metadata: run_metadata: 1,308 rows where devstage_curation = "Multi-stage" and technology = "smartseq"

1,308 rows where devstage_curation = "Multi-stage" and technology = "smartseq"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.title	sample.alias	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
24927	24927	SRR25557778	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L001_R1_001.fastq.gz	fastq	420092501.0	5668059.0	GSM7688794 r1	0:74.12	A:113006440;C:96725832;G:99320773;T:110915967;N:123489	74		113006440	96725832	99320773	110915967	123489	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94757		0.06229		0.72364		0.46676		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24928	24928	SRR25557779	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L002_R1_001.fastq.gz	fastq	421869780.0	5690053.0	GSM7688794 r2	0:74.14	A:113530489;C:97144227;G:99697959;T:111388539;N:108566	74		113530489	97144227	99697959	111388539	108566	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94921		0.06226		0.72462		0.4738		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24929	24929	SRR25557780	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L003_R1_001.fastq.gz	fastq	425064659.0	5734041.0	GSM7688794 r3	0:74.13	A:114342253;C:97873100;G:100532599;T:112196433;N:120274	74		114342253	97873100	100532599	112196433	120274	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94886		0.06112		0.72425		0.47055		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24930	24930	SRR25557781	SRX21286665	SRS18536778	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant XI	GSM7688794	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688794	GSM7688794: Morphant XI; Danio rerio; RNA Seq	GSM7688794 r1	GSM7688794	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-XI_S7_L004_R1_001.fastq.gz	fastq	416990548.0	5624902.0	GSM7688794 r4	0:74.13	A:112153356;C:96009158;G:98613145;T:110097476;N:117413	74		112153356	96009158	98613145	110097476	117413	SRX21286665	SRS18536778	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94869		0.06229		0.72506		0.47222		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24931	24931	SRR25557782	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L001_R1_001.fastq.gz	fastq	434485284.0	5881416.0	GSM7688793 r1	0:73.87	A:116640351;C:100176557;G:102659919;T:114799536;N:208921	73		116640351	100176557	102659919	114799536	208921	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94533		0.07176		0.72464		0.47632		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24932	24932	SRR25557783	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L002_R1_001.fastq.gz	fastq	435203869.0	5886556.0	GSM7688793 r2	0:73.93	A:116869356;C:100363580;G:102830644;T:114973504;N:166785	73		116869356	100363580	102830644	114973504	166785	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94542		0.07203		0.72421		0.47733		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24933	24933	SRR25557784	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L003_R1_001.fastq.gz	fastq	439897269.0	5951878.0	GSM7688793 r3	0:73.91	A:118101648;C:101426657;G:103990006;T:116184480;N:194478	73		118101648	101426657	103990006	116184480	194478	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94486		0.07224		0.72448		0.47915		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24934	24934	SRR25557785	SRX21286664	SRS18536777	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant X	GSM7688793	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688793	GSM7688793: Morphant X; Danio rerio; RNA Seq	GSM7688793 r1	GSM7688793	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-X_S6_L004_R1_001.fastq.gz	fastq	431385256.0	5836029.0	GSM7688793 r4	0:73.92	A:115804970;C:99459059;G:101962932;T:113975935;N:182360	73		115804970	99459059	101962932	113975935	182360	SRX21286664	SRS18536777	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94432		0.07229		0.7261		0.47463		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24935	24935	SRR25557786	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L001_R1_001.fastq.gz	fastq	513309395.0	6929648.0	GSM7688792 r1	0:74.07	A:137428462;C:118688804;G:122019962;T:134991729;N:180438	74		137428462	118688804	122019962	134991729	180438	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94188		0.07029		0.73772		0.47692		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24936	24936	SRR25557787	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L002_R1_001.fastq.gz	fastq	517356735.0	6982196.0	GSM7688792 r2	0:74.10	A:138524037;C:119650852;G:122965491;T:136056171;N:160184	74		138524037	119650852	122965491	136056171	160184	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94281		0.06967		0.73963		0.48142		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24937	24937	SRR25557788	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L003_R1_001.fastq.gz	fastq	519422328.0	7010631.0	GSM7688792 r3	0:74.09	A:139040684;C:120128748;G:123529198;T:136551898;N:171800	74		139040684	120128748	123529198	136551898	171800	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94297		0.06942		0.73726		0.47499		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24938	24938	SRR25557789	SRX21286663	SRS18536776	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant IX	GSM7688792	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688792	GSM7688792: Morphant IX; Danio rerio; RNA Seq	GSM7688792 r1	GSM7688792	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-IX_S16_L004_R1_001.fastq.gz	fastq	511640294.0	6905748.0	GSM7688792 r4	0:74.09	A:136914638;C:118302866;G:121704665;T:134543505;N:174620	74		136914638	118302866	121704665	134543505	174620	SRX21286663	SRS18536776	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94176		0.07029		0.73868		0.47987		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24939	24939	SRR25557790	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L001_R1_001.fastq.gz	fastq	429446821.0	5803178.0	GSM7688791 r1	0:74.00	A:114793535;C:99506379;G:102226914;T:112748761;N:171232	74		114793535	99506379	102226914	112748761	171232	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94175		0.06669		0.73673		0.48179		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24940	24940	SRR25557791	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L002_R1_001.fastq.gz	fastq	434629893.0	5870828.0	GSM7688791 r2	0:74.03	A:116216940;C:100703527;G:103463365;T:114092681;N:153380	74		116216940	100703527	103463365	114092681	153380	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94143		0.0676		0.73791		0.48091		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24941	24941	SRR25557792	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L003_R1_001.fastq.gz	fastq	435879881.0	5888685.0	GSM7688791 r3	0:74.02	A:116548094;C:100971153;G:103794902;T:114400770;N:164962	74		116548094	100971153	103794902	114400770	164962	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94195		0.06686		0.73785		0.48044		73		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24942	24942	SRR25557793	SRX21286662	SRS18536775	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VIII	GSM7688791	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688791	GSM7688791: Morphant VIII; Danio rerio; RNA Seq	GSM7688791 r1	GSM7688791	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VIII_S14_L004_R1_001.fastq.gz	fastq	429478475.0	5801978.0	GSM7688791 r4	0:74.02	A:114799280;C:99474677;G:102302775;T:112737475;N:164268	74		114799280	99474677	102302775	112737475	164268	SRX21286662	SRS18536775	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94118		0.06706		0.73892		0.47732		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24943	24943	SRR25557794	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L001_R1_001.fastq.gz	fastq	459545188.0	6215897.0	GSM7688790 r1	0:73.93	A:121926568;C:107379723;G:110263606;T:119766429;N:208862	73		121926568	107379723	110263606	119766429	208862	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94273		0.06072		0.74582		0.47499		73		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24944	24944	SRR25557795	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L002_R1_001.fastq.gz	fastq	463143624.0	6261406.0	GSM7688790 r2	0:73.97	A:122917997;C:108229793;G:111099867;T:120713978;N:181989	73		122917997	108229793	111099867	120713978	181989	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94387		0.06093		0.74341		0.47351		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24945	24945	SRR25557796	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L003_R1_001.fastq.gz	fastq	465959664.0	6300929.0	GSM7688790 r3	0:73.95	A:123689364;C:108847593;G:111847868;T:121377463;N:197376	73		123689364	108847593	111847868	121377463	197376	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94322		0.06219		0.74357		0.47977		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24946	24946	SRR25557797	SRX21286661	SRS18536774	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Morphant VII	GSM7688790	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant\|geo loc name:missing\|collection date:missing	Morphant VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:hmx2;hmx3a double knockdowm morphant\|treatment:hmx2;hmx3a double knockdowm morphant	GSM7688790	GSM7688790: Morphant VII; Danio rerio; RNA Seq	GSM7688790 r1	GSM7688790	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Morphant-VII_S15_L004_R1_001.fastq.gz	fastq	459075430.0	6207363.0	GSM7688790 r4	0:73.96	A:121797426;C:107221116;G:110209684;T:119657308;N:189896	73		121797426	107221116	110209684	119657308	189896	SRX21286661	SRS18536774	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94313		0.06211		0.74343		0.47801		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24947	24947	SRR25557798	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L001_R1_001.fastq.gz	fastq	439719566.0	5947052.0	GSM7688787 r1	0:73.94	A:117482073;C:102083665;G:104685444;T:115272860;N:195524	73		117482073	102083665	104685444	115272860	195524	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94829		0.06278		0.72525		0.46494		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24948	24948	SRR25557799	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L002_R1_001.fastq.gz	fastq	438533503.0	5927990.0	GSM7688787 r2	0:73.98	A:117199594;C:101810881;G:104402169;T:114946611;N:174248	73		117199594	101810881	104402169	114946611	174248	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94887		0.06387		0.72827		0.46616		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24949	24949	SRR25557800	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L003_R1_001.fastq.gz	fastq	443995554.0	6003540.0	GSM7688787 r3	0:73.96	A:118663936;C:103031716;G:105723574;T:116387834;N:188494	73		118663936	103031716	105723574	116387834	188494	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94788		0.06232		0.72693		0.46653		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24950	24950	SRR25557801	SRX21286660	SRS18536773	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control XI	GSM7688787	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control XI	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688787	GSM7688787: Control XI; Danio rerio; RNA Seq	GSM7688787 r1	GSM7688787	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-XI_S2_L004_R1_001.fastq.gz	fastq	435088869.0	5882642.0	GSM7688787 r4	0:73.96	A:116261447;C:100986653;G:103615584;T:114042354;N:182831	73		116261447	100986653	103615584	114042354	182831	SRX21286660	SRS18536773	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94914		0.06241		0.72829		0.4546		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24951	24951	SRR25557802	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L001_R1_001.fastq.gz	fastq	395130702.0	5338263.0	GSM7688785 r1	0:74.02	A:107005793;C:90183031;G:92316770;T:105476481;N:148627	74		107005793	90183031	92316770	105476481	148627	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94534		0.07625		0.73888		0.48135		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24952	24952	SRR25557803	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L002_R1_001.fastq.gz	fastq	396764458.0	5358448.0	GSM7688785 r2	0:74.04	A:107513717;C:90540282;G:92658504;T:105917444;N:134511	74		107513717	90540282	92658504	105917444	134511	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94374		0.07709		0.73878		0.47615		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24953	24953	SRR25557804	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L003_R1_001.fastq.gz	fastq	399623551.0	5397520.0	GSM7688785 r3	0:74.04	A:108230540;C:91192011;G:93388052;T:106665106;N:147842	74		108230540	91192011	93388052	106665106	147842	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94399		0.07657		0.73797		0.4794		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24954	24954	SRR25557805	SRX21286659	SRS18536772	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control X	GSM7688785	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control X	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688785	GSM7688785: Control X; Danio rerio; RNA Seq	GSM7688785 r1	GSM7688785	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-X_S1_L004_R1_001.fastq.gz	fastq	393298978.0	5312101.0	GSM7688785 r4	0:74.04	A:106518845;C:89734564;G:91901232;T:105004490;N:139847	74		106518845	89734564	91901232	105004490	139847	SRX21286659	SRS18536772	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94423		0.07599		0.73884		0.47905		71		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24955	24955	SRR25557806	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L001_R1_001.fastq.gz	fastq	366045799.0	4944832.0	GSM7688783 r1	0:74.03	A:98000119;C:84654222;G:86951226;T:96295351;N:144881	74		98000119	84654222	86951226	96295351	144881	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94303		0.07499		0.73085		0.47881		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24956	24956	SRR25557807	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L002_R1_001.fastq.gz	fastq	369429068.0	4988719.0	GSM7688783 r2	0:74.05	A:98907882;C:85446993;G:87729593;T:97216477;N:128123	74		98907882	85446993	87729593	97216477	128123	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94261		0.07335		0.72969		0.47867		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24957	24957	SRR25557808	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L003_R1_001.fastq.gz	fastq	369967330.0	4996710.0	GSM7688783 r3	0:74.04	A:99035743;C:85549878;G:87926587;T:97310812;N:144310	74		99035743	85549878	87926587	97310812	144310	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94328		0.0743		0.73034		0.47133		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24958	24958	SRR25557809	SRX21286658	SRS18536771	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control IX	GSM7688783	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control IX	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688783	GSM7688783: Control IX; Danio rerio; RNA Seq	GSM7688783 r1	GSM7688783	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-IX_S22_L004_R1_001.fastq.gz	fastq	365499176.0	4936305.0	GSM7688783 r4	0:74.04	A:97825658;C:84517732;G:86863655;T:96157429;N:134702	74		97825658	84517732	86863655	96157429	134702	SRX21286658	SRS18536771	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94286		0.07288		0.72999		0.4783		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24959	24959	SRR25557810	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L001_R1_001.fastq.gz	fastq	488585907.0	6585668.0	GSM7688782 r1	0:74.19	A:131727468;C:112349971;G:115189425;T:129203159;N:115884	74		131727468	112349971	115189425	129203159	115884	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93794		0.07381		0.7315		0.47355		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24960	24960	SRR25557811	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L002_R1_001.fastq.gz	fastq	493766544.0	6653820.0	GSM7688782 r2	0:74.21	A:133135166;C:113551418;G:116398455;T:130575771;N:105734	74		133135166	113551418	116398455	130575771	105734	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93729		0.07312		0.7307		0.47966		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24961	24961	SRR25557812	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L003_R1_001.fastq.gz	fastq	494935071.0	6670024.0	GSM7688782 r3	0:74.20	A:133406912;C:113769494;G:116771560;T:130871612;N:115493	74		133406912	113769494	116771560	130871612	115493	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93847		0.07383		0.73194		0.47646		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24962	24962	SRR25557813	SRX21286657	SRS18536770	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VIII	GSM7688782	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VIII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688782	GSM7688782: Control VIII; Danio rerio; RNA Seq	GSM7688782 r1	GSM7688782	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VIII_S20_L004_R1_001.fastq.gz	fastq	487644286.0	6572100.0	GSM7688782 r4	0:74.20	A:131423055;C:112092623;G:115067911;T:128945959;N:114738	74		131423055	112092623	115067911	128945959	114738	SRX21286657	SRS18536770	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.93708		0.0732		0.73186		0.4781		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24963	24963	SRR25557814	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L001_R1_001.fastq.gz	fastq	419048369.0	5664168.0	GSM7688781 r1	0:73.98	A:111569757;C:97553687;G:100228004;T:109523480;N:173441	73		111569757	97553687	100228004	109523480	173441	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94179		0.06596		0.74499		0.46809		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24964	24964	SRR25557815	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L002_R1_001.fastq.gz	fastq	422419362.0	5707444.0	GSM7688781 r2	0:74.01	A:112476977;C:98366185;G:101046586;T:110369882;N:159732	74		112476977	98366185	101046586	110369882	159732	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94275		0.06539		0.74523		0.47247		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24965	24965	SRR25557816	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L003_R1_001.fastq.gz	fastq	424260551.0	5733133.0	GSM7688781 r3	0:74.00	A:112957538;C:98789480;G:101496747;T:110850186;N:166600	74		112957538	98789480	101496747	110850186	166600	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94174		0.06482		0.74304		0.46935		75		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
24966	24966	SRR25557817	SRX21286656	SRS18536769	SRP453884	PRJNA1003026	Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]	GSE240238	Transcriptome Analysis	Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s…	parent bioproject:PRJNA1003022	pubmed:38017520	Control VII	GSM7688781	source name:Spinal Cord\|tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control\|geo loc name:missing\|collection date:missing	Control VII	We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.	Spinal Cord	The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …	The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.	tissue:Spinal Cord\|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41\|cell type:V1 and dI2 spinal interneurons\|genotype:Wild type\|treatment:Uninjected control	GSM7688781	GSM7688781: Control VII; Danio rerio; RNA Seq	GSM7688781 r1	GSM7688781	1	Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP453884	loader:fastq load.py	Control-VII_S21_L004_R1_001.fastq.gz	fastq	417875320.0	5646817.0	GSM7688781 r4	0:74.00	A:111226895;C:97273168;G:100030641;T:109182520;N:162096	74		111226895	97273168	100030641	109182520	162096	SRX21286656	SRS18536769	SRA1688461	Lewis Lab, Biology, Syracuse University	Lewis Lab, Biology, Syracuse University	1	0.94352		0.06524		0.74442		0.47095		74		B		usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2023-08-07	Multi-stage	Embryo	Spinal Cord	Nervous System
31773	31773	SRR28590145	SRX24189497	SRS20963520	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393	WT shield PGCs RNA rep2	GSM8193374	source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type\|geo loc name:missing\|collection date:missing	WT shield PGCs RNA rep2	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 214 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type	GSM8193374	GSM8193374: WT shield PGCs RNA rep2; Danio rerio; RNA Seq	GSM8193374 r1	GSM8193374	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320		WT_shield_PGCs_RNA_rep2_r1.fq.gz WT_shield_PGCs_RNA_rep2_r2.fq.gz	fastq fastq	1476298800.0	4920996.0	GSM8193374 r1	0:150 1:150	A:364072227;C:345274481;G:387289011;T:379660776;N:2305	150	150	364072227	345274481	387289011	379660776	2305	SRX24189497	SRS20963520	SRA1842063	Tsinghua University	Tsinghua University	2	0.9277	0.92845	0.26727	0.2672	0.86803	0.86969	0.75933	0.75985	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31774	31774	SRR28590146	SRX24189496	SRS20963519	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393	WT shield PGCs RNA rep1	GSM8193373	source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type\|geo loc name:missing\|collection date:missing	WT shield PGCs RNA rep1	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 212 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type	GSM8193373	GSM8193373: WT shield PGCs RNA rep1; Danio rerio; RNA Seq	GSM8193373 r1	GSM8193373	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320		WT_shield_PGCs_RNA_rep1_r2.fq.gz WT_shield_PGCs_RNA_rep1_r1.fq.gz	fastq fastq	2758778100.0	9195927.0	GSM8193373 r1	0:150 1:150	A:769058521;C:582931819;G:614181069;T:792602904;N:3787	150	150	769058521	582931819	614181069	792602904	3787	SRX24189496	SRS20963519	SRA1842063	Tsinghua University	Tsinghua University	2	0.93691	0.91581	0.06844	0.06665	0.7683	0.76995	0.53645	0.52363	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31775	31775	SRR28590147	SRX24189495	SRS20963518	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393	WT bud PGCs RNA rep2	GSM8193372	source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type\|geo loc name:missing\|collection date:missing	WT bud PGCs RNA rep2	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 210 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type	GSM8193372	GSM8193372: WT bud PGCs RNA rep2; Danio rerio; RNA Seq	GSM8193372 r1	GSM8193372	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320		WT_bud_PGCs_RNA_rep2_r1.fq.gz WT_bud_PGCs_RNA_rep2_r2.fq.gz	fastq fastq	3111261300.0	10370871.0	GSM8193372 r1	0:150 1:150	A:817262319;C:691724200;G:751270343;T:850999265;N:5173	150	150	817262319	691724200	751270343	850999265	5173	SRX24189495	SRS20963518	SRA1842063	Tsinghua University	Tsinghua University	2	0.90729	0.9053	0.11596	0.1166	0.79963	0.79981	0.60276	0.59912	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31776	31776	SRR28590148	SRX24189494	SRS20963517	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393	WT bud PGCs RNA rep1	GSM8193371	source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type\|geo loc name:missing\|collection date:missing	WT bud PGCs RNA rep1	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 208 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:Wile type	GSM8193371	GSM8193371: WT bud PGCs RNA rep1; Danio rerio; RNA Seq	GSM8193371 r1	GSM8193371	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320		WT_bud_PGCs_RNA_rep1_r1.fq.gz WT_bud_PGCs_RNA_rep1_r2.fq.gz	fastq fastq	3758269200.0	12527564.0	GSM8193371 r1	0:150 1:150	A:1041649283;C:801966468;G:845188264;T:1069459832;N:5353	150	150	1041649283	801966468	845188264	1069459832	5353	SRX24189494	SRS20963517	SRA1842063	Tsinghua University	Tsinghua University	2	0.93714	0.91161	0.07974	0.07673	0.75785	0.76037	0.52906	0.52822	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31777	31777	SRR28590149	SRX24189493	SRS20963516	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393	pigu homo shield PGCs RNA rep2	GSM8193370	source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo\|geo loc name:missing\|collection date:missing	pigu homo shield PGCs RNA rep2	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 206 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo	GSM8193370	GSM8193370: pigu homo shield PGCs RNA rep2; Danio rerio; RNA Seq	GSM8193370 r1	GSM8193370	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320		pigu_homo_shield_PGCs_RNA_rep2_r2.fq.gz pigu_homo_shield_PGCs_RNA_rep2_r1.fq.gz	fastq fastq	875630700.0	2918769.0	GSM8193370 r1	0:150 1:150	A:229625544;C:190227589;G:217096984;T:238679075;N:1508	150	150	229625544	190227589	217096984	238679075	1508	SRX24189493	SRS20963516	SRA1842063	Tsinghua University	Tsinghua University	2	0.81852	0.81643	0.19346	0.19329	0.89852	0.89897	0.83525	0.83082	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31778	31778	SRR28590150	SRX24189492	SRS20963515	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393	pigu homo shield PGCs RNA rep1	GSM8193369	source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo\|geo loc name:missing\|collection date:missing	pigu homo shield PGCs RNA rep1	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 204 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo	GSM8193369	GSM8193369: pigu homo shield PGCs RNA rep1; Danio rerio; RNA Seq	GSM8193369 r1	GSM8193369	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320		pigu_homo_shield_PGCs_RNA_rep1_r2.fq.gz pigu_homo_shield_PGCs_RNA_rep1_r1.fq.gz	fastq fastq	2204383800.0	7347946.0	GSM8193369 r1	0:150 1:150	A:618947181;C:459789570;G:491705141;T:633938869;N:3039	150	150	618947181	459789570	491705141	633938869	3039	SRX24189492	SRS20963515	SRA1842063	Tsinghua University	Tsinghua University	2	0.91971	0.9203	0.0732	0.07256	0.77512	0.77516	0.53347	0.53419	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31779	31779	SRR28590151	SRX24189491	SRS20963514	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393	pigu homo bud PGCs RNA rep2	GSM8193368	source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo\|geo loc name:missing\|collection date:missing	pigu homo bud PGCs RNA rep2	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 202 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo	GSM8193368	GSM8193368: pigu homo bud PGCs RNA rep2; Danio rerio; RNA Seq	GSM8193368 r1	GSM8193368	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320		pigu_homo_bud_PGCs_RNA_rep2_r1.fq.gz pigu_homo_bud_PGCs_RNA_rep2_r2.fq.gz	fastq fastq	2137638000.0	7125460.0	GSM8193368 r1	0:150 1:150	A:588045273;C:460739300;G:496293927;T:592556088;N:3412	150	150	588045273	460739300	496293927	592556088	3412	SRX24189491	SRS20963514	SRA1842063	Tsinghua University	Tsinghua University	2	0.36533	0.36278	0.05703	0.057	0.87754	0.87811	0.60206	0.59677	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
31780	31780	SRR28590152	SRX24189490	SRS20963513	SRP500320	PRJNA1097627	GPI transamidase complex is required for primordial germ cell migration and development in zebrafish	GSE263481	Transcriptome Analysis	Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.		pubmed:39741393	pigu homo bud PGCs RNA rep1	GSM8193367	source name:embryo\|tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo\|geo loc name:missing\|collection date:missing	pigu homo bud PGCs RNA rep1	RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples	embryo	GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.	The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.	tissue:embryo\|cell line:germ cell\|cell type:PGCs\|genotype:pigu homo	GSM8193367	GSM8193367: pigu homo bud PGCs RNA rep1; Danio rerio; RNA Seq	GSM8193367 r1	GSM8193367	1	Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500	SRP500320		pigu_homo_bud_PGCs_RNA_rep1_r1.fq.gz pigu_homo_bud_PGCs_RNA_rep1_r2.fq.gz	fastq fastq	2734187100.0	9113957.0	GSM8193367 r1	0:150 1:150	A:729072634;C:614811431;G:644751435;T:745548063;N:3537	150	150	729072634	614811431	644751435	745548063	3537	SRX24189490	SRS20963513	SRA1842063	Tsinghua University	Tsinghua University	2	0.94018	0.93763	0.11685	0.1143	0.77749	0.78204	0.50988	0.50832	150	150	B	B	biological fallback assumption	illumina	nextseq	unknown	poly_a	unknown	sc	single_cell_plate	smartseq	China	2024-04-08	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35474	35474	SRR32818793	SRX28102226	SRS24458273	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570	sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4	GSM8863184	source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf	GSM8863184	GSM8863184: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4; Danio rerio; RNA Seq	GSM8863184 r1	GSM8863184	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438		p48-4-READ1-Sequences.txt p48-4-READ2-Sequences.txt	fastq fastq	6624217400.0	33121087.0	GSM8863184 r1	0:100 1:100	A:1723006485;C:1604147349;G:1556891221;T:1739763662;N:408683	100	100	1723006485	1604147349	1556891221	1739763662	408683	SRX28102226	SRS24458273	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35475	35475	SRR32818794	SRX28102225	SRS24458272	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570	sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3	GSM8863183	source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf	GSM8863183	GSM8863183: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3; Danio rerio; RNA Seq	GSM8863183 r1	GSM8863183	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438		p48-3-READ1-Sequences.txt p48-3-READ2-Sequences.txt	fastq fastq	5127128400.0	25635642.0	GSM8863183 r1	0:100 1:100	A:1321647066;C:1250868808;G:1210591826;T:1343703952;N:316748	100	100	1321647066	1250868808	1210591826	1343703952	316748	SRX28102225	SRS24458272	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35476	35476	SRR32818795	SRX28102224	SRS24458271	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570	sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2	GSM8863182	source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf	GSM8863182	GSM8863182: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2; Danio rerio; RNA Seq	GSM8863182 r1	GSM8863182	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438		p48-2-READ1-Sequences.txt p48-2-READ2-Sequences.txt	fastq fastq	6832644200.0	34163221.0	GSM8863182 r1	0:100 1:100	A:1762283242;C:1668293067;G:1612470421;T:1789177247;N:420223	100	100	1762283242	1668293067	1612470421	1789177247	420223	SRX28102224	SRS24458271	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35477	35477	SRR32818796	SRX28102223	SRS24458270	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570	sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1	GSM8863181	source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf	GSM8863181	GSM8863181: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1; Danio rerio; RNA Seq	GSM8863181 r1	GSM8863181	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438		p48-1-READ1-Sequences.txt p48-1-READ2-Sequences.txt	fastq fastq	6861200200.0	34306001.0	GSM8863181 r1	0:100 1:100	A:1765390165;C:1682522416;G:1623224185;T:1789639564;N:423870	100	100	1765390165	1682522416	1623224185	1789639564	423870	SRX28102223	SRS24458270	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35478	35478	SRR32818797	SRX28102222	SRS24458269	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 7	GSM8863180	source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 7	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863180	GSM8863180: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 7; Danio rerio; RNA Seq	GSM8863180 r1	GSM8863180	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438		p36-7-READ1-Sequences.txt p36-7-READ2-Sequences.txt	fastq fastq	5620392000.0	28101960.0	GSM8863180 r1	0:100 1:100	A:1445709762;C:1377367138;G:1310017425;T:1486952834;N:344841	100	100	1445709762	1377367138	1310017425	1486952834	344841	SRX28102222	SRS24458269	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35479	35479	SRR32818798	SRX28102221	SRS24458268	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 6	GSM8863179	source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 6	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863179	GSM8863179: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 6; Danio rerio; RNA Seq	GSM8863179 r1	GSM8863179	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438		p36-6-READ1-Sequences.txt p36-6-READ2-Sequences.txt	fastq fastq	7568489000.0	37842445.0	GSM8863179 r1	0:100 1:100	A:1969395695;C:1827574975;G:1754405241;T:2016644374;N:468715	100	100	1969395695	1827574975	1754405241	2016644374	468715	SRX28102221	SRS24458268	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35480	35480	SRR32818799	SRX28102220	SRS24458267	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 5	GSM8863178	source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 5	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863178	GSM8863178: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 5; Danio rerio; RNA Seq	GSM8863178 r1	GSM8863178	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438		p36-5-READ1-Sequences.txt p36-5-READ2-Sequences.txt	fastq fastq	6657832800.0	33289164.0	GSM8863178 r1	0:100 1:100	A:1726677355;C:1613449895;G:1548951675;T:1768343661;N:410214	100	100	1726677355	1613449895	1548951675	1768343661	410214	SRX28102220	SRS24458267	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35481	35481	SRR32818800	SRX28102219	SRS24458266	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 4	GSM8863177	source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 4	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863177	GSM8863177: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 4; Danio rerio; RNA Seq	GSM8863177 r1	GSM8863177	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438		p36-4-READ1-Sequences.txt p36-4-READ2-Sequences.txt	fastq fastq	5153263800.0	25766319.0	GSM8863177 r1	0:100 1:100	A:1334474056;C:1251026482;G:1191417010;T:1376027996;N:318256	100	100	1334474056	1251026482	1191417010	1376027996	318256	SRX28102219	SRS24458266	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35482	35482	SRR32818801	SRX28102218	SRS24458265	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 3	GSM8863176	source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 3	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863176	GSM8863176: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 3; Danio rerio; RNA Seq	GSM8863176 r1	GSM8863176	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438		p36-3-READ1-Sequences.txt p36-3-READ2-Sequences.txt	fastq fastq	6089823000.0	30449115.0	GSM8863176 r1	0:100 1:100	A:1565216204;C:1493655703;G:1438012972;T:1592561753;N:376368	100	100	1565216204	1493655703	1438012972	1592561753	376368	SRX28102218	SRS24458265	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35483	35483	SRR32818802	SRX28102217	SRS24458264	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 2	GSM8863175	source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 2	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863175	GSM8863175: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 2; Danio rerio; RNA Seq	GSM8863175 r1	GSM8863175	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438		p36-2-READ1-Sequences.txt p36-2-READ2-Sequences.txt	fastq fastq	5575798600.0	27878993.0	GSM8863175 r1	0:100 1:100	A:1443367045;C:1355595610;G:1298738880;T:1477753374;N:343691	100	100	1443367045	1355595610	1298738880	1477753374	343691	SRX28102217	SRS24458264	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
35484	35484	SRR32818803	SRX28102216	SRS24458263	SRP572438	PRJNA1240805	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset	GSE292682	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.		pubmed:40145570	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 1	GSM8863174	source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 1	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos		36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:36 hpf	GSM8863174	GSM8863174: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 1; Danio rerio; RNA Seq	GSM8863174 r1	GSM8863174	1	36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000	SRP572438		p36-1-READ1-Sequences.txt p36-1-READ2-Sequences.txt	fastq fastq	6686065200.0	33430326.0	GSM8863174 r1	0:100 1:100	A:1705825267;C:1656952667;G:1564381164;T:1758493189;N:412913	100	100	1705825267	1656952667	1564381164	1758493189	412913	SRX28102216	SRS24458263	SRA2098458	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	hiseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_plate	smartseq	United States	2025-03-23	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38457	38457	SRR1873001	SRX914893	SRS869409	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S366	GSM1629126	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S366	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629126	GSM1629126: zf3 dis S366; Danio rerio; RNA Seq	GSM1629126		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629126	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S366.R2.fq zf3_dis_S366.R1.fq	fastq fastq	13953150.0	279063.0	GSM1629126 r1	0:25 1:25	A:3638478;C:3221565;G:3250022;T:3754586;N:88499	25	25	3638478	3221565	3250022	3754586	88499	SRX914893	SRS869409	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.68547	0.72347	0.17435	0.1776	0.89883	0.87645	0.78642	0.70697	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38458	38458	SRR1873000	SRX914892	SRS869415	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S365	GSM1629125	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S365	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629125	GSM1629125: zf3 dis S365; Danio rerio; RNA Seq	GSM1629125		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629125	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S365.R1.fq zf3_dis_S365.R2.fq	fastq fastq	18319750.0	366395.0	GSM1629125 r1	0:25 1:25	A:4713431;C:4306960;G:4405843;T:4784636;N:108880	25	25	4713431	4306960	4405843	4784636	108880	SRX914892	SRS869415	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.45031	0.41097	0.17574	0.16675	0.91098	0.92383	0.57619	0.61898	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38459	38459	SRR1872999	SRX914891	SRS869411	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S364	GSM1629124	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S364	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629124	GSM1629124: zf3 dis S364; Danio rerio; RNA Seq	GSM1629124		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629124	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S364.R1.fq zf3_dis_S364.R2.fq	fastq fastq	16291400.0	325828.0	GSM1629124 r1	0:25 1:25	A:4127905;C:3884549;G:3934831;T:4281925;N:62190	25	25	4127905	3884549	3934831	4281925	62190	SRX914891	SRS869411	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.64233	0.58456	0.18268	0.16828	0.89079	0.91056	0.69046	0.76873	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38460	38460	SRR1872998	SRX914890	SRS869413	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S363	GSM1629123	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S363	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629123	GSM1629123: zf3 dis S363; Danio rerio; RNA Seq	GSM1629123		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629123	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S363.R1.fq zf3_dis_S363.R2.fq	fastq fastq	24979500.0	499590.0	GSM1629123 r1	0:25 1:25	A:6522125;C:5838067;G:5906327;T:6630372;N:82609	25	25	6522125	5838067	5906327	6630372	82609	SRX914890	SRS869413	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.78356	0.7193	0.35183	0.32737	0.85096	0.86953	0.65229	0.72787	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38461	38461	SRR1872997	SRX914889	SRS869410	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S362	GSM1629122	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S362	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629122	GSM1629122: zf3 dis S362; Danio rerio; RNA Seq	GSM1629122		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629122	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S362.R1.fq zf3_dis_S362.R2.fq	fastq fastq	25961150.0	519223.0	GSM1629122 r1	0:25 1:25	A:6513860;C:6274276;G:6330224;T:6742925;N:99865	25	25	6513860	6274276	6330224	6742925	99865	SRX914889	SRS869410	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.64392	0.70212	0.20822	0.2179	0.90449	0.88544	0.7447	0.66953	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38462	38462	SRR1872996	SRX914888	SRS869414	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S361	GSM1629121	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S361	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629121	GSM1629121: zf3 dis S361; Danio rerio; RNA Seq	GSM1629121		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629121	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S361.R1.fq zf3_dis_S361.R2.fq	fastq fastq	31158400.0	623168.0	GSM1629121 r1	0:25 1:25	A:8003929;C:7345167;G:7419409;T:8283464;N:106431	25	25	8003929	7345167	7419409	8283464	106431	SRX914888	SRS869414	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.69021	0.64535	0.18688	0.18054	0.86624	0.88789	0.69784	0.78517	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38463	38463	SRR1872995	SRX914887	SRS869416	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S360	GSM1629120	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S360	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629120	GSM1629120: zf3 dis S360; Danio rerio; RNA Seq	GSM1629120		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629120	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S360.R1.fq zf3_dis_S360.R2.fq	fastq fastq	65650.0	1313.0	GSM1629120 r1	0:25 1:25	A:16756;C:15635;G:13912;T:19083;N:264	25	25	16756	15635	13912	19083	264	SRX914887	SRS869416	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.6792	0.7566	0.21098	0.22718	0.99823	0.99667	0.76729	0.68093	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38464	38464	SRR1872994	SRX914886	SRS869408	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S359	GSM1629119	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S359	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629119	GSM1629119: zf3 dis S359; Danio rerio; RNA Seq	GSM1629119		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629119	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S359.R1.fq zf3_dis_S359.R2.fq	fastq fastq	11699050.0	233981.0	GSM1629119 r1	0:25 1:25	A:3029078;C:2720012;G:2748834;T:3147149;N:53977	25	25	3029078	2720012	2748834	3147149	53977	SRX914886	SRS869408	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.73706	0.69089	0.16704	0.16123	0.88795	0.90696	0.71161	0.78714	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38465	38465	SRR1872993	SRX914885	SRS869417	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S358	GSM1629118	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S358	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629118	GSM1629118: zf3 dis S358; Danio rerio; RNA Seq	GSM1629118		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629118	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S358.R2.fq zf3_dis_S358.R1.fq	fastq fastq	9555800.0	191116.0	GSM1629118 r1	0:25 1:25	A:2455617;C:2236174;G:2275012;T:2547459;N:41538	25	25	2455617	2236174	2275012	2547459	41538	SRX914885	SRS869417	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.71513	0.67049	0.20389	0.18909	0.90289	0.91758	0.72281	0.78587	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38466	38466	SRR1872992	SRX914884	SRS869420	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S357	GSM1629117	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S357	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629117	GSM1629117: zf3 dis S357; Danio rerio; RNA Seq	GSM1629117		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629117	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S357.R1.fq zf3_dis_S357.R2.fq	fastq fastq	6685400.0	133708.0	GSM1629117 r1	0:25 1:25	A:1794401;C:1506998;G:1499676;T:1830754;N:53571	25	25	1794401	1506998	1499676	1830754	53571	SRX914884	SRS869420	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.51579	0.51107	0.13925	0.12582	0.95089	0.95828	0.33071	0.8304	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38467	38467	SRR1872991	SRX914883	SRS869418	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S356	GSM1629116	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S356	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629116	GSM1629116: zf3 dis S356; Danio rerio; RNA Seq	GSM1629116		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629116	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S356.R2.fq zf3_dis_S356.R1.fq	fastq fastq	11637750.0	232755.0	GSM1629116 r1	0:25 1:25	A:2892151;C:2796777;G:2856920;T:3041989;N:49913	25	25	2892151	2796777	2856920	3041989	49913	SRX914883	SRS869418	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.78167	0.71632	0.23745	0.21955	0.89262	0.91054	0.67329	0.74109	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38468	38468	SRR1872990	SRX914882	SRS869419	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S355	GSM1629115	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S355	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629115	GSM1629115: zf3 dis S355; Danio rerio; RNA Seq	GSM1629115		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629115	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S355.R2.fq zf3_dis_S355.R1.fq	fastq fastq	16269550.0	325391.0	GSM1629115 r1	0:25 1:25	A:4085539;C:3887330;G:3971738;T:4261948;N:62995	25	25	4085539	3887330	3971738	4261948	62995	SRX914882	SRS869419	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.67445	0.74201	0.22487	0.24114	0.90473	0.88637	0.73772	0.66677	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38469	38469	SRR1872989	SRX914881	SRS869421	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S354	GSM1629114	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S354	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629114	GSM1629114: zf3 dis S354; Danio rerio; RNA Seq	GSM1629114		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629114	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S354.R1.fq zf3_dis_S354.R2.fq	fastq fastq	17585450.0	351709.0	GSM1629114 r1	0:25 1:25	A:4659589;C:4039300;G:4045812;T:4733042;N:107707	25	25	4659589	4039300	4045812	4733042	107707	SRX914881	SRS869421	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.4878	0.45754	0.15743	0.15052	0.91849	0.9321	0.70142	0.77697	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38470	38470	SRR1872988	SRX914880	SRS869422	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S353	GSM1629113	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S353	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629113	GSM1629113: zf3 dis S353; Danio rerio; RNA Seq	GSM1629113		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629113	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S353.R2.fq zf3_dis_S353.R1.fq	fastq fastq	14485550.0	289711.0	GSM1629113 r1	0:25 1:25	A:3738800;C:3399635;G:3435347;T:3844352;N:67416	25	25	3738800	3399635	3435347	3844352	67416	SRX914880	SRS869422	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.62055	0.56082	0.17925	0.17361	0.88698	0.90761	0.63705	0.72713	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38471	38471	SRR1872987	SRX914879	SRS869427	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S352	GSM1629112	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S352	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629112	GSM1629112: zf3 dis S352; Danio rerio; RNA Seq	GSM1629112		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629112	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S352.R1.fq zf3_dis_S352.R2.fq	fastq fastq	20656250.0	413125.0	GSM1629112 r1	0:25 1:25	A:5409278;C:4778324;G:4823018;T:5565607;N:80023	25	25	5409278	4778324	4823018	5565607	80023	SRX914879	SRS869427	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.7596	0.69086	0.29648	0.27453	0.84843	0.87265	0.65665	0.73501	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38472	38472	SRR1872986	SRX914878	SRS869407	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S351	GSM1629111	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S351	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629111	GSM1629111: zf3 dis S351; Danio rerio; RNA Seq	GSM1629111		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629111	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S351.R2.fq zf3_dis_S351.R1.fq	fastq fastq	18878500.0	377570.0	GSM1629111 r1	0:25 1:25	A:4794224;C:4526355;G:4554783;T:4925799;N:77339	25	25	4794224	4526355	4554783	4925799	77339	SRX914878	SRS869407	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.59735	0.65152	0.17597	0.18275	0.91204	0.89367	0.73252	0.66132	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38473	38473	SRR1872985	SRX914877	SRS869426	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S350	GSM1629110	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S350	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629110	GSM1629110: zf3 dis S350; Danio rerio; RNA Seq	GSM1629110		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629110	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S350.R2.fq zf3_dis_S350.R1.fq	fastq fastq	18015150.0	360303.0	GSM1629110 r1	0:25 1:25	A:4757233;C:4120910;G:4152471;T:4865140;N:119396	25	25	4757233	4120910	4152471	4865140	119396	SRX914877	SRS869426	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.59623	0.55628	0.16688	0.15933	0.89016	0.90946	0.68088	0.39729	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38474	38474	SRR1872984	SRX914876	SRS869425	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S349	GSM1629109	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S349	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629109	GSM1629109: zf3 dis S349; Danio rerio; RNA Seq	GSM1629109		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629109	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S349.R1.fq zf3_dis_S349.R2.fq	fastq fastq	18552750.0	371055.0	GSM1629109 r1	0:25 1:25	A:4713675;C:4414123;G:4487632;T:4865002;N:72318	25	25	4713675	4414123	4487632	4865002	72318	SRX914876	SRS869425	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.73956	0.66864	0.29185	0.26915	0.8728	0.89185	0.64518	0.71455	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38475	38475	SRR1872983	SRX914875	SRS869424	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S348	GSM1629108	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S348	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629108	GSM1629108: zf3 dis S348; Danio rerio; RNA Seq	GSM1629108		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629108	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S348.R1.fq zf3_dis_S348.R2.fq	fastq fastq	18364000.0	367280.0	GSM1629108 r1	0:25 1:25	A:4467688;C:4489708;G:4651022;T:4688256;N:67326	25	25	4467688	4489708	4651022	4688256	67326	SRX914875	SRS869424	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.82371	0.74488	0.27118	0.25268	0.86758	0.8886	0.65639	0.72281	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38476	38476	SRR1872982	SRX914874	SRS869429	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S347	GSM1629107	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S347	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629107	GSM1629107: zf3 dis S347; Danio rerio; RNA Seq	GSM1629107		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629107	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S347.R1.fq zf3_dis_S347.R2.fq	fastq fastq	21064200.0	421284.0	GSM1629107 r1	0:25 1:25	A:5412410;C:4977004;G:4997675;T:5572725;N:104386	25	25	5412410	4977004	4997675	5572725	104386	SRX914874	SRS869429	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.5825	0.54487	0.15602	0.14912	0.89053	0.91094	0.71218	0.79095	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38477	38477	SRR1872981	SRX914873	SRS869428	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S346	GSM1629106	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S346	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629106	GSM1629106: zf3 dis S346; Danio rerio; RNA Seq	GSM1629106		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629106	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S346.R1.fq zf3_dis_S346.R2.fq	fastq fastq	14579650.0	291593.0	GSM1629106 r1	0:25 1:25	A:3652547;C:3477071;G:3552653;T:3844470;N:52909	25	25	3652547	3477071	3552653	3844470	52909	SRX914873	SRS869428	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.84569	0.77715	0.24465	0.23283	0.87651	0.89706	0.69586	0.77338	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38478	38478	SRR1872980	SRX914872	SRS869430	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S345	GSM1629105	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S345	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629105	GSM1629105: zf3 dis S345; Danio rerio; RNA Seq	GSM1629105		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629105	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S345.R1.fq zf3_dis_S345.R2.fq	fastq fastq	19894100.0	397882.0	GSM1629105 r1	0:25 1:25	A:4978487;C:4785641;G:4877454;T:5178846;N:73672	25	25	4978487	4785641	4877454	5178846	73672	SRX914872	SRS869430	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.80074	0.73644	0.28821	0.27089	0.87452	0.89213	0.68194	0.75059	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38479	38479	SRR1872979	SRX914871	SRS869433	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S344	GSM1629104	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S344	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629104	GSM1629104: zf3 dis S344; Danio rerio; RNA Seq	GSM1629104		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629104	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S344.R2.fq zf3_dis_S344.R1.fq	fastq fastq	21335200.0	426704.0	GSM1629104 r1	0:25 1:25	A:5277911;C:5144153;G:5264908;T:5565367;N:82861	25	25	5277911	5144153	5264908	5565367	82861	SRX914871	SRS869433	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.72171	0.80382	0.21052	0.21995	0.89061	0.86695	0.72932	0.64495	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38480	38480	SRR1872978	SRX914870	SRS869431	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S343	GSM1629103	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S343	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629103	GSM1629103: zf3 dis S343; Danio rerio; RNA Seq	GSM1629103		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629103	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S343.R1.fq zf3_dis_S343.R2.fq	fastq fastq	19911000.0	398220.0	GSM1629103 r1	0:25 1:25	A:4923353;C:4815086;G:4933744;T:5166820;N:71997	25	25	4923353	4815086	4933744	5166820	71997	SRX914870	SRS869431	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.79232	0.71735	0.23984	0.22867	0.88943	0.91074	0.64925	0.73421	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38481	38481	SRR1872977	SRX914869	SRS869432	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1800	GSM1629102	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1800	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629102	GSM1629102: zf3 dis S1800; Danio rerio; RNA Seq	GSM1629102		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629102	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1800.R1.fq zf3_dis_S1800.R2.fq	fastq fastq	10790700.0	215814.0	GSM1629102 r1	0:25 1:25	A:2721576;C:2556263;G:2606994;T:2865815;N:40052	25	25	2721576	2556263	2606994	2865815	40052	SRX914869	SRS869432	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.76882	0.8569	0.22815	0.24284	0.90851	0.88925	0.73921	0.67204	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38482	38482	SRR1872976	SRX914868	SRS869434	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1799	GSM1629101	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1799	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629101	GSM1629101: zf3 dis S1799; Danio rerio; RNA Seq	GSM1629101		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629101	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1799.R1.fq zf3_dis_S1799.R2.fq	fastq fastq	5593150.0	111863.0	GSM1629101 r1	0:25 1:25	A:1395285;C:1345325;G:1376091;T:1455988;N:20461	25	25	1395285	1345325	1376091	1455988	20461	SRX914868	SRS869434	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.85141	0.7543	0.26701	0.24608	0.91443	0.93028	0.65519	0.7383	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38483	38483	SRR1872975	SRX914867	SRS869435	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1798	GSM1629100	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1798	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629100	GSM1629100: zf3 dis S1798; Danio rerio; RNA Seq	GSM1629100		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629100	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1798.R2.fq zf3_dis_S1798.R1.fq	fastq fastq	10414350.0	208287.0	GSM1629100 r1	0:25 1:25	A:2580685;C:2509293;G:2567981;T:2715865;N:40526	25	25	2580685	2509293	2567981	2715865	40526	SRX914867	SRS869435	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.86357	0.77003	0.26639	0.24899	0.88876	0.90916	0.65432	0.73207	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38484	38484	SRR1872974	SRX914866	SRS869436	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1797	GSM1629099	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1797	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629099	GSM1629099: zf3 dis S1797; Danio rerio; RNA Seq	GSM1629099		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629099	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1797.R1.fq zf3_dis_S1797.R2.fq	fastq fastq	15301850.0	306037.0	GSM1629099 r1	0:25 1:25	A:3854776;C:3654525;G:3713786;T:4018813;N:59950	25	25	3854776	3654525	3713786	4018813	59950	SRX914866	SRS869436	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.854	0.76358	0.30542	0.28721	0.87448	0.89392	0.62852	0.70188	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38485	38485	SRR1872973	SRX914865	SRS869437	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1796	GSM1629098	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1796	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629098	GSM1629098: zf3 dis S1796; Danio rerio; RNA Seq	GSM1629098		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629098	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1796.R2.fq zf3_dis_S1796.R1.fq	fastq fastq	8775100.0	175502.0	GSM1629098 r1	0:25 1:25	A:2202984;C:2111992;G:2131355;T:2296008;N:32761	25	25	2202984	2111992	2131355	2296008	32761	SRX914865	SRS869437	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.73886	0.82202	0.24645	0.25948	0.89069	0.87282	0.71893	0.66123	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38486	38486	SRR1872972	SRX914864	SRS869438	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1795	GSM1629097	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1795	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629097	GSM1629097: zf3 dis S1795; Danio rerio; RNA Seq	GSM1629097		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629097	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1795.R1.fq zf3_dis_S1795.R2.fq	fastq fastq	3867650.0	77353.0	GSM1629097 r1	0:25 1:25	A:945418;C:947115;G:963293;T:998039;N:13785	25	25	945418	947115	963293	998039	13785	SRX914864	SRS869438	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.84833	0.75285	0.27938	0.26663	0.91543	0.93026	0.63501	0.69265	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38487	38487	SRR1872971	SRX914863	SRS869406	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1794	GSM1629096	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1794	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629096	GSM1629096: zf3 dis S1794; Danio rerio; RNA Seq	GSM1629096		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629096	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1794.R1.fq zf3_dis_S1794.R2.fq	fastq fastq	8452150.0	169043.0	GSM1629096 r1	0:25 1:25	A:2071197;C:2071760;G:2110479;T:2169192;N:29522	25	25	2071197	2071760	2110479	2169192	29522	SRX914863	SRS869406	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.73958	0.83971	0.24128	0.26353	0.91887	0.90023	0.72096	0.64372	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38488	38488	SRR1872970	SRX914862	SRS869439	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1793	GSM1629095	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1793	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629095	GSM1629095: zf3 dis S1793; Danio rerio; RNA Seq	GSM1629095		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629095	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1793.R1.fq zf3_dis_S1793.R2.fq	fastq fastq	8832450.0	176649.0	GSM1629095 r1	0:25 1:25	A:2188095;C:2142691;G:2187563;T:2283127;N:30974	25	25	2188095	2142691	2187563	2283127	30974	SRX914862	SRS869439	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.82613	0.72679	0.22978	0.21996	0.89323	0.91263	0.60951	0.69076	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38489	38489	SRR1872969	SRX914861	SRS869405	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1792	GSM1629094	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1792	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629094	GSM1629094: zf3 dis S1792; Danio rerio; RNA Seq	GSM1629094		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629094	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1792.R1.fq zf3_dis_S1792.R2.fq	fastq fastq	5363400.0	107268.0	GSM1629094 r1	0:25 1:25	A:1333155;C:1295485;G:1314864;T:1400923;N:18973	25	25	1333155	1295485	1314864	1400923	18973	SRX914861	SRS869405	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.79882	0.71843	0.19651	0.18206	0.91967	0.93679	0.67635	0.75194	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38490	38490	SRR1872968	SRX914860	SRS869440	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1791	GSM1629093	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1791	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629093	GSM1629093: zf3 dis S1791; Danio rerio; RNA Seq	GSM1629093		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629093	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1791.R1.fq zf3_dis_S1791.R2.fq	fastq fastq	6287000.0	125740.0	GSM1629093 r1	0:25 1:25	A:1573148;C:1505013;G:1531762;T:1654056;N:23021	25	25	1573148	1505013	1531762	1654056	23021	SRX914860	SRS869440	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.7364	0.83315	0.21321	0.23072	0.92579	0.90887	0.74029	0.65374	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38491	38491	SRR1872967	SRX914859	SRS869441	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1790	GSM1629092	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1790	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629092	GSM1629092: zf3 dis S1790; Danio rerio; RNA Seq	GSM1629092		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629092	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1790.R1.fq zf3_dis_S1790.R2.fq	fastq fastq	10112150.0	202243.0	GSM1629092 r1	0:25 1:25	A:2508260;C:2430588;G:2481266;T:2652826;N:39210	25	25	2508260	2430588	2481266	2652826	39210	SRX914859	SRS869441	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.76794	0.86354	0.24185	0.25375	0.90084	0.87858	0.7102	0.64235	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38492	38492	SRR1872966	SRX914858	SRS869402	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1789	GSM1629091	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1789	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629091	GSM1629091: zf3 dis S1789; Danio rerio; RNA Seq	GSM1629091		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629091	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1789.R1.fq zf3_dis_S1789.R2.fq	fastq fastq	11231050.0	224621.0	GSM1629091 r1	0:25 1:25	A:2804694;C:2700654;G:2738351;T:2946403;N:40948	25	25	2804694	2700654	2738351	2946403	40948	SRX914858	SRS869402	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.77491	0.865	0.23972	0.24944	0.90173	0.88138	0.73586	0.39217	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38493	38493	SRR1872965	SRX914857	SRS869401	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1788	GSM1629090	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1788	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629090	GSM1629090: zf3 dis S1788; Danio rerio; RNA Seq	GSM1629090		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629090	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1788.R1.fq zf3_dis_S1788.R2.fq	fastq fastq	10314050.0	206281.0	GSM1629090 r1	0:25 1:25	A:2552958;C:2507831;G:2553958;T:2660287;N:39016	25	25	2552958	2507831	2553958	2660287	39016	SRX914857	SRS869401	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.75288	0.84683	0.24666	0.25857	0.9178	0.89785	0.70009	0.64569	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38494	38494	SRR1872964	SRX914856	SRS869404	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1787	GSM1629089	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1787	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629089	GSM1629089: zf3 dis S1787; Danio rerio; RNA Seq	GSM1629089		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629089	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1787.R1.fq zf3_dis_S1787.R2.fq	fastq fastq	10036550.0	200731.0	GSM1629089 r1	0:25 1:25	A:2476382;C:2435406;G:2478877;T:2611435;N:34450	25	25	2476382	2435406	2478877	2611435	34450	SRX914856	SRS869404	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.76416	0.85721	0.24235	0.25133	0.91019	0.89085	0.72942	0.65077	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38495	38495	SRR1872963	SRX914855	SRS869403	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1786	GSM1629088	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1786	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629088	GSM1629088: zf3 dis S1786; Danio rerio; RNA Seq	GSM1629088		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629088	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1786.R1.fq zf3_dis_S1786.R2.fq	fastq fastq	10707900.0	214158.0	GSM1629088 r1	0:25 1:25	A:2626362;C:2606657;G:2669488;T:2766478;N:38915	25	25	2626362	2606657	2669488	2766478	38915	SRX914855	SRS869403	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.76097	0.85966	0.23352	0.2479	0.91352	0.89244	0.70793	0.63433	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38496	38496	SRR1872962	SRX914854	SRS869400	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1785	GSM1629087	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1785	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629087	GSM1629087: zf3 dis S1785; Danio rerio; RNA Seq	GSM1629087		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629087	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1785.R1.fq zf3_dis_S1785.R2.fq	fastq fastq	13552600.0	271052.0	GSM1629087 r1	0:25 1:25	A:3331733;C:3298975;G:3371183;T:3504256;N:46453	25	25	3331733	3298975	3371183	3504256	46453	SRX914854	SRS869400	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.8397	0.74277	0.22428	0.21707	0.88653	0.90569	0.6195	0.69908	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures
38497	38497	SRR1872961	SRX914853	SRS869443	SRP055996	PRJNA277737	Spatial reconstruction of single cell gene expression	GSE66688	Transcriptome Analysis	Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly		pubmed:25867923	zf3 dis S1784	GSM1629086	tissue:50% Epiboly stage\|group:experimental batch 3	zf3 dis S1784	To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples	50% Epiboly stage		Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage	group:experimental batch 3	GSM1629086	GSM1629086: zf3 dis S1784; Danio rerio; RNA Seq	GSM1629086		1	Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.	GEO Accession:GSM1629086	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500	SRP055996	loader:fastq load.py	zf3_dis_S1784.R1.fq zf3_dis_S1784.R2.fq	fastq fastq	4404200.0	88084.0	GSM1629086 r1	0:25 1:25	A:1084888;C:1067528;G:1088523;T:1145020;N:18241	25	25	1084888	1067528	1088523	1145020	18241	SRX914853	SRS869443	SRA246089	GEO	Satija Lab, New York Genome Center	2	0.8337	0.73219	0.2522	0.22849	0.92415	0.93973	0.64174	0.72344	25	25	B	B	biological fallback assumption	illumina	hiseq_era	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	United States	2015-03-09	Multi-stage	Embryo	Embryo Imprecise	All anatomical structures

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;