RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

1,101 rows where devstage_curation = "Multi-stage" and experiment.library_layout = "SINGLE"

✎ View and edit SQL

This data as json, CSV (advanced)

tissue_curation >10

experiment.library_selection 8

technology 4

experiment.platform 4

experiment.library_strategy 4

experiment.library_source 2

devstage_curation_coarse 2

experiment.library_layout 1

  • SINGLE · 1,101 ✖

devstage_curation 1

  • Multi-stage · 1,101 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
9825 9825 ERR2102841 ERX2160152 ERS1883528 ERP040145 PRJEB37796 Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf E-MTAB-5992 Transcriptome Analysis We wanted to compare gene expression from control untreated zebrafish larvae and 2 mM NaBu treated larvae for 24 hours in order to assess the effect of inhibition of the HDAC pathway in these animals ENA FIRST PUBLIC:2017 08 29|ENA LAST UPDATE:2017 08 23|ArrayExpress:E MTAB 5992   Protocols: zebrafish were isolated during pharyngula stage daily fed and water changed until 8 dpf 2 mM NaBu for 24 hours in some samples Whole larvae where immersed in RNA later and RNA was extracted using a Qiagen kit following manufacturer recommendations. RNA seq libraries were built using the TruSeq RNA Library Preparation Kit v2 from Illumina RS 122 2001 N3 nabu RNA SAMEA104224510 Fundacao Champalimaud ENA first public:2017 08 29|ENA last update:2017 08 23|External Id:SAMEA104224510|INSDC center alias:Fundacao Champalimaud|INSDC center name:Fundacao Champalimaud|INSDC first public:2017 08 29T17:02:02Z|INSDC last update:2017 08 23T09:55:35Z|INSDC status:public|Submitter Id:E MTAB 5992:N3 nabu RNA|age:8|broker name:ArrayExpress|common name:zebrafish|disease:normal|genotype:wild type genotype|sample name:E MTAB 5992:N3 nabu RNA|strain:AB                 Illumina Genome Analyzer IIx sequencing; Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf E MTAB 5992:N3 nabu RNA s N3 nabu RNA s Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf zebrafish were isolated during pharyngula stage daily fed and water changed until 8 dpf 2 mM NaBu for 24 hours in some samples Whole larvae where immersed in RNA later and RNA was extracted using a Qiagen kit following manufacturer recommendations. RNA seq libraries were built using the TruSeq RNA Library Preparation Kit v2 from Illumina RS 122 2001 Experimental Factor: compound:NaBu|Experimental Factor: dose:2 RNA-Seq TRANSCRIPTOMIC RANDOM SINGLE ILLUMINA Illumina Genome Analyzer IIx   ERP040145 Illumina Genome Analyzer IIx sequencing; Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf ENA FIRST PUBLIC:2017 08 29|ENA LAST UPDATE:2018 11 16 N3_R1_all.fastq.gz fastq 1410139550.0 18670564.0 E MTAB 5992:N3 nabu RNA 0:75.53 1:0 A:353294009;C:340727934;G:322476371;T:393200193;N:441043 75 0     353294009 340727934 322476371 393200193 441043 ERX2160152 ERS1883528 ERA1011308 Fundacao Champalimaud|European Nucleotide Archive Fundacao Champalimaud|European Nucleotide Archive 1 0.95434   0.08906   0.66935   0.47788   76   B   usable mapping rate illumina early_illumina unknown random_priming trueseq bulk unknown unknown   Portugal 2017-08-23 Multi-stage Multi-stage Whole Organism All anatomical structures
9826 9826 ERR2102840 ERX2160151 ERS1883527 ERP040145 PRJEB37796 Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf E-MTAB-5992 Transcriptome Analysis We wanted to compare gene expression from control untreated zebrafish larvae and 2 mM NaBu treated larvae for 24 hours in order to assess the effect of inhibition of the HDAC pathway in these animals ENA FIRST PUBLIC:2017 08 29|ENA LAST UPDATE:2017 08 23|ArrayExpress:E MTAB 5992   Protocols: zebrafish were isolated during pharyngula stage daily fed and water changed until 8 dpf 2 mM NaBu for 24 hours in some samples Whole larvae where immersed in RNA later and RNA was extracted using a Qiagen kit following manufacturer recommendations. RNA seq libraries were built using the TruSeq RNA Library Preparation Kit v2 from Illumina RS 122 2001 N2 nabu RNA SAMEA104224509 Fundacao Champalimaud ENA first public:2017 08 29|ENA last update:2017 08 23|External Id:SAMEA104224509|INSDC center alias:Fundacao Champalimaud|INSDC center name:Fundacao Champalimaud|INSDC first public:2017 08 29T17:02:02Z|INSDC last update:2017 08 23T09:55:35Z|INSDC status:public|Submitter Id:E MTAB 5992:N2 nabu RNA|age:8|broker name:ArrayExpress|common name:zebrafish|disease:normal|genotype:wild type genotype|sample name:E MTAB 5992:N2 nabu RNA|strain:AB                 Illumina Genome Analyzer IIx sequencing; Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf E MTAB 5992:N2 nabu RNA s N2 nabu RNA s Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf zebrafish were isolated during pharyngula stage daily fed and water changed until 8 dpf 2 mM NaBu for 24 hours in some samples Whole larvae where immersed in RNA later and RNA was extracted using a Qiagen kit following manufacturer recommendations. RNA seq libraries were built using the TruSeq RNA Library Preparation Kit v2 from Illumina RS 122 2001 Experimental Factor: compound:NaBu|Experimental Factor: dose:2 RNA-Seq TRANSCRIPTOMIC RANDOM SINGLE ILLUMINA Illumina Genome Analyzer IIx   ERP040145 Illumina Genome Analyzer IIx sequencing; Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf ENA FIRST PUBLIC:2017 08 29|ENA LAST UPDATE:2018 11 16 N2_R1_all.fastq.gz fastq 1478621168.0 19576865.0 E MTAB 5992:N2 nabu RNA 0:75.53 1:0 A:369453299;C:359092235;G:341176884;T:408389810;N:508940 75 0     369453299 359092235 341176884 408389810 508940 ERX2160151 ERS1883527 ERA1011308 Fundacao Champalimaud|European Nucleotide Archive Fundacao Champalimaud|European Nucleotide Archive 1 0.95582   0.08202   0.67718   0.47812   76   B   usable mapping rate illumina early_illumina unknown random_priming trueseq bulk unknown unknown   Portugal 2017-08-23 Multi-stage Multi-stage Whole Organism All anatomical structures
9827 9827 ERR2102839 ERX2160150 ERS1883526 ERP040145 PRJEB37796 Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf E-MTAB-5992 Transcriptome Analysis We wanted to compare gene expression from control untreated zebrafish larvae and 2 mM NaBu treated larvae for 24 hours in order to assess the effect of inhibition of the HDAC pathway in these animals ENA FIRST PUBLIC:2017 08 29|ENA LAST UPDATE:2017 08 23|ArrayExpress:E MTAB 5992   Protocols: zebrafish were isolated during pharyngula stage daily fed and water changed until 8 dpf 2 mM NaBu for 24 hours in some samples Whole larvae where immersed in RNA later and RNA was extracted using a Qiagen kit following manufacturer recommendations. RNA seq libraries were built using the TruSeq RNA Library Preparation Kit v2 from Illumina RS 122 2001 N1 nabu RNA SAMEA104224508 Fundacao Champalimaud ENA first public:2017 08 29|ENA last update:2017 08 23|External Id:SAMEA104224508|INSDC center alias:Fundacao Champalimaud|INSDC center name:Fundacao Champalimaud|INSDC first public:2017 08 29T17:02:02Z|INSDC last update:2017 08 23T09:55:35Z|INSDC status:public|Submitter Id:E MTAB 5992:N1 nabu RNA|age:8|broker name:ArrayExpress|common name:zebrafish|disease:normal|genotype:wild type genotype|sample name:E MTAB 5992:N1 nabu RNA|strain:AB                 Illumina Genome Analyzer IIx sequencing; Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf E MTAB 5992:N1 nabu RNA s N1 nabu RNA s Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf zebrafish were isolated during pharyngula stage daily fed and water changed until 8 dpf 2 mM NaBu for 24 hours in some samples Whole larvae where immersed in RNA later and RNA was extracted using a Qiagen kit following manufacturer recommendations. RNA seq libraries were built using the TruSeq RNA Library Preparation Kit v2 from Illumina RS 122 2001 Experimental Factor: compound:NaBu|Experimental Factor: dose:2 RNA-Seq TRANSCRIPTOMIC RANDOM SINGLE ILLUMINA Illumina Genome Analyzer IIx   ERP040145 Illumina Genome Analyzer IIx sequencing; Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf ENA FIRST PUBLIC:2017 08 29|ENA LAST UPDATE:2018 11 16 N1_R1_all.fastq.gz fastq 1531713181.0 20277882.0 E MTAB 5992:N1 nabu RNA 0:75.54 1:0 A:386600603;C:373317031;G:350339456;T:420938891;N:517200 75 0     386600603 373317031 350339456 420938891 517200 ERX2160150 ERS1883526 ERA1011308 Fundacao Champalimaud|European Nucleotide Archive Fundacao Champalimaud|European Nucleotide Archive 1 0.9552   0.08124   0.67685   0.47578   76   B   usable mapping rate illumina early_illumina unknown random_priming trueseq bulk unknown unknown   Portugal 2017-08-23 Multi-stage Multi-stage Whole Organism All anatomical structures
9828 9828 ERR2102838 ERX2160149 ERS1883525 ERP040145 PRJEB37796 Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf E-MTAB-5992 Transcriptome Analysis We wanted to compare gene expression from control untreated zebrafish larvae and 2 mM NaBu treated larvae for 24 hours in order to assess the effect of inhibition of the HDAC pathway in these animals ENA FIRST PUBLIC:2017 08 29|ENA LAST UPDATE:2017 08 23|ArrayExpress:E MTAB 5992   Protocols: zebrafish were isolated during pharyngula stage daily fed and water changed until 8 dpf 2 mM NaBu for 24 hours in some samples Whole larvae where immersed in RNA later and RNA was extracted using a Qiagen kit following manufacturer recommendations. RNA seq libraries were built using the TruSeq RNA Library Preparation Kit v2 from Illumina RS 122 2001 C3 control RNA SAMEA104224507 Fundacao Champalimaud ENA first public:2017 08 29|ENA last update:2017 08 23|External Id:SAMEA104224507|INSDC center alias:Fundacao Champalimaud|INSDC center name:Fundacao Champalimaud|INSDC first public:2017 08 29T17:02:02Z|INSDC last update:2017 08 23T09:55:35Z|INSDC status:public|Submitter Id:E MTAB 5992:C3 control RNA|age:8|broker name:ArrayExpress|common name:zebrafish|disease:normal|genotype:wild type genotype|sample name:E MTAB 5992:C3 control RNA|strain:AB                 Illumina Genome Analyzer IIx sequencing; Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf E MTAB 5992:C3 control RNA s C3 control RNA s Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf zebrafish were isolated during pharyngula stage daily fed and water changed until 8 dpf 2 mM NaBu for 24 hours in some samples Whole larvae where immersed in RNA later and RNA was extracted using a Qiagen kit following manufacturer recommendations. RNA seq libraries were built using the TruSeq RNA Library Preparation Kit v2 from Illumina RS 122 2001 Experimental Factor: compound:PBS RNA-Seq TRANSCRIPTOMIC RANDOM SINGLE ILLUMINA Illumina Genome Analyzer IIx   ERP040145 Illumina Genome Analyzer IIx sequencing; Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf ENA FIRST PUBLIC:2017 08 29|ENA LAST UPDATE:2018 11 16 C3_R1_all.fastq.gz fastq 1380662008.0 18279108.0 E MTAB 5992:C3 control RNA 0:75.53 1:0 A:345997031;C:338444594;G:316575258;T:379195977;N:449148 75 0     345997031 338444594 316575258 379195977 449148 ERX2160149 ERS1883525 ERA1011308 Fundacao Champalimaud|European Nucleotide Archive Fundacao Champalimaud|European Nucleotide Archive 1 0.95615   0.08131   0.68694   0.45267   74   B   usable mapping rate illumina early_illumina unknown random_priming trueseq bulk unknown unknown   Portugal 2017-08-23 Multi-stage Multi-stage Whole Organism All anatomical structures
9829 9829 ERR2102837 ERX2160148 ERS1883524 ERP040145 PRJEB37796 Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf E-MTAB-5992 Transcriptome Analysis We wanted to compare gene expression from control untreated zebrafish larvae and 2 mM NaBu treated larvae for 24 hours in order to assess the effect of inhibition of the HDAC pathway in these animals ENA FIRST PUBLIC:2017 08 29|ENA LAST UPDATE:2017 08 23|ArrayExpress:E MTAB 5992   Protocols: zebrafish were isolated during pharyngula stage daily fed and water changed until 8 dpf 2 mM NaBu for 24 hours in some samples Whole larvae where immersed in RNA later and RNA was extracted using a Qiagen kit following manufacturer recommendations. RNA seq libraries were built using the TruSeq RNA Library Preparation Kit v2 from Illumina RS 122 2001 C2 control RNA SAMEA104224506 Fundacao Champalimaud ENA first public:2017 08 29|ENA last update:2017 08 23|External Id:SAMEA104224506|INSDC center alias:Fundacao Champalimaud|INSDC center name:Fundacao Champalimaud|INSDC first public:2017 08 29T17:02:02Z|INSDC last update:2017 08 23T09:55:35Z|INSDC status:public|Submitter Id:E MTAB 5992:C2 control RNA|age:8|broker name:ArrayExpress|common name:zebrafish|disease:normal|genotype:wild type genotype|sample name:E MTAB 5992:C2 control RNA|strain:AB                 Illumina Genome Analyzer IIx sequencing; Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf E MTAB 5992:C2 control RNA s C2 control RNA s Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf zebrafish were isolated during pharyngula stage daily fed and water changed until 8 dpf 2 mM NaBu for 24 hours in some samples Whole larvae where immersed in RNA later and RNA was extracted using a Qiagen kit following manufacturer recommendations. RNA seq libraries were built using the TruSeq RNA Library Preparation Kit v2 from Illumina RS 122 2001 Experimental Factor: compound:PBS RNA-Seq TRANSCRIPTOMIC RANDOM SINGLE ILLUMINA Illumina Genome Analyzer IIx   ERP040145 Illumina Genome Analyzer IIx sequencing; Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf ENA FIRST PUBLIC:2017 08 29|ENA LAST UPDATE:2018 11 16 C2_R1_all.fastq.gz fastq 1336640735.0 17695627.0 E MTAB 5992:C2 control RNA 0:75.54 1:0 A:338213530;C:326808990;G:303983789;T:367147896;N:486530 75 0     338213530 326808990 303983789 367147896 486530 ERX2160148 ERS1883524 ERA1011308 Fundacao Champalimaud|European Nucleotide Archive Fundacao Champalimaud|European Nucleotide Archive 1 0.95427   0.08628   0.67706   0.47245   76   B   usable mapping rate illumina early_illumina unknown random_priming trueseq bulk unknown unknown   Portugal 2017-08-23 Multi-stage Multi-stage Whole Organism All anatomical structures
9830 9830 ERR2102836 ERX2160147 ERS1883523 ERP040145 PRJEB37796 Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf E-MTAB-5992 Transcriptome Analysis We wanted to compare gene expression from control untreated zebrafish larvae and 2 mM NaBu treated larvae for 24 hours in order to assess the effect of inhibition of the HDAC pathway in these animals ENA FIRST PUBLIC:2017 08 29|ENA LAST UPDATE:2017 08 23|ArrayExpress:E MTAB 5992   Protocols: zebrafish were isolated during pharyngula stage daily fed and water changed until 8 dpf 2 mM NaBu for 24 hours in some samples Whole larvae where immersed in RNA later and RNA was extracted using a Qiagen kit following manufacturer recommendations. RNA seq libraries were built using the TruSeq RNA Library Preparation Kit v2 from Illumina RS 122 2001 C1 control RNA SAMEA104224505 Fundacao Champalimaud ENA first public:2017 08 29|ENA last update:2017 08 23|External Id:SAMEA104224505|INSDC center alias:Fundacao Champalimaud|INSDC center name:Fundacao Champalimaud|INSDC first public:2017 08 29T17:02:02Z|INSDC last update:2017 08 23T09:55:35Z|INSDC status:public|Submitter Id:E MTAB 5992:C1 control RNA|age:8|broker name:ArrayExpress|common name:zebrafish|disease:normal|genotype:wild type genotype|sample name:E MTAB 5992:C1 control RNA|strain:AB                 Illumina Genome Analyzer IIx sequencing; Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf E MTAB 5992:C1 control RNA s C1 control RNA s Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf zebrafish were isolated during pharyngula stage daily fed and water changed until 8 dpf 2 mM NaBu for 24 hours in some samples Whole larvae where immersed in RNA later and RNA was extracted using a Qiagen kit following manufacturer recommendations. RNA seq libraries were built using the TruSeq RNA Library Preparation Kit v2 from Illumina RS 122 2001 Experimental Factor: compound:PBS RNA-Seq TRANSCRIPTOMIC RANDOM SINGLE ILLUMINA Illumina Genome Analyzer IIx   ERP040145 Illumina Genome Analyzer IIx sequencing; Rna seq of control and 2mM NaBu treated zebrafish larvae 8 dpf ENA FIRST PUBLIC:2017 08 29|ENA LAST UPDATE:2018 11 16 C1_R1_all.fastq.gz fastq 1297694845.0 17180544.0 E MTAB 5992:C1 control RNA 0:75.53 1:0 A:322048172;C:316542683;G:299227724;T:359449433;N:426833 75 0     322048172 316542683 299227724 359449433 426833 ERX2160147 ERS1883523 ERA1011308 Fundacao Champalimaud|European Nucleotide Archive Fundacao Champalimaud|European Nucleotide Archive 1 0.95505   0.08541   0.67659   0.48159   75   B   usable mapping rate illumina early_illumina unknown random_priming trueseq bulk unknown unknown   Portugal 2017-08-23 Multi-stage Multi-stage Whole Organism All anatomical structures
9898 9898 ERR4194114 ERX4155254 ERS4601292 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 2 SAMEA6873729 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873729|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 2|age:8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 2|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 2 s Sample 2 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:8|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA8h_1_S2_L001.bam bam 10087287534.0 99874134.0 E MTAB 9193:cDNA8h 1 S2 L001 0:101 A:2892833391;C:2022466595;G:2198646699;T:2962268446;N:11072403 101       2892833391 2022466595 2198646699 2962268446 11072403 ERX4155254 ERS4601292 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.93609   0.12902   0.82158   0.5062   101   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9899 9899 ERR4194115 ERX4155254 ERS4601292 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 2 SAMEA6873729 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873729|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 2|age:8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 2|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 2 s Sample 2 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:8|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA8h_1_S2_L002.bam bam 10191911414.0 100910014.0 E MTAB 9193:cDNA8h 1 S2 L002 0:101 A:2923216190;C:2043975715;G:2221734566;T:2992798366;N:10186577 101       2923216190 2043975715 2221734566 2992798366 10186577 ERX4155254 ERS4601292 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.93445   0.13038   0.824   0.49774   101   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9900 9900 ERR4194112 ERX4155253 ERS4601291 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 1 SAMEA6873728 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873728|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 1|age:6|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 1|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 1 s Sample 1 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:6|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA6h_1_S1_L001.bam bam 7181772357.0 71106657.0 E MTAB 9193:cDNA6h 1 S1 L001 0:101 A:2074032710;C:1415439071;G:1544274166;T:2140112533;N:7913877 101       2074032710 1415439071 1544274166 2140112533 7913877 ERX4155253 ERS4601291 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.9297   0.12156   0.8117   0.51457   101   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9901 9901 ERR4194113 ERX4155253 ERS4601291 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 1 SAMEA6873728 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873728|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 1|age:6|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 1|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 1 s Sample 1 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:6|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA6h_1_S1_L002.bam bam 7256542253.0 71846953.0 E MTAB 9193:cDNA6h 1 S1 L002 0:101 A:2096163385;C:1430325700;G:1560530043;T:2162265616;N:7257509 101       2096163385 1430325700 1560530043 2162265616 7257509 ERX4155253 ERS4601291 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.92882   0.12127   0.81162   0.51457   101   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9902 9902 ERR4194128 ERX4155256 ERS4601294 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 4 SAMEA6873731 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873731|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 4|age:13|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 4|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 4 s Sample 4 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:13|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA13h_1_control_S1_L001.bam bam 10785974123.0 106791823.0 E MTAB 9193:cDNA13h 1 control S1 L001 0:101 A:3007305661;C:2241057062;G:2505494392;T:2986021199;N:46095809 101       3007305661 2241057062 2505494392 2986021199 46095809 ERX4155256 ERS4601294 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.67094   0.07571   0.92951   0.5272   101   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9903 9903 ERR4194129 ERX4155256 ERS4601294 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 4 SAMEA6873731 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873731|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 4|age:13|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 4|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 4 s Sample 4 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:13|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA13h_1_control_S1_L002.bam bam 10595192294.0 104902894.0 E MTAB 9193:cDNA13h 1 control S1 L002 0:101 A:2971916419;C:2204229263;G:2390854035;T:2949877754;N:78314823 101       2971916419 2204229263 2390854035 2949877754 78314823 ERX4155256 ERS4601294 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.67255   0.08054   0.91583   0.52661   101   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9904 9904 ERR4194116 ERX4155255 ERS4601293 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 3 SAMEA6873730 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 3 s Sample 3 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:10|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA10h_1_S3_L001.bam bam 1622536412.0 16556494.0 E MTAB 9193:cDNA10h 1 S3 L001 0:98 A:491141175;C:317161060;G:354179755;T:459976409;N:78013 98       491141175 317161060 354179755 459976409 78013 ERX4155255 ERS4601293 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.93238   0.13033   0.89132   0.47076   98   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9905 9905 ERR4194117 ERX4155255 ERS4601293 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 3 SAMEA6873730 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 3 s Sample 3 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:10|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA10h_1_S3_L002.bam bam 1484328776.0 15146212.0 E MTAB 9193:cDNA10h 1 S3 L002 0:98 A:450782055;C:290088574;G:322801188;T:420570801;N:86158 98       450782055 290088574 322801188 420570801 86158 ERX4155255 ERS4601293 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.92846   0.13128   0.89923   0.46879   98   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9906 9906 ERR4194118 ERX4155255 ERS4601293 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 3 SAMEA6873730 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 3 s Sample 3 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:10|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA10h_1_S3_L003.bam bam 1578833116.0 16110542.0 E MTAB 9193:cDNA10h 1 S3 L003 0:98 A:477600666;C:308260969;G:347303289;T:445467384;N:200808 98       477600666 308260969 347303289 445467384 200808 ERX4155255 ERS4601293 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.93107   0.12965   0.91265   0.47375   98   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9907 9907 ERR4194119 ERX4155255 ERS4601293 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 3 SAMEA6873730 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 3 s Sample 3 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:10|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA10h_1_S3_L004.bam bam 1859564994.0 18975153.0 E MTAB 9193:cDNA10h 1 S3 L004 0:98 A:562936790;C:364057256;G:406607636;T:525811595;N:151717 98       562936790 364057256 406607636 525811595 151717 ERX4155255 ERS4601293 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.93453   0.1266   0.87714   0.46957   98   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9908 9908 ERR4194120 ERX4155255 ERS4601293 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 3 SAMEA6873730 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 3 s Sample 3 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:10|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA10h_2_S3_L001.bam bam 1156341102.0 11799399.0 E MTAB 9193:cDNA10h 2 S3 L001 0:98 A:345857612;C:224453195;G:257551986;T:327969064;N:509245 98       345857612 224453195 257551986 327969064 509245 ERX4155255 ERS4601293 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.93863   0.10744   0.81984   0.501   98   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9909 9909 ERR4194121 ERX4155255 ERS4601293 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 3 SAMEA6873730 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 3 s Sample 3 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:10|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA10h_2_S3_L002.bam bam 1105219696.0 11277752.0 E MTAB 9193:cDNA10h 2 S3 L002 0:98 A:331051973;C:214369903;G:246546338;T:312897773;N:353709 98       331051973 214369903 246546338 312897773 353709 ERX4155255 ERS4601293 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.93941   0.10818   0.82211   0.50079   98   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9910 9910 ERR4194122 ERX4155255 ERS4601293 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 3 SAMEA6873730 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 3 s Sample 3 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:10|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA10h_2_S3_L003.bam bam 1105199606.0 11277547.0 E MTAB 9193:cDNA10h 2 S3 L003 0:98 A:331158619;C:214305131;G:246465559;T:312930408;N:339889 98       331158619 214305131 246465559 312930408 339889 ERX4155255 ERS4601293 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.93767   0.10645   0.82329   0.50057   98   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9911 9911 ERR4194123 ERX4155255 ERS4601293 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 3 SAMEA6873730 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 3 s Sample 3 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:10|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA10h_2_S3_L004.bam bam 1108707712.0 11313344.0 E MTAB 9193:cDNA10h 2 S3 L004 0:98 A:331374433;C:215925150;G:247131942;T:313865174;N:411013 98       331374433 215925150 247131942 313865174 411013 ERX4155255 ERS4601293 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.93827   0.10842   0.82031   0.49241   98   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9912 9912 ERR4194124 ERX4155255 ERS4601293 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 3 SAMEA6873730 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 3 s Sample 3 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:10|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA10h_2_S3_L005.bam bam 1110084612.0 11327394.0 E MTAB 9193:cDNA10h 2 S3 L005 0:98 A:332881960;C:215360330;G:247563319;T:313842331;N:436672 98       332881960 215360330 247563319 313842331 436672 ERX4155255 ERS4601293 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.93827   0.10719   0.8238   0.50406   98   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9913 9913 ERR4194125 ERX4155255 ERS4601293 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 3 SAMEA6873730 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 3 s Sample 3 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:10|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA10h_2_S3_L006.bam bam 1113812728.0 11365436.0 E MTAB 9193:cDNA10h 2 S3 L006 0:98 A:333112288;C:216649152;G:248341020;T:315338848;N:371420 98       333112288 216649152 248341020 315338848 371420 ERX4155255 ERS4601293 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.93843   0.10675   0.82079   0.49284   98   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9914 9914 ERR4194126 ERX4155255 ERS4601293 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 3 SAMEA6873730 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 3 s Sample 3 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:10|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA10h_2_S3_L007.bam bam 1119495748.0 11423426.0 E MTAB 9193:cDNA10h 2 S3 L007 0:98 A:335288339;C:217283719;G:249624836;T:316900388;N:398466 98       335288339 217283719 249624836 316900388 398466 ERX4155255 ERS4601293 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.93711   0.10749   0.82266   0.49382   98   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9915 9915 ERR4194127 ERX4155255 ERS4601293 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 3 SAMEA6873730 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873730|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 3|age:10|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 3|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 3 s Sample 3 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:10|Experimental Factor: RNA interference:n1 RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA10h_2_S3_L008.bam bam 1175946688.0 11999456.0 E MTAB 9193:cDNA10h 2 S3 L008 0:98 A:351364169;C:228318193;G:261971072;T:333863943;N:429311 98       351364169 228318193 261971072 333863943 429311 ERX4155255 ERS4601293 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.93851   0.10755   0.82158   0.49895   98   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9916 9916 ERR4194130 ERX4155257 ERS4601295 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 5 SAMEA6873732 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873732|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 5|age:13|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 5|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 5 s Sample 5 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:13|Experimental Factor: RNA interference:morpholino mediated Gata5/6 knockdown RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA13h_2_gata56KD_S2_L001.bam bam 7791309377.0 77141677.0 E MTAB 9193:cDNA13h 2 gata56KD S2 L001 0:101 A:2198242220;C:1593746618;G:1784167452;T:2181979820;N:33173267 101       2198242220 1593746618 1784167452 2181979820 33173267 ERX4155257 ERS4601295 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.66736   0.08039   0.93026   0.50796   101   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
9917 9917 ERR4194131 ERX4155257 ERS4601295 ERP122151 PRJEB38705 Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E-MTAB-9193 Transcriptome Analysis TgBACgata5:EGFP transgenic line was used to isolate mesendoderm cells enriched for cardiac lineage. Wild type embryos at 6 8 10 13 hpf and morpholinos injected Gata5/6 know down KD embryos at 13 hpf were pre screened for GFP signal and dissociated into single cell suspension in separate wells. GFP+ cells at each condition were isolated through fluorescent activated cell sorting FACS. Single cell cDNA libraries were constructed through the 10x Chromium Single Cell Gene Expression platform. Final sequencing was performed on an Illumina HiSeq 2500 platform Rapid Run Model. Note that the 10h single cell library was sequenced twice Named as cDNA10h 1* and cDNA10h 2* separately. ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01   Protocols: WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Sample 5 SAMEA6873732 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada ENA FIRST PUBLIC:2020 12 31T11:11:47Z|ENA LAST UPDATE:2020 06 04T16:16:46Z|External Id:SAMEA6873732|INSDC center name:Developmental and Stem Cell Biology Sickkids Toronto Canada; Genetics and Genome Biology Sickkids Toronto Canada; Molecular Genetics University of Toronto Toronto Canada|INSDC first public:2020 12 31T11:11:47Z|INSDC last update:2020 06 04T16:16:46Z|INSDC status:public|Submitter Id:E MTAB 9193:Sample 5|age:13|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:TgBACgata5: EGFPpd25|immunophenotype:GFP+|individual:embryo pool 100 200|organism part:mesendoderm|sample name:E MTAB 9193:Sample 5|scientific name:Danio rerio|sex:mixed                 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish E MTAB 9193:Sample 5 s Sample 5 s Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish WT and Gata5/6KD TgBAC gata5: EGFP embryos were synchronized and dechorionated with pronase Sigma Cat# 11459643001 at desired stages. For embryos at gastrulation stages 6 hpf 8 hpf 10 hpf the dissociation was performed by incubating embryos in 200 μl calcium free Ringer solution 116 mM NaCl 2.6 mM KCl 5 mM HEPE pH 7.0 for 5 min followed by 500ul TrpLE GIBCO TrypLE Express Enzyme cat #: 12604 013 at room temperature. Dissociation was monitored under a dissecting scope and embryos were homogenized every 5min until single cell suspensions were generated. Embryos at the early segmentation stage 13 hpf were treated similarly but incubated with 500 ul of 0.25 Trypsin GIBCO Trypsin2.5% no phenol red cat#: 15090046/ EDTA instead of TrpLE for dissociation. post dissociation Cells were washed twice with DMEM 1% FBS. DAPI was added at a concentration of 5ug/ml to exclude dead cells right before the Fluorescence activated cell sorting FACS. FACS was performed on Sony SH800S Cell Sorter MoFlo XDP or MoFlo Astrios with a 100 μm nozzle by the SickKids UHN Flow and Mass Cytometry Facility. Around 20 000 to 50 000 gata5GFP+ cells were obtained in one FACS experiment. Single cell suspensions post FACS were loaded into the 10x machine and RNA was extracted based on Chromium Single Cell three prime Reagent Kits v2 protocol. Libraries were constructed using the 10x v2 chemistry. Experimental Factor: age:13|Experimental Factor: RNA interference:morpholino mediated Gata5/6 knockdown RNA-Seq TRANSCRIPTOMIC SINGLE CELL PolyA SINGLE ILLUMINA Illumina HiSeq 2500   ERP122151 Illumina HiSeq 2500 sequencing; Single cell transcriptome analysis of gata5GFP labelled WT and Gata5/6 deficient cells from early gastrulation to early somitogenesis in zebrafish ENA FIRST PUBLIC:2021 06 02|ENA LAST UPDATE:2021 12 01 cDNA13h_2_gata56KD_S2_L002.bam bam 7658149967.0 75823267.0 E MTAB 9193:cDNA13h 2 gata56KD S2 L002 0:101 A:2172230233;C:1568805100;G:1703587704;T:2157181071;N:56345859 101       2172230233 1568805100 1703587704 2157181071 56345859 ERX4155257 ERS4601295 ERA2667966 Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive Developmental and Stem Cell Biology, Sickkids, Toronto, Canada; Genetics and Genome Biology, Sickkids, Toronto, Canada; Molecular Genetics, University of Toronto, Toronto, Canada|European Nucleotide Archive 1 0.66565   0.08597   0.91804   0.51772   101   B   usable mapping rate illumina hiseq_era unknown poly_a unknown sc single_cell_droplet 10x   Canada 2020-06-04 Multi-stage Embryo Embryo Imprecise All anatomical structures
10141 10141 ERR4973564 ERX4792138 ERS5459722 ERP125703 PRJEB41864 three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf E-MTAB-9899 Transcriptome Analysis mRNA was purified from whole zebrafish embryos at 24 hpf and three prime proximal region was sequenced. ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 12 10   Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library was generated using Lexogen's QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina sibling 3 SAMEA7703213 Centre for Developmental Neurobiology King's College London ENA first public:2021 01 27|ENA last update:2020 12 10|External Id:SAMEA7703213|INSDC center alias:Centre for Developmental Neurobiology King's College London|INSDC center name:Centre for Developmental Neurobiology King's College London|INSDC first public:2021 01 27T17:06:57Z|INSDC last update:2020 12 10T17:23:32Z|INSDC status:public|Submitter Id:E MTAB 9899:sibling 3|age:24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|organism part:whole organism|sample name:E MTAB 9899:sibling 3                 NextSeq 500 sequencing; 3 prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf E MTAB 9899:sibling 3 s sibling 3 s three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library was generated using Lexogen's QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Experimental Factor: genotype:wild type genotype RNA-Seq TRANSCRIPTOMIC RACE SINGLE ILLUMINA NextSeq 500   ERP125703 NextSeq 500 sequencing; three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 12 10 70_AACCGA_70_ACTAGC_S2_R1_001.fastq.gz fastq     E MTAB 9899:sibling 3 0:76 1:0 A:385382600;C:210104151;G:238678838;T:315495923;N:5536 76 0     385382600 210104151 238678838 315495923 5536 ERX4792138 ERS5459722 ERA3194022 Centre for Developmental Neurobiology King Centre for Developmental Neurobiology King 1 0.82613   0.13111   0.77597   0.53833   76   B   usable mapping rate illumina nextseq 3prime other lexogen bulk unknown unknown   United Kingdom 2020-12-10 Multi-stage Multi-stage Whole Organism All anatomical structures
10142 10142 ERR4973563 ERX4792137 ERS5459721 ERP125703 PRJEB41864 three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf E-MTAB-9899 Transcriptome Analysis mRNA was purified from whole zebrafish embryos at 24 hpf and three prime proximal region was sequenced. ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 12 10   Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library was generated using Lexogen's QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina sibling 2 SAMEA7703212 Centre for Developmental Neurobiology King's College London ENA first public:2021 01 27|ENA last update:2020 12 10|External Id:SAMEA7703212|INSDC center alias:Centre for Developmental Neurobiology King's College London|INSDC center name:Centre for Developmental Neurobiology King's College London|INSDC first public:2021 01 27T17:06:57Z|INSDC last update:2020 12 10T17:23:32Z|INSDC status:public|Submitter Id:E MTAB 9899:sibling 2|age:24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|organism part:whole organism|sample name:E MTAB 9899:sibling 2                 NextSeq 500 sequencing; 3 prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf E MTAB 9899:sibling 2 s sibling 2 s three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library was generated using Lexogen's QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Experimental Factor: genotype:wild type genotype RNA-Seq TRANSCRIPTOMIC RACE SINGLE ILLUMINA NextSeq 500   ERP125703 NextSeq 500 sequencing; three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 12 10 69_AGTTGA_69_CTTACA_S7_R1_001.fastq.gz fastq     E MTAB 9899:sibling 2 0:76 1:0 A:405337161;C:226099266;G:255734601;T:341120121;N:5955 76 0     405337161 226099266 255734601 341120121 5955 ERX4792137 ERS5459721 ERA3194022 Centre for Developmental Neurobiology King Centre for Developmental Neurobiology King 1 0.84066   0.12241   0.77755   0.56472   76   B   usable mapping rate illumina nextseq 3prime other lexogen bulk unknown unknown   United Kingdom 2020-12-10 Multi-stage Multi-stage Whole Organism All anatomical structures
10143 10143 ERR4973562 ERX4792136 ERS5459720 ERP125703 PRJEB41864 three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf E-MTAB-9899 Transcriptome Analysis mRNA was purified from whole zebrafish embryos at 24 hpf and three prime proximal region was sequenced. ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 12 10   Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library was generated using Lexogen's QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina sibling 1 SAMEA7703211 Centre for Developmental Neurobiology King's College London ENA first public:2021 01 27|ENA last update:2020 12 10|External Id:SAMEA7703211|INSDC center alias:Centre for Developmental Neurobiology King's College London|INSDC center name:Centre for Developmental Neurobiology King's College London|INSDC first public:2021 01 27T17:06:57Z|INSDC last update:2020 12 10T17:23:32Z|INSDC status:public|Submitter Id:E MTAB 9899:sibling 1|age:24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|organism part:whole organism|sample name:E MTAB 9899:sibling 1                 NextSeq 500 sequencing; 3 prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf E MTAB 9899:sibling 1 s sibling 1 s three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library was generated using Lexogen's QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Experimental Factor: genotype:wild type genotype RNA-Seq TRANSCRIPTOMIC RACE SINGLE ILLUMINA NextSeq 500   ERP125703 NextSeq 500 sequencing; three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 12 10 68_CCAATT_68_GTCCCG_S11_R1_001.fastq.gz fastq     E MTAB 9899:sibling 1 0:76 1:0 A:440539801;C:236835299;G:268057277;T:355636994;N:6169 76 0     440539801 236835299 268057277 355636994 6169 ERX4792136 ERS5459720 ERA3194022 Centre for Developmental Neurobiology King Centre for Developmental Neurobiology King 1 0.82002   0.12908   0.77766   0.54981   76   B   usable mapping rate illumina nextseq 3prime other lexogen bulk unknown unknown   United Kingdom 2020-12-10 Multi-stage Multi-stage Whole Organism All anatomical structures
10144 10144 ERR4973561 ERX4792135 ERS5459719 ERP125703 PRJEB41864 three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf E-MTAB-9899 Transcriptome Analysis mRNA was purified from whole zebrafish embryos at 24 hpf and three prime proximal region was sequenced. ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 12 10   Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library was generated using Lexogen's QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina sfpq 3 SAMEA7703210 Centre for Developmental Neurobiology King's College London ENA first public:2021 01 27|ENA last update:2020 12 10|External Id:SAMEA7703210|INSDC center alias:Centre for Developmental Neurobiology King's College London|INSDC center name:Centre for Developmental Neurobiology King's College London|INSDC first public:2021 01 27T17:06:57Z|INSDC last update:2020 12 10T17:23:32Z|INSDC status:public|Submitter Id:E MTAB 9899:sfpq 3|age:24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:sfpq / |organism part:whole organism|sample name:E MTAB 9899:sfpq 3                 NextSeq 500 sequencing; 3 prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf E MTAB 9899:sfpq 3 s sfpq 3 s three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library was generated using Lexogen's QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Experimental Factor: genotype:sfpq / RNA-Seq TRANSCRIPTOMIC RACE SINGLE ILLUMINA NextSeq 500   ERP125703 NextSeq 500 sequencing; three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 12 10 67_TCGTTC_67_TGCTAT_S22_R1_001.fastq.gz fastq     E MTAB 9899:sfpq 3 0:76 1:0 A:493165327;C:268347233;G:303443918;T:399152596;N:7138 76 0     493165327 268347233 303443918 399152596 7138 ERX4792135 ERS5459719 ERA3194022 Centre for Developmental Neurobiology King Centre for Developmental Neurobiology King 1 0.82521   0.12349   0.78545   0.57446   76   B   usable mapping rate illumina nextseq 3prime other lexogen bulk unknown unknown   United Kingdom 2020-12-10 Multi-stage Multi-stage Whole Organism All anatomical structures
10145 10145 ERR4973560 ERX4792134 ERS5459718 ERP125703 PRJEB41864 three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf E-MTAB-9899 Transcriptome Analysis mRNA was purified from whole zebrafish embryos at 24 hpf and three prime proximal region was sequenced. ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 12 10   Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library was generated using Lexogen's QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina sfpq 2 SAMEA7703209 Centre for Developmental Neurobiology King's College London ENA first public:2021 01 27|ENA last update:2020 12 10|External Id:SAMEA7703209|INSDC center alias:Centre for Developmental Neurobiology King's College London|INSDC center name:Centre for Developmental Neurobiology King's College London|INSDC first public:2021 01 27T17:06:57Z|INSDC last update:2020 12 10T17:23:32Z|INSDC status:public|Submitter Id:E MTAB 9899:sfpq 2|age:24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:sfpq / |organism part:whole organism|sample name:E MTAB 9899:sfpq 2                 NextSeq 500 sequencing; 3 prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf E MTAB 9899:sfpq 2 s sfpq 2 s three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library was generated using Lexogen's QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Experimental Factor: genotype:sfpq / RNA-Seq TRANSCRIPTOMIC RACE SINGLE ILLUMINA NextSeq 500   ERP125703 NextSeq 500 sequencing; three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 12 10 66_GACGAT_66_TCAGTC_S18_R1_001.fastq.gz fastq     E MTAB 9899:sfpq 2 0:76 1:0 A:426637005;C:227027693;G:257342561;T:338159540;N:5909 76 0     426637005 227027693 257342561 338159540 5909 ERX4792134 ERS5459718 ERA3194022 Centre for Developmental Neurobiology King Centre for Developmental Neurobiology King 1 0.81933   0.11571   0.78593   0.56675   76   B   usable mapping rate illumina nextseq 3prime other lexogen bulk unknown unknown   United Kingdom 2020-12-10 Multi-stage Multi-stage Whole Organism All anatomical structures
10146 10146 ERR4973559 ERX4792133 ERS5459717 ERP125703 PRJEB41864 three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf E-MTAB-9899 Transcriptome Analysis mRNA was purified from whole zebrafish embryos at 24 hpf and three prime proximal region was sequenced. ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 12 10   Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library was generated using Lexogen's QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina sfpq 1 SAMEA7703208 Centre for Developmental Neurobiology King's College London ENA first public:2021 01 27|ENA last update:2020 12 10|External Id:SAMEA7703208|INSDC center alias:Centre for Developmental Neurobiology King's College London|INSDC center name:Centre for Developmental Neurobiology King's College London|INSDC first public:2021 01 27T17:06:57Z|INSDC last update:2020 12 10T17:23:32Z|INSDC status:public|Submitter Id:E MTAB 9899:sfpq 1|age:24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:sfpq / |organism part:whole organism|sample name:E MTAB 9899:sfpq 1                 NextSeq 500 sequencing; 3 prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf E MTAB 9899:sfpq 1 s sfpq 1 s three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library was generated using Lexogen's QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Experimental Factor: genotype:sfpq / RNA-Seq TRANSCRIPTOMIC RACE SINGLE ILLUMINA NextSeq 500   ERP125703 NextSeq 500 sequencing; three prime mRNA seq of sfpq / zebrafish embryos and siblings at 24 hpf ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 12 10 65_AAGCTC_65_AAGAAG_S3_R1_001.fastq.gz fastq     E MTAB 9899:sfpq 1 0:76 1:0 A:425613638;C:225707961;G:254738302;T:336863560;N:5847 76 0     425613638 225707961 254738302 336863560 5847 ERX4792133 ERS5459717 ERA3194022 Centre for Developmental Neurobiology King Centre for Developmental Neurobiology King 1 0.81857   0.11342   0.78587   0.56439   76   B   usable mapping rate illumina nextseq 3prime other lexogen bulk unknown unknown   United Kingdom 2020-12-10 Multi-stage Multi-stage Whole Organism All anatomical structures
10213 10213 ERR6511329 ERX6138165 ERS7264188 ERP131213 PRJEB46978 Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore sequencing ena-STUDY-CENTER FOR GENOMIC REGULATION (CRG)-12-08-2021-14:48:52:906-1159 Other Nano3P seq is a simple and robust method to accurately estimate transcript levels tail lengths and tail nucleotide composition information in full length individual reads with minimal library preparation biases both in the coding and non coding transcriptome. ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28   Zebrafish Nano3P seq of Ribodepleted sample biological replicate 1 including 2 hpf 4 hpf 6 hpf RNAs Zebrafish Ribodep Rep1 SAMEA9541418 CENTER FOR GENOMIC REGULATION (CRG) ENA FIRST PUBLIC:2023 12 28T01:07:23Z|ENA LAST UPDATE:2023 12 28T01:07:23Z|External Id:SAMEA9541418|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2023 12 28T01:07:23Z|INSDC last update:2023 12 28T01:07:23Z|INSDC status:public|Submitter Id:Zebrafish Ribodep Rep1|common name:zebrafish|sample name:Zebrafish Ribodep Rep1|scientific name:Danio rerio                 MinION sequencing ena EXPERIMENT CENTER FOR GENOMIC REGULATION CRG 17 08 2021 13:09:55:665 3 cDNA786327 Nano3P seq Nano3P seq   OTHER TRANSCRIPTOMIC unspecified SINGLE OXFORD_NANOPORE MinION   ERP131213 MinION sequencing ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28 zebrafish_ribodep_rep1.tar.gz nanopore 1745399583.0 1644167.0 ena RUN CENTER FOR GENOMIC REGULATION CRG 17 08 2021 13:09:55:665 3 0:1061.57 A:449704009;C:421915878;G:378879857;T:494899839;N:0 1061       449704009 421915878 378879857 494899839 0 ERX6138165 ERS7264188 ERA5757997 CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive CENTER FOR GENOMIC REGULATION (CRG) 1 0.01112   0.0   0.99997   1.0   546   T   long read ont ont full_length rrna_depletion unknown bulk unknown unknown   Spain 2023-12-28 Multi-stage Embryo Undetermined Embryo Imprecise
10215 10215 ERR6511330 ERX6138166 ERS7264189 ERP131213 PRJEB46978 Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore sequencing ena-STUDY-CENTER FOR GENOMIC REGULATION (CRG)-12-08-2021-14:48:52:906-1159 Other Nano3P seq is a simple and robust method to accurately estimate transcript levels tail lengths and tail nucleotide composition information in full length individual reads with minimal library preparation biases both in the coding and non coding transcriptome. ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28   Zebrafish Nano3P seq of Ribodepleted sample biological replicate 1 including 2 hpf 4 hpf 6 hpf RNAs Zebrafish Ribodep Rep2 SAMEA9541419 CENTER FOR GENOMIC REGULATION (CRG) ENA FIRST PUBLIC:2023 12 28T01:07:23Z|ENA LAST UPDATE:2023 12 28T01:07:23Z|External Id:SAMEA9541419|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2023 12 28T01:07:23Z|INSDC last update:2023 12 28T01:07:23Z|INSDC status:public|Submitter Id:Zebrafish Ribodep Rep2|common name:zebrafish|sample name:Zebrafish Ribodep Rep2|scientific name:Danio rerio                 MinION sequencing ena EXPERIMENT CENTER FOR GENOMIC REGULATION CRG 17 08 2021 13:09:55:665 4 cDNA123791 Nano3P seq Nano3P seq   OTHER TRANSCRIPTOMIC unspecified SINGLE OXFORD_NANOPORE MinION   ERP131213 MinION sequencing ENA FIRST PUBLIC:2023 12 28|ENA LAST UPDATE:2023 12 28 zebrafish_ribodep_rep2.tar.gz nanopore 2038398139.0 1955617.0 ena RUN CENTER FOR GENOMIC REGULATION CRG 17 08 2021 13:09:55:665 4 0:1042.33 A:518369802;C:477535545;G:441294056;T:601198736;N:0 1042       518369802 477535545 441294056 601198736 0 ERX6138166 ERS7264189 ERA5757997 CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive CENTER FOR GENOMIC REGULATION (CRG)                             ont ont full_length rrna_depletion unknown bulk unknown unknown   Spain 2023-12-28 Multi-stage Embryo Undetermined Embryo Imprecise
10649 10649 ERR406885 ERX373262 ERS391761 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 5s24 SAMEA2299303 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299303|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:5s24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5s24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.4 batchA 24hpf SP YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:24 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 5s24.fq.gz fastq 584550600.0 11691012.0 E MTAB 2194:5s24.fq.gz 0:50 1:0 A:154602150;C:138134763;G:138628704;T:153175234;N:9749 50 0     154602150 138134763 138628704 153175234 9749 ERX373262 ERS391761 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.9356   0.0996   0.68615   0.47069   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10650 10650 ERR406893 ERX373261 ERS391760 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 5y32 SAMEA2299302 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299302|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:5y32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5y32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.5 batchA 32hpf YD YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:yolk|Experimental Factor: time:32 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 5y32.fq.gz fastq 528892950.0 10577859.0 E MTAB 2194:5y32.fq.gz 0:50 1:0 A:140383478;C:125036983;G:124119152;T:139344643;N:8694 50 0     140383478 125036983 124119152 139344643 8694 ERX373261 ERS391760 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93478   0.10542   0.68296   0.4795   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10651 10651 ERR406898 ERX373260 ERS391759 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 6s24 SAMEA2299301 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299301|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:6s24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6s24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.10 batchB 24hpf SP YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:24 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 6s24.fq.gz fastq 542771850.0 10855437.0 E MTAB 2194:6s24.fq.gz 0:50 1:0 A:142311943;C:129686202;G:129130172;T:141634727;N:8806 50 0     142311943 129686202 129130172 141634727 8806 ERX373260 ERS391759 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93717   0.09239   0.68876   0.46809   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10652 10652 ERR406896 ERX373259 ERS391758 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 13y32 SAMEA2299300 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299300|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:13y32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13y32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.18 batchC 32hpf YD YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:yolk|Experimental Factor: time:32 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 13y32.fq.gz fastq 649898350.0 12997967.0 E MTAB 2194:13y32.fq.gz 0:50 1:0 A:169738689;C:156130165;G:155102788;T:168916174;N:10534 50 0     169738689 156130165 155102788 168916174 10534 ERX373259 ERS391758 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93898   0.08535   0.68217   0.47133   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10653 10653 ERR406899 ERX373258 ERS391757 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 5s32 SAMEA2299299 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299299|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:5s32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5s32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.6 batchA 32hpf SP YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:32 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 5s32.fq.gz fastq 566813600.0 11336272.0 E MTAB 2194:5s32.fq.gz 0:50 1:0 A:149907366;C:134421172;G:133399280;T:149076590;N:9192 50 0     149907366 134421172 133399280 149076590 9192 ERX373258 ERS391757 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93497   0.10019   0.68379   0.4671   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10654 10654 ERR406888 ERX373257 ERS391756 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 5y24 SAMEA2299298 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299298|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:5y24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5y24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.3 batchA 24hpf YD YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:yolk|Experimental Factor: time:24 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 5y24.fq.gz fastq 578936250.0 11578725.0 E MTAB 2194:5y24.fq.gz 0:50 1:0 A:154884020;C:135497257;G:135214353;T:153331273;N:9347 50 0     154884020 135497257 135214353 153331273 9347 ERX373257 ERS391756 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.9342   0.1106   0.67811   0.47685   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10655 10655 ERR406887 ERX373256 ERS391755 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 13s24 SAMEA2299297 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299297|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:13s24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13s24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.16 batchC 24hpf SP YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:24 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 13s24.fq.gz fastq 837415050.0 16748301.0 E MTAB 2194:13s24.fq.gz 0:50 1:0 A:217172462;C:202556518;G:201365353;T:216307386;N:13331 50 0     217172462 202556518 201365353 216307386 13331 ERX373256 ERS391755 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93888   0.07561   0.6899   0.46646   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10656 10656 ERR406894 ERX373255 ERS391754 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 6y24 SAMEA2299296 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299296|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:6y24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6y24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.9 batchB 24hpf YD YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:yolk|Experimental Factor: time:24 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 6y24.fq.gz fastq 569424550.0 11388491.0 E MTAB 2194:6y24.fq.gz 0:50 1:0 A:149287318;C:136121879;G:135445765;T:148560272;N:9316 50 0     149287318 136121879 135445765 148560272 9316 ERX373255 ERS391754 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93486   0.0893   0.68751   0.46133   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10657 10657 ERR406895 ERX373254 ERS391753 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 13s8 SAMEA2299295 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299295|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:13s8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13s8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.14 batchC 8hpf SP YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:8 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 13s8.fq.gz fastq 532141500.0 10642830.0 E MTAB 2194:13s8.fq.gz 0:50 1:0 A:139773245;C:127051350;G:126773752;T:138534560;N:8593 50 0     139773245 127051350 126773752 138534560 8593 ERX373254 ERS391753 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93506   0.0742   0.74748   0.47765   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10658 10658 ERR406891 ERX373253 ERS391752 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 6s8 SAMEA2299294 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299294|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:6s8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6s8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.8 batchB 8hpf SP YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:8 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 6s8.fq.gz fastq 477620550.0 9552411.0 E MTAB 2194:6s8.fq.gz 0:50 1:0 A:127095393;C:112660046;G:111717464;T:126139686;N:7961 50 0     127095393 112660046 111717464 126139686 7961 ERX373253 ERS391752 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93605   0.08112   0.74552   0.46821   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10659 10659 ERR406886 ERX373252 ERS391751 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 6y8 SAMEA2299293 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:38Z|External Id:SAMEA2299293|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:38Z|INSDC status:public|Submitter Id:E MTAB 2194:6y8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6y8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.7 batchB 8hpf YD YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:yolk|Experimental Factor: time:8 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 6y8.fq.gz fastq 508637450.0 10172749.0 E MTAB 2194:6y8.fq.gz 0:50 1:0 A:135377293;C:119833844;G:119447157;T:133970958;N:8198 50 0     135377293 119833844 119447157 133970958 8198 ERX373252 ERS391751 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93203   0.07833   0.73744   0.47586   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10660 10660 ERR406892 ERX373251 ERS391750 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 6y32 SAMEA2299292 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:37Z|External Id:SAMEA2299292|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:37Z|INSDC status:public|Submitter Id:E MTAB 2194:6y32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6y32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.11 batchB 32hpf YD YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:yolk|Experimental Factor: time:32 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 6y32.fq.gz fastq 568482400.0 11369648.0 E MTAB 2194:6y32.fq.gz 0:50 1:0 A:149679881;C:135411801;G:134312216;T:149069222;N:9280 50 0     149679881 135411801 134312216 149069222 9280 ERX373251 ERS391750 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93184   0.104   0.68128   0.47652   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10661 10661 ERR406897 ERX373250 ERS391749 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 5y8 SAMEA2299291 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:37Z|External Id:SAMEA2299291|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:37Z|INSDC status:public|Submitter Id:E MTAB 2194:5y8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5y8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.1 batchA 8hpf YD YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:yolk|Experimental Factor: time:8 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 5y8.fq.gz fastq 497573200.0 9951464.0 E MTAB 2194:5y8.fq.gz 0:50 1:0 A:134128000;C:115688460;G:114668036;T:133080206;N:8498 50 0     134128000 115688460 114668036 133080206 8498 ERX373250 ERS391749 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93519   0.07057   0.73511   0.47977   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10662 10662 ERR406889 ERX373249 ERS391748 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 13s32 SAMEA2299290 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:37Z|External Id:SAMEA2299290|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:37Z|INSDC status:public|Submitter Id:E MTAB 2194:13s32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13s32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.19 batchC 32hpf SP YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:32 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 13s32.fq.gz fastq 637724150.0 12754483.0 E MTAB 2194:13s32.fq.gz 0:50 1:0 A:165500205;C:154383334;G:152953181;T:164877160;N:10270 50 0     165500205 154383334 152953181 164877160 10270 ERX373249 ERS391748 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93998   0.08954   0.68146   0.4729   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10663 10663 ERR406890 ERX373248 ERS391747 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 13y24 SAMEA2299289 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:26Z|External Id:SAMEA2299289|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:26Z|INSDC status:public|Submitter Id:E MTAB 2194:13y24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13y24|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.15 batchC 24hpf YD YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:yolk|Experimental Factor: time:24 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 13y24.fq.gz fastq 834725800.0 16694516.0 E MTAB 2194:13y24.fq.gz 0:50 1:0 A:216896952;C:201332171;G:200308143;T:216174965;N:13569 50 0     216896952 201332171 200308143 216174965 13569 ERX373248 ERS391747 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.9358   0.07569   0.68757   0.46994   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10664 10664 ERR406900 ERX373247 ERS391746 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 13y8 SAMEA2299288 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:26Z|External Id:SAMEA2299288|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:26Z|INSDC status:public|Submitter Id:E MTAB 2194:13y8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:13y8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.13 batchC 8hpf YD YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Removed yolk around 5hpf YD with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:yolk|Experimental Factor: time:8 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 13y8.fq.gz fastq 457245150.0 9144903.0 E MTAB 2194:13y8.fq.gz 0:50 1:0 A:119648940;C:109589521;G:109491446;T:118507707;N:7536 50 0     119648940 109589521 109491446 118507707 7536 ERX373247 ERS391746 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93146   0.0681   0.73718   0.47464   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10665 10665 ERR406884 ERX373246 ERS391745 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 6s32 SAMEA2299287 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:26Z|External Id:SAMEA2299287|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:26Z|INSDC status:public|Submitter Id:E MTAB 2194:6s32|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:6s32|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.12 batchB 32hpf SP YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:32 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 6s32.fq.gz fastq 652353200.0 13047064.0 E MTAB 2194:6s32.fq.gz 0:50 1:0 A:170844587;C:156203331;G:155264927;T:170029850;N:10505 50 0     170844587 156203331 155264927 170029850 10505 ERX373246 ERS391745 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93785   0.09102   0.68554   0.46397   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
10666 10666 ERR406901 ERX373245 ERS391744 ERP004564 PRJEB5188 YD embryos 8 hpf 24 hpf 32 hpf E-MTAB-2194 Transcriptome Analysis Limited nutrient availability during development puts individuals at risk to develop complications later in life. Central in this early life stress paradox lies developmental plasticity a poorly understood mechanism that responds to environmental cues from early to late developmental stages. In this study we introduce the zebrafish Danio rerio as a model to study the early developmental responses to reduced nutrient availability and their outcome. To reduce nutrient availability we partially remove the yolk during embryogenesis. Around 5 hpf we removed 30% of the yolk YD samples or sham punctured embryos SP with a Hamilton syringe system. At 8 24 hpf and 32 hpf we collected RNA from whole embryos and obtained transcriptome profiles by RNAseq.     Protocols: Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 5s8 SAMEA2299286 CAS-MPG PICB ENA FIRST PUBLIC:2014 04 01T17:00:44Z|ENA LAST UPDATE:2018 03 08T17:04:26Z|External Id:SAMEA2299286|INSDC center name:CAS MPG PICB|INSDC first public:2014 04 01T17:00:44Z|INSDC last update:2018 03 08T17:04:26Z|INSDC status:public|Submitter Id:E MTAB 2194:5s8|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo stage|genotype:wild type genotype|sample name:E MTAB 2194:5s8|scientific name:Danio rerio|specimen with known storage state:fresh specimen|strain:tb                 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf E MTAB 2194:Unique sample ID.2 batchA 8hpf SP YD embryos 8 hpf 24 hpf 32 hpf Zebrafish embryos in HANKS embryo buffer Around 5hpf sham puncture the controls SP with hamilton syringe system. Trizol RNA extraction of whole embryos Truseq RNA Sample preparation Kits V2 Experimental Factor: treatment:sham punctured embryos|Experimental Factor: time:8 hour RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   ERP004564 Illumina HiSeq 2000 sequencing; YD embryos 8 hpf 24 hpf 32 hpf ENA FIRST PUBLIC:2014 04 01|ENA LAST UPDATE:2018 11 16 5s8.fq.gz fastq 359298500.0 7185970.0 E MTAB 2194:5s8.fq.gz 0:50 1:0 A:96450828;C:83805020;G:83440885;T:95595844;N:5923 50 0     96450828 83805020 83440885 95595844 5923 ERX373245 ERS391744 ERA280282 CAS-MPG PICB|ArrayExpress CAS-MPG PICB|ArrayExpress 1 0.93524   0.07491   0.73312   0.47914   50   B   usable mapping rate illumina hiseq_era unknown random_priming trueseq bulk unknown unknown   China 2014-04-01 Multi-stage Embryo Whole Organism All anatomical structures
11042 11042 ERR9839781 ERX9385638 ERS12199238 ERP138294 PRJEB53494 Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing 94bf5509-4622-4d5f-b7c5-6a14bdfac340 Other RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome. ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10   Zebrafish Ribodepleted RNA 2hpf 4hpf 6hpf Zebrafish Ribodepleted Rep3 SAMEA110100413 CENTER FOR GENOMIC REGULATION (CRG) ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110100413|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:20:53Z|INSDC last update:2022 10 10T00:20:53Z|INSDC status:public|Submitter Id:Zebrafish Ribodepleted Rep3|common name:zebrafish|sample name:Zebrafish Ribodepleted Rep3                 MinION sequencing ena EXPERIMENT TAB 13 06 2022 16:07:52:807 817 cDNA897892 ZFRDR3 1     RNA-Seq TRANSCRIPTOMIC other SINGLE OXFORD_NANOPORE MinION   ERP138294 MinION sequencing ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10 cDNA897892_ZFRDR3.tar.gz nanopore 848659575.0 587586.0 ena RUN TAB 13 06 2022 16:07:52:808 818 0:1444.32 A:210205014;C:186527780;G:188214279;T:263712502;N:0 1444       210205014 186527780 188214279 263712502 0 ERX9385638 ERS12199238 ERA15547404 CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive CENTER FOR GENOMIC REGULATION (CRG)                             ont ont 3prime poly_a unknown bulk unknown unknown   Spain 2022-10-10 Multi-stage Embryo Undetermined Embryo Imprecise
11043 11043 ERR9839780 ERX9385637 ERS12199237 ERP138294 PRJEB53494 Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing 94bf5509-4622-4d5f-b7c5-6a14bdfac340 Other RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome. ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10   Zebrafish Ribodepleted RNA 2hpf 4hpf 6hpf Zebrafish Ribodepleted Rep2 SAMEA110100412 CENTER FOR GENOMIC REGULATION (CRG) ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110100412|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:20:53Z|INSDC last update:2022 10 10T00:20:53Z|INSDC status:public|Submitter Id:Zebrafish Ribodepleted Rep2|common name:zebrafish|sample name:Zebrafish Ribodepleted Rep2                 MinION sequencing ena EXPERIMENT TAB 13 06 2022 16:07:52:807 815 cDNA123791 ZFRDR2 1     RNA-Seq TRANSCRIPTOMIC other SINGLE OXFORD_NANOPORE MinION   ERP138294 MinION sequencing ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10 cDNA123791_ZFRDR2.tar.gz nanopore 2229275175.0 1955617.0 ena RUN TAB 13 06 2022 16:07:52:807 816 0:1139.93 A:533543922;C:498938137;G:515833119;T:680959997;N:0 1139       533543922 498938137 515833119 680959997 0 ERX9385637 ERS12199237 ERA15547404 CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive CENTER FOR GENOMIC REGULATION (CRG)                             ont ont 3prime poly_a unknown bulk unknown unknown   Spain 2022-10-10 Multi-stage Embryo Undetermined Embryo Imprecise
11044 11044 ERR9839779 ERX9385636 ERS12199236 ERP138294 PRJEB53494 Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing 94bf5509-4622-4d5f-b7c5-6a14bdfac340 Other RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome. ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10   Zebrafish Ribodepleted RNA 2hpf 4hpf 6hpf Zebrafish Ribodepleted Rep1 SAMEA110100411 CENTER FOR GENOMIC REGULATION (CRG) ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110100411|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:20:53Z|INSDC last update:2022 10 10T00:20:53Z|INSDC status:public|Submitter Id:Zebrafish Ribodepleted Rep1|common name:zebrafish|sample name:Zebrafish Ribodepleted Rep1                 MinION sequencing ena EXPERIMENT TAB 13 06 2022 16:07:52:807 813 cDNA786327 ZFRDR1 1     RNA-Seq TRANSCRIPTOMIC other SINGLE OXFORD_NANOPORE MinION   ERP138294 MinION sequencing ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10 cDNA786327_ZFRDR1.tar.gz nanopore 1900613556.0 1660167.0 ena RUN TAB 13 06 2022 16:07:52:807 814 0:1144.83 A:473050820;C:438054520;G:425169743;T:564338473;N:0 1144       473050820 438054520 425169743 564338473 0 ERX9385636 ERS12199236 ERA15547404 CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive CENTER FOR GENOMIC REGULATION (CRG)                             ont ont 3prime poly_a unknown bulk unknown unknown   Spain 2022-10-10 Multi-stage Embryo Undetermined Embryo Imprecise
24927 24927 SRR25557778 SRX21286665 SRS18536778 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant XI GSM7688794   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant XI We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688794 GSM7688794: Morphant XI; Danio rerio; RNA Seq GSM7688794 r1 GSM7688794 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-XI_S7_L001_R1_001.fastq.gz fastq 420092501.0 5668059.0 GSM7688794 r1 0:74.12 A:113006440;C:96725832;G:99320773;T:110915967;N:123489 74       113006440 96725832 99320773 110915967 123489 SRX21286665 SRS18536778 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94757   0.06229   0.72364   0.46676   74   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24928 24928 SRR25557779 SRX21286665 SRS18536778 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant XI GSM7688794   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant XI We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688794 GSM7688794: Morphant XI; Danio rerio; RNA Seq GSM7688794 r1 GSM7688794 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-XI_S7_L002_R1_001.fastq.gz fastq 421869780.0 5690053.0 GSM7688794 r2 0:74.14 A:113530489;C:97144227;G:99697959;T:111388539;N:108566 74       113530489 97144227 99697959 111388539 108566 SRX21286665 SRS18536778 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94921   0.06226   0.72462   0.4738   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24929 24929 SRR25557780 SRX21286665 SRS18536778 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant XI GSM7688794   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant XI We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688794 GSM7688794: Morphant XI; Danio rerio; RNA Seq GSM7688794 r1 GSM7688794 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-XI_S7_L003_R1_001.fastq.gz fastq 425064659.0 5734041.0 GSM7688794 r3 0:74.13 A:114342253;C:97873100;G:100532599;T:112196433;N:120274 74       114342253 97873100 100532599 112196433 120274 SRX21286665 SRS18536778 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94886   0.06112   0.72425   0.47055   74   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24930 24930 SRR25557781 SRX21286665 SRS18536778 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant XI GSM7688794   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant XI We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688794 GSM7688794: Morphant XI; Danio rerio; RNA Seq GSM7688794 r1 GSM7688794 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-XI_S7_L004_R1_001.fastq.gz fastq 416990548.0 5624902.0 GSM7688794 r4 0:74.13 A:112153356;C:96009158;G:98613145;T:110097476;N:117413 74       112153356 96009158 98613145 110097476 117413 SRX21286665 SRS18536778 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94869   0.06229   0.72506   0.47222   74   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24931 24931 SRR25557782 SRX21286664 SRS18536777 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant X GSM7688793   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant X We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688793 GSM7688793: Morphant X; Danio rerio; RNA Seq GSM7688793 r1 GSM7688793 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-X_S6_L001_R1_001.fastq.gz fastq 434485284.0 5881416.0 GSM7688793 r1 0:73.87 A:116640351;C:100176557;G:102659919;T:114799536;N:208921 73       116640351 100176557 102659919 114799536 208921 SRX21286664 SRS18536777 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94533   0.07176   0.72464   0.47632   74   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24932 24932 SRR25557783 SRX21286664 SRS18536777 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant X GSM7688793   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant X We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688793 GSM7688793: Morphant X; Danio rerio; RNA Seq GSM7688793 r1 GSM7688793 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-X_S6_L002_R1_001.fastq.gz fastq 435203869.0 5886556.0 GSM7688793 r2 0:73.93 A:116869356;C:100363580;G:102830644;T:114973504;N:166785 73       116869356 100363580 102830644 114973504 166785 SRX21286664 SRS18536777 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94542   0.07203   0.72421   0.47733   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24933 24933 SRR25557784 SRX21286664 SRS18536777 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant X GSM7688793   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant X We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688793 GSM7688793: Morphant X; Danio rerio; RNA Seq GSM7688793 r1 GSM7688793 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-X_S6_L003_R1_001.fastq.gz fastq 439897269.0 5951878.0 GSM7688793 r3 0:73.91 A:118101648;C:101426657;G:103990006;T:116184480;N:194478 73       118101648 101426657 103990006 116184480 194478 SRX21286664 SRS18536777 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94486   0.07224   0.72448   0.47915   74   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24934 24934 SRR25557785 SRX21286664 SRS18536777 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant X GSM7688793   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant X We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688793 GSM7688793: Morphant X; Danio rerio; RNA Seq GSM7688793 r1 GSM7688793 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-X_S6_L004_R1_001.fastq.gz fastq 431385256.0 5836029.0 GSM7688793 r4 0:73.92 A:115804970;C:99459059;G:101962932;T:113975935;N:182360 73       115804970 99459059 101962932 113975935 182360 SRX21286664 SRS18536777 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94432   0.07229   0.7261   0.47463   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24935 24935 SRR25557786 SRX21286663 SRS18536776 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant IX GSM7688792   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant IX We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688792 GSM7688792: Morphant IX; Danio rerio; RNA Seq GSM7688792 r1 GSM7688792 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-IX_S16_L001_R1_001.fastq.gz fastq 513309395.0 6929648.0 GSM7688792 r1 0:74.07 A:137428462;C:118688804;G:122019962;T:134991729;N:180438 74       137428462 118688804 122019962 134991729 180438 SRX21286663 SRS18536776 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94188   0.07029   0.73772   0.47692   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24936 24936 SRR25557787 SRX21286663 SRS18536776 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant IX GSM7688792   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant IX We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688792 GSM7688792: Morphant IX; Danio rerio; RNA Seq GSM7688792 r1 GSM7688792 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-IX_S16_L002_R1_001.fastq.gz fastq 517356735.0 6982196.0 GSM7688792 r2 0:74.10 A:138524037;C:119650852;G:122965491;T:136056171;N:160184 74       138524037 119650852 122965491 136056171 160184 SRX21286663 SRS18536776 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94281   0.06967   0.73963   0.48142   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24937 24937 SRR25557788 SRX21286663 SRS18536776 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant IX GSM7688792   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant IX We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688792 GSM7688792: Morphant IX; Danio rerio; RNA Seq GSM7688792 r1 GSM7688792 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-IX_S16_L003_R1_001.fastq.gz fastq 519422328.0 7010631.0 GSM7688792 r3 0:74.09 A:139040684;C:120128748;G:123529198;T:136551898;N:171800 74       139040684 120128748 123529198 136551898 171800 SRX21286663 SRS18536776 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94297   0.06942   0.73726   0.47499   74   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24938 24938 SRR25557789 SRX21286663 SRS18536776 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant IX GSM7688792   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant IX We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688792 GSM7688792: Morphant IX; Danio rerio; RNA Seq GSM7688792 r1 GSM7688792 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-IX_S16_L004_R1_001.fastq.gz fastq 511640294.0 6905748.0 GSM7688792 r4 0:74.09 A:136914638;C:118302866;G:121704665;T:134543505;N:174620 74       136914638 118302866 121704665 134543505 174620 SRX21286663 SRS18536776 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94176   0.07029   0.73868   0.47987   74   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24939 24939 SRR25557790 SRX21286662 SRS18536775 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant VIII GSM7688791   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant VIII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688791 GSM7688791: Morphant VIII; Danio rerio; RNA Seq GSM7688791 r1 GSM7688791 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-VIII_S14_L001_R1_001.fastq.gz fastq 429446821.0 5803178.0 GSM7688791 r1 0:74.00 A:114793535;C:99506379;G:102226914;T:112748761;N:171232 74       114793535 99506379 102226914 112748761 171232 SRX21286662 SRS18536775 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94175   0.06669   0.73673   0.48179   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24940 24940 SRR25557791 SRX21286662 SRS18536775 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant VIII GSM7688791   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant VIII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688791 GSM7688791: Morphant VIII; Danio rerio; RNA Seq GSM7688791 r1 GSM7688791 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-VIII_S14_L002_R1_001.fastq.gz fastq 434629893.0 5870828.0 GSM7688791 r2 0:74.03 A:116216940;C:100703527;G:103463365;T:114092681;N:153380 74       116216940 100703527 103463365 114092681 153380 SRX21286662 SRS18536775 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94143   0.0676   0.73791   0.48091   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24941 24941 SRR25557792 SRX21286662 SRS18536775 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant VIII GSM7688791   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant VIII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688791 GSM7688791: Morphant VIII; Danio rerio; RNA Seq GSM7688791 r1 GSM7688791 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-VIII_S14_L003_R1_001.fastq.gz fastq 435879881.0 5888685.0 GSM7688791 r3 0:74.02 A:116548094;C:100971153;G:103794902;T:114400770;N:164962 74       116548094 100971153 103794902 114400770 164962 SRX21286662 SRS18536775 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94195   0.06686   0.73785   0.48044   73   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24942 24942 SRR25557793 SRX21286662 SRS18536775 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant VIII GSM7688791   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant VIII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688791 GSM7688791: Morphant VIII; Danio rerio; RNA Seq GSM7688791 r1 GSM7688791 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-VIII_S14_L004_R1_001.fastq.gz fastq 429478475.0 5801978.0 GSM7688791 r4 0:74.02 A:114799280;C:99474677;G:102302775;T:112737475;N:164268 74       114799280 99474677 102302775 112737475 164268 SRX21286662 SRS18536775 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94118   0.06706   0.73892   0.47732   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24943 24943 SRR25557794 SRX21286661 SRS18536774 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant VII GSM7688790   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant VII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688790 GSM7688790: Morphant VII; Danio rerio; RNA Seq GSM7688790 r1 GSM7688790 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-VII_S15_L001_R1_001.fastq.gz fastq 459545188.0 6215897.0 GSM7688790 r1 0:73.93 A:121926568;C:107379723;G:110263606;T:119766429;N:208862 73       121926568 107379723 110263606 119766429 208862 SRX21286661 SRS18536774 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94273   0.06072   0.74582   0.47499   73   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24944 24944 SRR25557795 SRX21286661 SRS18536774 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant VII GSM7688790   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant VII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688790 GSM7688790: Morphant VII; Danio rerio; RNA Seq GSM7688790 r1 GSM7688790 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-VII_S15_L002_R1_001.fastq.gz fastq 463143624.0 6261406.0 GSM7688790 r2 0:73.97 A:122917997;C:108229793;G:111099867;T:120713978;N:181989 73       122917997 108229793 111099867 120713978 181989 SRX21286661 SRS18536774 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94387   0.06093   0.74341   0.47351   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24945 24945 SRR25557796 SRX21286661 SRS18536774 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant VII GSM7688790   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant VII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688790 GSM7688790: Morphant VII; Danio rerio; RNA Seq GSM7688790 r1 GSM7688790 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-VII_S15_L003_R1_001.fastq.gz fastq 465959664.0 6300929.0 GSM7688790 r3 0:73.95 A:123689364;C:108847593;G:111847868;T:121377463;N:197376 73       123689364 108847593 111847868 121377463 197376 SRX21286661 SRS18536774 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94322   0.06219   0.74357   0.47977   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24946 24946 SRR25557797 SRX21286661 SRS18536774 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Morphant VII GSM7688790   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing Morphant VII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant GSM7688790 GSM7688790: Morphant VII; Danio rerio; RNA Seq GSM7688790 r1 GSM7688790 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Morphant-VII_S15_L004_R1_001.fastq.gz fastq 459075430.0 6207363.0 GSM7688790 r4 0:73.96 A:121797426;C:107221116;G:110209684;T:119657308;N:189896 73       121797426 107221116 110209684 119657308 189896 SRX21286661 SRS18536774 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94313   0.06211   0.74343   0.47801   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24947 24947 SRR25557798 SRX21286660 SRS18536773 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control XI GSM7688787   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control XI We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688787 GSM7688787: Control XI; Danio rerio; RNA Seq GSM7688787 r1 GSM7688787 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-XI_S2_L001_R1_001.fastq.gz fastq 439719566.0 5947052.0 GSM7688787 r1 0:73.94 A:117482073;C:102083665;G:104685444;T:115272860;N:195524 73       117482073 102083665 104685444 115272860 195524 SRX21286660 SRS18536773 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94829   0.06278   0.72525   0.46494   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24948 24948 SRR25557799 SRX21286660 SRS18536773 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control XI GSM7688787   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control XI We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688787 GSM7688787: Control XI; Danio rerio; RNA Seq GSM7688787 r1 GSM7688787 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-XI_S2_L002_R1_001.fastq.gz fastq 438533503.0 5927990.0 GSM7688787 r2 0:73.98 A:117199594;C:101810881;G:104402169;T:114946611;N:174248 73       117199594 101810881 104402169 114946611 174248 SRX21286660 SRS18536773 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94887   0.06387   0.72827   0.46616   74   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24949 24949 SRR25557800 SRX21286660 SRS18536773 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control XI GSM7688787   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control XI We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688787 GSM7688787: Control XI; Danio rerio; RNA Seq GSM7688787 r1 GSM7688787 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-XI_S2_L003_R1_001.fastq.gz fastq 443995554.0 6003540.0 GSM7688787 r3 0:73.96 A:118663936;C:103031716;G:105723574;T:116387834;N:188494 73       118663936 103031716 105723574 116387834 188494 SRX21286660 SRS18536773 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94788   0.06232   0.72693   0.46653   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24950 24950 SRR25557801 SRX21286660 SRS18536773 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control XI GSM7688787   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control XI We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688787 GSM7688787: Control XI; Danio rerio; RNA Seq GSM7688787 r1 GSM7688787 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-XI_S2_L004_R1_001.fastq.gz fastq 435088869.0 5882642.0 GSM7688787 r4 0:73.96 A:116261447;C:100986653;G:103615584;T:114042354;N:182831 73       116261447 100986653 103615584 114042354 182831 SRX21286660 SRS18536773 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94914   0.06241   0.72829   0.4546   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24951 24951 SRR25557802 SRX21286659 SRS18536772 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control X GSM7688785   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control X We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688785 GSM7688785: Control X; Danio rerio; RNA Seq GSM7688785 r1 GSM7688785 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-X_S1_L001_R1_001.fastq.gz fastq 395130702.0 5338263.0 GSM7688785 r1 0:74.02 A:107005793;C:90183031;G:92316770;T:105476481;N:148627 74       107005793 90183031 92316770 105476481 148627 SRX21286659 SRS18536772 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94534   0.07625   0.73888   0.48135   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24952 24952 SRR25557803 SRX21286659 SRS18536772 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control X GSM7688785   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control X We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688785 GSM7688785: Control X; Danio rerio; RNA Seq GSM7688785 r1 GSM7688785 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-X_S1_L002_R1_001.fastq.gz fastq 396764458.0 5358448.0 GSM7688785 r2 0:74.04 A:107513717;C:90540282;G:92658504;T:105917444;N:134511 74       107513717 90540282 92658504 105917444 134511 SRX21286659 SRS18536772 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94374   0.07709   0.73878   0.47615   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24953 24953 SRR25557804 SRX21286659 SRS18536772 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control X GSM7688785   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control X We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688785 GSM7688785: Control X; Danio rerio; RNA Seq GSM7688785 r1 GSM7688785 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-X_S1_L003_R1_001.fastq.gz fastq 399623551.0 5397520.0 GSM7688785 r3 0:74.04 A:108230540;C:91192011;G:93388052;T:106665106;N:147842 74       108230540 91192011 93388052 106665106 147842 SRX21286659 SRS18536772 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94399   0.07657   0.73797   0.4794   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24954 24954 SRR25557805 SRX21286659 SRS18536772 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control X GSM7688785   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control X We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688785 GSM7688785: Control X; Danio rerio; RNA Seq GSM7688785 r1 GSM7688785 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-X_S1_L004_R1_001.fastq.gz fastq 393298978.0 5312101.0 GSM7688785 r4 0:74.04 A:106518845;C:89734564;G:91901232;T:105004490;N:139847 74       106518845 89734564 91901232 105004490 139847 SRX21286659 SRS18536772 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94423   0.07599   0.73884   0.47905   71   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24955 24955 SRR25557806 SRX21286658 SRS18536771 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control IX GSM7688783   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control IX We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688783 GSM7688783: Control IX; Danio rerio; RNA Seq GSM7688783 r1 GSM7688783 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-IX_S22_L001_R1_001.fastq.gz fastq 366045799.0 4944832.0 GSM7688783 r1 0:74.03 A:98000119;C:84654222;G:86951226;T:96295351;N:144881 74       98000119 84654222 86951226 96295351 144881 SRX21286658 SRS18536771 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94303   0.07499   0.73085   0.47881   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24956 24956 SRR25557807 SRX21286658 SRS18536771 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control IX GSM7688783   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control IX We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688783 GSM7688783: Control IX; Danio rerio; RNA Seq GSM7688783 r1 GSM7688783 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-IX_S22_L002_R1_001.fastq.gz fastq 369429068.0 4988719.0 GSM7688783 r2 0:74.05 A:98907882;C:85446993;G:87729593;T:97216477;N:128123 74       98907882 85446993 87729593 97216477 128123 SRX21286658 SRS18536771 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94261   0.07335   0.72969   0.47867   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24957 24957 SRR25557808 SRX21286658 SRS18536771 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control IX GSM7688783   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control IX We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688783 GSM7688783: Control IX; Danio rerio; RNA Seq GSM7688783 r1 GSM7688783 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-IX_S22_L003_R1_001.fastq.gz fastq 369967330.0 4996710.0 GSM7688783 r3 0:74.04 A:99035743;C:85549878;G:87926587;T:97310812;N:144310 74       99035743 85549878 87926587 97310812 144310 SRX21286658 SRS18536771 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94328   0.0743   0.73034   0.47133   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24958 24958 SRR25557809 SRX21286658 SRS18536771 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control IX GSM7688783   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control IX We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688783 GSM7688783: Control IX; Danio rerio; RNA Seq GSM7688783 r1 GSM7688783 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-IX_S22_L004_R1_001.fastq.gz fastq 365499176.0 4936305.0 GSM7688783 r4 0:74.04 A:97825658;C:84517732;G:86863655;T:96157429;N:134702 74       97825658 84517732 86863655 96157429 134702 SRX21286658 SRS18536771 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94286   0.07288   0.72999   0.4783   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24959 24959 SRR25557810 SRX21286657 SRS18536770 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control VIII GSM7688782   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control VIII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688782 GSM7688782: Control VIII; Danio rerio; RNA Seq GSM7688782 r1 GSM7688782 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-VIII_S20_L001_R1_001.fastq.gz fastq 488585907.0 6585668.0 GSM7688782 r1 0:74.19 A:131727468;C:112349971;G:115189425;T:129203159;N:115884 74       131727468 112349971 115189425 129203159 115884 SRX21286657 SRS18536770 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.93794   0.07381   0.7315   0.47355   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24960 24960 SRR25557811 SRX21286657 SRS18536770 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control VIII GSM7688782   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control VIII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688782 GSM7688782: Control VIII; Danio rerio; RNA Seq GSM7688782 r1 GSM7688782 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-VIII_S20_L002_R1_001.fastq.gz fastq 493766544.0 6653820.0 GSM7688782 r2 0:74.21 A:133135166;C:113551418;G:116398455;T:130575771;N:105734 74       133135166 113551418 116398455 130575771 105734 SRX21286657 SRS18536770 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.93729   0.07312   0.7307   0.47966   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24961 24961 SRR25557812 SRX21286657 SRS18536770 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control VIII GSM7688782   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control VIII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688782 GSM7688782: Control VIII; Danio rerio; RNA Seq GSM7688782 r1 GSM7688782 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-VIII_S20_L003_R1_001.fastq.gz fastq 494935071.0 6670024.0 GSM7688782 r3 0:74.20 A:133406912;C:113769494;G:116771560;T:130871612;N:115493 74       133406912 113769494 116771560 130871612 115493 SRX21286657 SRS18536770 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.93847   0.07383   0.73194   0.47646   74   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24962 24962 SRR25557813 SRX21286657 SRS18536770 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control VIII GSM7688782   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control VIII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688782 GSM7688782: Control VIII; Danio rerio; RNA Seq GSM7688782 r1 GSM7688782 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-VIII_S20_L004_R1_001.fastq.gz fastq 487644286.0 6572100.0 GSM7688782 r4 0:74.20 A:131423055;C:112092623;G:115067911;T:128945959;N:114738 74       131423055 112092623 115067911 128945959 114738 SRX21286657 SRS18536770 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.93708   0.0732   0.73186   0.4781   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24963 24963 SRR25557814 SRX21286656 SRS18536769 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control VII GSM7688781   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control VII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688781 GSM7688781: Control VII; Danio rerio; RNA Seq GSM7688781 r1 GSM7688781 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-VII_S21_L001_R1_001.fastq.gz fastq 419048369.0 5664168.0 GSM7688781 r1 0:73.98 A:111569757;C:97553687;G:100228004;T:109523480;N:173441 73       111569757 97553687 100228004 109523480 173441 SRX21286656 SRS18536769 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94179   0.06596   0.74499   0.46809   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24964 24964 SRR25557815 SRX21286656 SRS18536769 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control VII GSM7688781   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control VII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688781 GSM7688781: Control VII; Danio rerio; RNA Seq GSM7688781 r1 GSM7688781 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-VII_S21_L002_R1_001.fastq.gz fastq 422419362.0 5707444.0 GSM7688781 r2 0:74.01 A:112476977;C:98366185;G:101046586;T:110369882;N:159732 74       112476977 98366185 101046586 110369882 159732 SRX21286656 SRS18536769 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94275   0.06539   0.74523   0.47247   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24965 24965 SRR25557816 SRX21286656 SRS18536769 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control VII GSM7688781   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control VII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688781 GSM7688781: Control VII; Danio rerio; RNA Seq GSM7688781 r1 GSM7688781 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-VII_S21_L003_R1_001.fastq.gz fastq 424260551.0 5733133.0 GSM7688781 r3 0:74.00 A:112957538;C:98789480;G:101496747;T:110850186;N:166600 74       112957538 98789480 101496747 110850186 166600 SRX21286656 SRS18536769 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94174   0.06482   0.74304   0.46935   75   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
24966 24966 SRR25557817 SRX21286656 SRS18536769 SRP453884 PRJNA1003026 Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq] GSE240238 Transcriptome Analysis Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory s… parent bioproject:PRJNA1003022 pubmed:38017520   Control VII GSM7688781   source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing Control VII We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos. Spinal Cord The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS. Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height … The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos. tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control GSM7688781 GSM7688781: Control VII; Danio rerio; RNA Seq GSM7688781 r1 GSM7688781 1 Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height …   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP453884   loader:fastq load.py Control-VII_S21_L004_R1_001.fastq.gz fastq 417875320.0 5646817.0 GSM7688781 r4 0:74.00 A:111226895;C:97273168;G:100030641;T:109182520;N:162096 74       111226895 97273168 100030641 109182520 162096 SRX21286656 SRS18536769 SRA1688461 Lewis Lab, Biology, Syracuse University Lewis Lab, Biology, Syracuse University 1 0.94352   0.06524   0.74442   0.47095   74   B   usable mapping rate illumina nextseq unknown cdna_unspecified nextera sc single_cell_plate smartseq   United States 2023-08-07 Multi-stage Embryo Spinal Cord Nervous System
25277 25277 SRR30160454 SRX25627658 SRS22272474 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT bud 10 hpf charged tRNA seqrep 3 GSM8441306   tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing WT bud 10 hpf charged tRNA seqrep 3 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions 10 hpf embryos   Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   cell type:10 hpf embryos GSM8441306 GSM8441306: WT bud 10 hpf charged tRNA seqrep 3; Danio rerio; ncRNA Seq GSM8441306 r1 GSM8441306 1 Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP457111     10hpf_aa_rep3.fastq.gz fastq 193965330.0 3367323.0 GSM8441306 r1 0:57.60 A:36799299;C:55100074;G:53758955;T:48306966;N:36 57       36799299 55100074 53758955 48306966 36 SRX25627658 SRS22272474 SRA1941998 Max Planck Institute of Biochemistry Max Planck Institute of Biochemistry 1 0.34405   0.05049   0.89471   0.46469   88   B   usable mapping rate illumina novaseq_era 5prime size_fractionation unknown bulk unknown unknown   Germany 2024-08-05 Multi-stage Embryo Embryo Imprecise All anatomical structures
25278 25278 SRR30160455 SRX25627657 SRS22272473 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT bud 10 hpf charged tRNA seqrep 2 GSM8441305   tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing WT bud 10 hpf charged tRNA seqrep 2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions 10 hpf embryos   Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   cell type:10 hpf embryos GSM8441305 GSM8441305: WT bud 10 hpf charged tRNA seqrep 2; Danio rerio; ncRNA Seq GSM8441305 r1 GSM8441305 1 Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP457111     10hpf_aa_rep2.fastq.gz fastq 138524715.0 2369009.0 GSM8441305 r1 0:58.47 A:26396279;C:39139297;G:38459048;T:34530060;N:31 58       26396279 39139297 38459048 34530060 31 SRX25627657 SRS22272473 SRA1941998 Max Planck Institute of Biochemistry Max Planck Institute of Biochemistry 1 0.35458   0.05179   0.89424   0.46401   74   B   usable mapping rate illumina novaseq_era 5prime size_fractionation unknown bulk unknown unknown   Germany 2024-08-05 Multi-stage Embryo Embryo Imprecise All anatomical structures
25279 25279 SRR30160456 SRX25627656 SRS22272472 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT bud 10 hpf charged tRNA seqrep 1 GSM8441304   tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing WT bud 10 hpf charged tRNA seqrep 1 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions 10 hpf embryos   Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   cell type:10 hpf embryos GSM8441304 GSM8441304: WT bud 10 hpf charged tRNA seqrep 1; Danio rerio; ncRNA Seq GSM8441304 r1 GSM8441304 1 Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP457111     10hpf_aa_rep1.fastq.gz fastq 54473618.0 946419.0 GSM8441304 r1 0:57.56 A:10345022;C:15413782;G:15135500;T:13579304;N:10 57       10345022 15413782 15135500 13579304 10 SRX25627656 SRS22272472 SRA1941998 Max Planck Institute of Biochemistry Max Planck Institute of Biochemistry 1 0.36103   0.0515   0.89227   0.4748   81   B   usable mapping rate illumina novaseq_era 5prime size_fractionation unknown bulk unknown unknown   Germany 2024-08-05 Multi-stage Embryo Embryo Imprecise All anatomical structures
25280 25280 SRR30160457 SRX25627655 SRS22272471 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT sphere 4 hpf charged tRNA seqrep 3 GSM8441303   tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing WT sphere 4 hpf charged tRNA seqrep 3 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions 4 hpf embryos   Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   cell type:4 hpf embryos GSM8441303 GSM8441303: WT sphere 4 hpf charged tRNA seqrep 3; Danio rerio; ncRNA Seq GSM8441303 r1 GSM8441303 1 Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP457111     4hpf_aa_rep3.fastq.gz fastq 100810543.0 1747597.0 GSM8441303 r1 0:57.69 A:20466558;C:28054923;G:26849246;T:25439798;N:18 57       20466558 28054923 26849246 25439798 18 SRX25627655 SRS22272471 SRA1941998 Max Planck Institute of Biochemistry Max Planck Institute of Biochemistry 1 0.36374   0.06294   0.87316   0.54642   39   B   usable mapping rate illumina novaseq_era 5prime size_fractionation unknown bulk unknown unknown   Germany 2024-08-05 Multi-stage Embryo Embryo Imprecise All anatomical structures
25281 25281 SRR30160458 SRX25627654 SRS22272470 SRP457111 PRJNA1009808 Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq] GSE241754 Transcriptome Analysis Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis. parent bioproject:PRJNA1009800 pubmed:39402326   WT sphere 4 hpf charged tRNA seqrep 2 GSM8441302   tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing WT sphere 4 hpf charged tRNA seqrep 2 Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions 4 hpf embryos   Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   cell type:4 hpf embryos GSM8441302 GSM8441302: WT sphere 4 hpf charged tRNA seqrep 2; Danio rerio; ncRNA Seq GSM8441302 r1 GSM8441302 1 Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.   ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina NovaSeq 6000   SRP457111     4hpf_aa_rep2.fastq.gz fastq 121662759.0 2046536.0 GSM8441302 r1 0:59.45 A:24519095;C:33689156;G:32726095;T:30728382;N:31 59       24519095 33689156 32726095 30728382 31 SRX25627654 SRS22272470 SRA1941998 Max Planck Institute of Biochemistry Max Planck Institute of Biochemistry 1 0.3726   0.06263   0.87136   0.55584   31   B   usable mapping rate illumina novaseq_era 5prime size_fractionation unknown bulk unknown unknown   Germany 2024-08-05 Multi-stage Embryo Embryo Imprecise All anatomical structures

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;