run_metadata
332 rows where devstage_curation = "Larval" and tissue_curation_coarse = "Liver and Biliary System"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 171 | 171 | DRR075399 | DRX069313 | DRS075494 | DRP004473 | PRJDB5226 | Effects of local gut tumor on whole organismal gene expressions in zebrafish | DRP004473 | Other | How tumors affects whole organismal physiology remains largely unknown. To address this we established the novel gut tumor model in zebrafish Danio rerio. This model develops tumor at an early stage of juvenile development when zebrafish larvae are small <4mm enabling us to perform whole organismal RNA seq experiments. Control or tumor bearing zebrafish were dissected into the three parts under microscope: the liver the gut/gut tumor and others. Tissues from >10 individuals were pooled and RNA extracted. Analyses on these RNA seq samples identified a set of host genes affected by the gut tumor contributing to discovering novel tumor organ interactions and their mediators in zebrafish. | The liver of control fish 7dpf | Control liver | SAMD00065413 | sample name:3 control liver 150701 Hiseq3A l3 019|tissue type:Liver | Illumina HiSeq 2500 sequencing of SAMD00065413 | DRX069313 | Control liver | 1 | Agilent SureSelect Strand Specific RNA Prep Kit | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP004473 | Illumina HiSeq 2500 sequencing of SAMD00065413 | 951579036.0 | 26432751.0 | DRR075399 | 0:36 | A:231570583;C:228182815;G:227223430;T:264569214;N:32994 | 36 | 231570583 | 228182815 | 227223430 | 264569214 | 32994 | DRX069313 | DRS075494 | DRA005199 | ATR|The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International | The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International | 1 | 0.8903 | 0.08667 | 0.7236 | 0.51557 | 36 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2018-09-19 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||||||
| 8104 | 8104 | ERR2455366 | ERX2474426 | ERS2327331 | ERP107743 | PRJEB25789 | RNA seq of zebrafish larvae fed with different diets | E-MTAB-6636 | Transcriptome Analysis | We aim to establish NAFLD model of Zebrafish. Zebrafish larvae fed with high cholesterol diet high fructose diet and overfeed diet to induce liver steatosis. RNA seq was employed to analyze the effects of different diets on NAFLD development. | ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 03 29 | Protocols: Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. | Sample 4 | SAMEA104725948 | Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College | ENA FIRST PUBLIC:2018 12 01T17:02:09Z|ENA LAST UPDATE:2018 03 29T12:32:24Z|External Id:SAMEA104725948|INSDC center name:Institute of Medicinal Biotechnology Chinese Academy of Medical Sciences and Peking Union Medical College|INSDC first public:2018 12 01T17:02:09Z|INSDC last update:2018 03 29T12:32:24Z|INSDC status:public|Submitter Id:E MTAB 6636:Sample 4|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|diet:overfeeding|organism part:liver|sample name:E MTAB 6636:Sample 4|scientific name:Danio rerio | Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets | E MTAB 6636:Sample 4 s | Sample 4 s | RNA seq of zebrafish larvae fed with different diets | Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. | Experimental Factor: diet:overfeeding | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 4000 | ERP107743 | Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets | ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 11 16 | OF-4_H7MWNALXX_L6_1.fq.gz | fastq | 4961276550.0 | 33075177.0 | E MTAB 6636:Sample 4 | 0:150 1:0 | A:1349413168;C:1135314970;G:1137935563;T:1338034716;N:578133 | 150 | 0 | 1349413168 | 1135314970 | 1137935563 | 1338034716 | 578133 | ERX2474426 | ERS2327331 | ERA1259907 | Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive | Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive | 1 | 0.90787 | 0.11999 | 0.66123 | 0.49072 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2018-03-29 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 8105 | 8105 | ERR2455365 | ERX2474425 | ERS2327330 | ERP107743 | PRJEB25789 | RNA seq of zebrafish larvae fed with different diets | E-MTAB-6636 | Transcriptome Analysis | We aim to establish NAFLD model of Zebrafish. Zebrafish larvae fed with high cholesterol diet high fructose diet and overfeed diet to induce liver steatosis. RNA seq was employed to analyze the effects of different diets on NAFLD development. | ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 03 29 | Protocols: Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. | Sample 3 | SAMEA104725947 | Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College | ENA FIRST PUBLIC:2018 12 01T17:02:09Z|ENA LAST UPDATE:2018 03 29T12:32:24Z|External Id:SAMEA104725947|INSDC center name:Institute of Medicinal Biotechnology Chinese Academy of Medical Sciences and Peking Union Medical College|INSDC first public:2018 12 01T17:02:09Z|INSDC last update:2018 03 29T12:32:24Z|INSDC status:public|Submitter Id:E MTAB 6636:Sample 3|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|diet:fructose|organism part:liver|sample name:E MTAB 6636:Sample 3|scientific name:Danio rerio | Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets | E MTAB 6636:Sample 3 s | Sample 3 s | RNA seq of zebrafish larvae fed with different diets | Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. | Experimental Factor: diet:fructose | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 4000 | ERP107743 | Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets | ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 11 16 | Fru-3_H7MWNALXX_L5_1.fq.gz | fastq | 5858273250.0 | 39055155.0 | E MTAB 6636:Sample 3 | 0:150 1:0 | A:1580150663;C:1353221682;G:1355865524;T:1568428138;N:607243 | 150 | 0 | 1580150663 | 1353221682 | 1355865524 | 1568428138 | 607243 | ERX2474425 | ERS2327330 | ERA1259907 | Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive | Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive | 1 | 0.91505 | 0.11036 | 0.65985 | 0.48443 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2018-03-29 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 8106 | 8106 | ERR2455364 | ERX2474424 | ERS2327329 | ERP107743 | PRJEB25789 | RNA seq of zebrafish larvae fed with different diets | E-MTAB-6636 | Transcriptome Analysis | We aim to establish NAFLD model of Zebrafish. Zebrafish larvae fed with high cholesterol diet high fructose diet and overfeed diet to induce liver steatosis. RNA seq was employed to analyze the effects of different diets on NAFLD development. | ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 03 29 | Protocols: Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. | Sample 2 | SAMEA104725946 | Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College | ENA FIRST PUBLIC:2018 12 01T17:02:09Z|ENA LAST UPDATE:2018 03 29T12:32:24Z|External Id:SAMEA104725946|INSDC center name:Institute of Medicinal Biotechnology Chinese Academy of Medical Sciences and Peking Union Medical College|INSDC first public:2018 12 01T17:02:09Z|INSDC last update:2018 03 29T12:32:24Z|INSDC status:public|Submitter Id:E MTAB 6636:Sample 2|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|diet:cholesterol|organism part:liver|sample name:E MTAB 6636:Sample 2|scientific name:Danio rerio | Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets | E MTAB 6636:Sample 2 s | Sample 2 s | RNA seq of zebrafish larvae fed with different diets | Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. | Experimental Factor: diet:cholesterol | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 4000 | ERP107743 | Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets | ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 11 16 | Cho-2_H7MWNALXX_L5_1.fq.gz | fastq | 5636304900.0 | 37575366.0 | E MTAB 6636:Sample 2 | 0:150 1:0 | A:1526862069;C:1295343770;G:1298751994;T:1514766898;N:580169 | 150 | 0 | 1526862069 | 1295343770 | 1298751994 | 1514766898 | 580169 | ERX2474424 | ERS2327329 | ERA1259907 | Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive | Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive | 1 | 0.91032 | 0.11644 | 0.66649 | 0.47766 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2018-03-29 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 8107 | 8107 | ERR2455363 | ERX2474423 | ERS2327328 | ERP107743 | PRJEB25789 | RNA seq of zebrafish larvae fed with different diets | E-MTAB-6636 | Transcriptome Analysis | We aim to establish NAFLD model of Zebrafish. Zebrafish larvae fed with high cholesterol diet high fructose diet and overfeed diet to induce liver steatosis. RNA seq was employed to analyze the effects of different diets on NAFLD development. | ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 03 29 | Protocols: Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. | Sample 1 | SAMEA104725945 | Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College | ENA FIRST PUBLIC:2018 12 01T17:02:09Z|ENA LAST UPDATE:2018 03 29T12:32:24Z|External Id:SAMEA104725945|INSDC center name:Institute of Medicinal Biotechnology Chinese Academy of Medical Sciences and Peking Union Medical College|INSDC first public:2018 12 01T17:02:09Z|INSDC last update:2018 03 29T12:32:24Z|INSDC status:public|Submitter Id:E MTAB 6636:Sample 1|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|diet:control|organism part:liver|sample name:E MTAB 6636:Sample 1|scientific name:Danio rerio | Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets | E MTAB 6636:Sample 1 s | Sample 1 s | RNA seq of zebrafish larvae fed with different diets | Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. | Experimental Factor: diet:control | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 4000 | ERP107743 | Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets | ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 11 16 | ND-1_H7MWNALXX_L5_1.fq.gz | fastq | 5197165350.0 | 34647769.0 | E MTAB 6636:Sample 1 | 0:150 1:0 | A:1430911816;C:1174811274;G:1175616551;T:1415284019;N:541690 | 150 | 0 | 1430911816 | 1174811274 | 1175616551 | 1415284019 | 541690 | ERX2474423 | ERS2327328 | ERA1259907 | Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive | Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive | 1 | 0.89838 | 0.13883 | 0.66129 | 0.48467 | 150 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2018-03-29 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 28955 | 28955 | SRR26862014 | SRX22556964 | SRS19565505 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | atf4a / ;atf4b / ;sec31anju221 7dpf liver rep3 | GSM7905882 | source name:liver|tissue:liver|genotype:atf4a / ;atf4b / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | atf4a / ;atf4b / ;sec31anju221 7dpf liver rep3 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:atf4a / ;atf4b / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905882 | GSM7905882: atf4a / ;atf4b / ;sec31anju221 7dpf liver rep3; Danio rerio; RNA Seq | GSM7905882 r1 | GSM7905882 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | atf4a_atf4b_sec31a_7dpf_liver_3_R1.fastq.gz atf4a_atf4b_sec31a_7dpf_liver_3_R2.fastq.gz | fastq fastq | 5909169300.0 | 19697231.0 | GSM7905882 r1 | 0:150 1:150 | A:1814217313;C:1062889607;G:1281434828;T:1750535462;N:92090 | 150 | 150 | 1814217313 | 1062889607 | 1281434828 | 1750535462 | 92090 | SRX22556964 | SRS19565505 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.76999 | 0.77426 | 0.42801 | 0.42392 | 0.8016 | 0.80275 | 0.54736 | 0.56955 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28956 | 28956 | SRR26862015 | SRX22556963 | SRS19565504 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | atf4a / ;atf4b / ;sec31anju221 7dpf liver rep2 | GSM7905881 | source name:liver|tissue:liver|genotype:atf4a / ;atf4b / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | atf4a / ;atf4b / ;sec31anju221 7dpf liver rep2 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:atf4a / ;atf4b / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905881 | GSM7905881: atf4a / ;atf4b / ;sec31anju221 7dpf liver rep2; Danio rerio; RNA Seq | GSM7905881 r1 | GSM7905881 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | atf4a_atf4b_sec31a_7dpf_liver_2_R2.fastq.gz atf4a_atf4b_sec31a_7dpf_liver_2_R1.fastq.gz | fastq fastq | 5909169300.0 | 19697231.0 | GSM7905881 r1 | 0:150 1:150 | A:1814304871;C:1062851267;G:1281344920;T:1750575670;N:92572 | 150 | 150 | 1814304871 | 1062851267 | 1281344920 | 1750575670 | 92572 | SRX22556963 | SRS19565504 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.77 | 0.77338 | 0.42787 | 0.42319 | 0.80137 | 0.80314 | 0.56997 | 0.57195 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28957 | 28957 | SRR26862016 | SRX22556962 | SRS19565503 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | atf4a / ;atf4b / ;sec31anju221 7dpf liver rep1 | GSM7905880 | source name:liver|tissue:liver|genotype:atf4a / ;atf4b / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | atf4a / ;atf4b / ;sec31anju221 7dpf liver rep1 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:atf4a / ;atf4b / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905880 | GSM7905880: atf4a / ;atf4b / ;sec31anju221 7dpf liver rep1; Danio rerio; RNA Seq | GSM7905880 r1 | GSM7905880 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | atf4a_atf4b_sec31a_7dpf_liver_1_R1.fastq.gz atf4a_atf4b_sec31a_7dpf_liver_1_R2.fastq.gz | fastq fastq | 5909169600.0 | 19697232.0 | GSM7905880 r1 | 0:150 1:150 | A:1814273460;C:1062781687;G:1281372048;T:1750650699;N:91706 | 150 | 150 | 1814273460 | 1062781687 | 1281372048 | 1750650699 | 91706 | SRX22556962 | SRS19565503 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.76973 | 0.77461 | 0.42583 | 0.42416 | 0.80154 | 0.80501 | 0.56619 | 0.57103 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28958 | 28958 | SRR26862017 | SRX22556961 | SRS19565502 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | atf6 / ;sec31anju221 7dpf liver rep3 | GSM7905879 | source name:liver|tissue:liver|genotype:atf6 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | atf6 / ;sec31anju221 7dpf liver rep3 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:atf6 / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905879 | GSM7905879: atf6 / ;sec31anju221 7dpf liver rep3; Danio rerio; RNA Seq | GSM7905879 r1 | GSM7905879 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | atf6_sec31a_7dpf_liver_3_R1.fastq.gz atf6_sec31a_7dpf_liver_3_R2.fastq.gz | fastq fastq | 5861267700.0 | 19537559.0 | GSM7905879 r1 | 0:150 1:150 | A:1784341701;C:1072473445;G:1285100764;T:1719260200;N:91590 | 150 | 150 | 1784341701 | 1072473445 | 1285100764 | 1719260200 | 91590 | SRX22556961 | SRS19565502 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.75325 | 0.76151 | 0.45725 | 0.45689 | 0.78798 | 0.78922 | 0.56218 | 0.56438 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28959 | 28959 | SRR26862018 | SRX22556960 | SRS19565501 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | atf6 / ;sec31anju221 7dpf liver rep2 | GSM7905878 | source name:liver|tissue:liver|genotype:atf6 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | atf6 / ;sec31anju221 7dpf liver rep2 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:atf6 / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905878 | GSM7905878: atf6 / ;sec31anju221 7dpf liver rep2; Danio rerio; RNA Seq | GSM7905878 r1 | GSM7905878 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | atf6_sec31a_7dpf_liver_2_R1.fastq.gz atf6_sec31a_7dpf_liver_2_R2.fastq.gz | fastq fastq | 5861267700.0 | 19537559.0 | GSM7905878 r1 | 0:150 1:150 | A:1784326758;C:1072428588;G:1285145147;T:1719275142;N:92065 | 150 | 150 | 1784326758 | 1072428588 | 1285145147 | 1719275142 | 92065 | SRX22556960 | SRS19565501 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.75399 | 0.76366 | 0.46023 | 0.46101 | 0.79153 | 0.79243 | 0.56082 | 0.56109 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28960 | 28960 | SRR26862019 | SRX22556959 | SRS19565500 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | atf6 / ;sec31anju221 7dpf liver rep1 | GSM7905877 | source name:liver|tissue:liver|genotype:atf6 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | atf6 / ;sec31anju221 7dpf liver rep1 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:atf6 / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905877 | GSM7905877: atf6 / ;sec31anju221 7dpf liver rep1; Danio rerio; RNA Seq | GSM7905877 r1 | GSM7905877 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | atf6_sec31a_7dpf_liver_1_R1.fastq.gz atf6_sec31a_7dpf_liver_1_R2.fastq.gz | fastq fastq | 5861267700.0 | 19537559.0 | GSM7905877 r1 | 0:150 1:150 | A:1784239507;C:1072424839;G:1285216751;T:1719294746;N:91857 | 150 | 150 | 1784239507 | 1072424839 | 1285216751 | 1719294746 | 91857 | SRX22556959 | SRS19565500 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.75279 | 0.76268 | 0.45792 | 0.46002 | 0.79251 | 0.79482 | 0.55778 | 0.55965 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28961 | 28961 | SRR26862020 | SRX22556958 | SRS19565499 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | srebf2 / ;sec31anju221 7dpf liver rep3 | GSM7905876 | source name:liver|tissue:liver|genotype:srebf2 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | srebf2 / ;sec31anju221 7dpf liver rep3 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:srebf2 / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905876 | GSM7905876: srebf2 / ;sec31anju221 7dpf liver rep3; Danio rerio; RNA Seq | GSM7905876 r1 | GSM7905876 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | srebf2_sec31a_7dpf_liver_3_R2.fastq.gz srebf2_sec31a_7dpf_liver_3_R1.fastq.gz | fastq fastq | 5510352000.0 | 18367840.0 | GSM7905876 r1 | 0:150 1:150 | A:1627756472;C:1023474678;G:1300851324;T:1558184587;N:84939 | 150 | 150 | 1627756472 | 1023474678 | 1300851324 | 1558184587 | 84939 | SRX22556958 | SRS19565499 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.80994 | 0.82412 | 0.13867 | 0.1397 | 0.84264 | 0.84228 | 0.58499 | 0.58509 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28962 | 28962 | SRR26862021 | SRX22556957 | SRS19565498 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | srebf2 / ;sec31anju221 7dpf liver rep2 | GSM7905875 | source name:liver|tissue:liver|genotype:srebf2 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | srebf2 / ;sec31anju221 7dpf liver rep2 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:srebf2 / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905875 | GSM7905875: srebf2 / ;sec31anju221 7dpf liver rep2; Danio rerio; RNA Seq | GSM7905875 r1 | GSM7905875 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | srebf2_sec31a_7dpf_liver_2_R1.fastq.gz srebf2_sec31a_7dpf_liver_2_R2.fastq.gz | fastq fastq | 5510352000.0 | 18367840.0 | GSM7905875 r1 | 0:150 1:150 | A:1627771682;C:1023494582;G:1300898781;T:1558101507;N:85448 | 150 | 150 | 1627771682 | 1023494582 | 1300898781 | 1558101507 | 85448 | SRX22556957 | SRS19565498 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.81036 | 0.82384 | 0.14055 | 0.13973 | 0.84151 | 0.84145 | 0.58974 | 0.57294 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28963 | 28963 | SRR26862022 | SRX22556956 | SRS19565497 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | srebf2 / ;sec31anju221 7dpf liver rep1 | GSM7905874 | source name:liver|tissue:liver|genotype:srebf2 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | srebf2 / ;sec31anju221 7dpf liver rep1 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:srebf2 / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905874 | GSM7905874: srebf2 / ;sec31anju221 7dpf liver rep1; Danio rerio; RNA Seq | GSM7905874 r1 | GSM7905874 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | srebf2_sec31a_7dpf_liver_1_R1.fastq.gz srebf2_sec31a_7dpf_liver_1_R2.fastq.gz | fastq fastq | 5510352300.0 | 18367841.0 | GSM7905874 r1 | 0:150 1:150 | A:1627704384;C:1023445689;G:1301022904;T:1558092507;N:86816 | 150 | 150 | 1627704384 | 1023445689 | 1301022904 | 1558092507 | 86816 | SRX22556956 | SRS19565497 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.81137 | 0.82447 | 0.13931 | 0.13977 | 0.84104 | 0.84129 | 0.58031 | 0.57864 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28964 | 28964 | SRR26862023 | SRX22556955 | SRS19565496 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | srebf1 / ;sec31anju221 7dpf liver rep3 | GSM7905873 | source name:liver|tissue:liver|genotype:srebf1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | srebf1 / ;sec31anju221 7dpf liver rep3 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:srebf1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905873 | GSM7905873: srebf1 / ;sec31anju221 7dpf liver rep3; Danio rerio; RNA Seq | GSM7905873 r1 | GSM7905873 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | srebf1_sec31a_7dpf_liver_3_R1.fastq.gz srebf1_sec31a_7dpf_liver_3_R2.fastq.gz | fastq fastq | 6400097700.0 | 21333659.0 | GSM7905873 r1 | 0:150 1:150 | A:1899190871;C:1190525037;G:1467138729;T:1843142069;N:100994 | 150 | 150 | 1899190871 | 1190525037 | 1467138729 | 1843142069 | 100994 | SRX22556955 | SRS19565496 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.81425 | 0.82461 | 0.21108 | 0.21197 | 0.82221 | 0.82323 | 0.56957 | 0.594 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28965 | 28965 | SRR26862024 | SRX22556954 | SRS19565495 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | srebf1 / ;sec31anju221 7dpf liver rep2 | GSM7905872 | source name:liver|tissue:liver|genotype:srebf1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | srebf1 / ;sec31anju221 7dpf liver rep2 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:srebf1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905872 | GSM7905872: srebf1 / ;sec31anju221 7dpf liver rep2; Danio rerio; RNA Seq | GSM7905872 r1 | GSM7905872 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | srebf1_sec31a_7dpf_liver_2_R1.fastq.gz srebf1_sec31a_7dpf_liver_2_R2.fastq.gz | fastq fastq | 6400098000.0 | 21333660.0 | GSM7905872 r1 | 0:150 1:150 | A:1898994954;C:1190735681;G:1467311615;T:1842955236;N:100514 | 150 | 150 | 1898994954 | 1190735681 | 1467311615 | 1842955236 | 100514 | SRX22556954 | SRS19565495 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.81439 | 0.82458 | 0.20976 | 0.20983 | 0.82252 | 0.82278 | 0.57027 | 0.58785 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28966 | 28966 | SRR26862025 | SRX22556953 | SRS19565494 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | srebf1 / ;sec31anju221 7dpf liver rep1 | GSM7905871 | source name:liver|tissue:liver|genotype:srebf1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | srebf1 / ;sec31anju221 7dpf liver rep1 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:srebf1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905871 | GSM7905871: srebf1 / ;sec31anju221 7dpf liver rep1; Danio rerio; RNA Seq | GSM7905871 r1 | GSM7905871 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | srebf1_sec31a_7dpf_liver_1_R1.fastq.gz srebf1_sec31a_7dpf_liver_1_R2.fastq.gz | fastq fastq | 6400098000.0 | 21333660.0 | GSM7905871 r1 | 0:150 1:150 | A:1899112598;C:1190526850;G:1467278074;T:1843080128;N:100350 | 150 | 150 | 1899112598 | 1190526850 | 1467278074 | 1843080128 | 100350 | SRX22556953 | SRS19565494 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.81419 | 0.82464 | 0.20997 | 0.21061 | 0.82317 | 0.82296 | 0.57794 | 0.57323 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28967 | 28967 | SRR26862026 | SRX22556952 | SRS19565493 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | xbp1 / ;sec31anju221 7dpf liver rep3 | GSM7905870 | source name:liver|tissue:liver|genotype:xbp1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | xbp1 / ;sec31anju221 7dpf liver rep3 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:xbp1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905870 | GSM7905870: xbp1 / ;sec31anju221 7dpf liver rep3; Danio rerio; RNA Seq | GSM7905870 r1 | GSM7905870 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | xbp1_sec31a_7dpf_liver_3_R1.fastq.gz xbp1_sec31a_7dpf_liver_3_R2.fastq.gz | fastq fastq | 6187152600.0 | 20623842.0 | GSM7905870 r1 | 0:150 1:150 | A:1877363692;C:1115080777;G:1381299595;T:1812977195;N:431341 | 150 | 150 | 1877363692 | 1115080777 | 1381299595 | 1812977195 | 431341 | SRX22556952 | SRS19565493 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.76954 | 0.76951 | 0.43867 | 0.43143 | 0.77993 | 0.78291 | 0.54133 | 0.5381 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28968 | 28968 | SRR26862027 | SRX22556951 | SRS19565492 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | xbp1 / ;sec31anju221 7dpf liver rep2 | GSM7905869 | source name:liver|tissue:liver|genotype:xbp1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | xbp1 / ;sec31anju221 7dpf liver rep2 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:xbp1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905869 | GSM7905869: xbp1 / ;sec31anju221 7dpf liver rep2; Danio rerio; RNA Seq | GSM7905869 r1 | GSM7905869 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | xbp1_sec31a_7dpf_liver_2_R1.fastq.gz xbp1_sec31a_7dpf_liver_2_R2.fastq.gz | fastq fastq | 6187152600.0 | 20623842.0 | GSM7905869 r1 | 0:150 1:150 | A:1877413505;C:1115113811;G:1381185230;T:1813009192;N:430862 | 150 | 150 | 1877413505 | 1115113811 | 1381185230 | 1813009192 | 430862 | SRX22556951 | SRS19565492 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.77052 | 0.77186 | 0.4375 | 0.43158 | 0.77857 | 0.78376 | 0.54778 | 0.54495 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28969 | 28969 | SRR26862028 | SRX22556950 | SRS19565491 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | xbp1 / ;sec31anju221 7dpf liver rep1 | GSM7905868 | source name:liver|tissue:liver|genotype:xbp1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | xbp1 / ;sec31anju221 7dpf liver rep1 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:xbp1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905868 | GSM7905868: xbp1 / ;sec31anju221 7dpf liver rep1; Danio rerio; RNA Seq | GSM7905868 r1 | GSM7905868 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | xbp1_sec31a_7dpf_liver_1_R1.fastq.gz xbp1_sec31a_7dpf_liver_1_R2.fastq.gz | fastq fastq | 6187152900.0 | 20623843.0 | GSM7905868 r1 | 0:150 1:150 | A:1877304250;C:1115136591;G:1381366555;T:1812912124;N:433380 | 150 | 150 | 1877304250 | 1115136591 | 1381366555 | 1812912124 | 433380 | SRX22556950 | SRS19565491 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.77014 | 0.76961 | 0.43869 | 0.43265 | 0.77863 | 0.78293 | 0.54465 | 0.54127 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28970 | 28970 | SRR26862029 | SRX22556949 | SRS19565490 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | sec31anju221 7dpf liver rep3 | GSM7905867 | source name:liver|tissue:liver|genotype:sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | sec31anju221 7dpf liver rep3 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905867 | GSM7905867: sec31anju221 7dpf liver rep3; Danio rerio; RNA Seq | GSM7905867 r1 | GSM7905867 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | sec31a_7dpf_liver_3_R1.fastq.gz sec31a_7dpf_liver_3_R2.fastq.gz | fastq fastq | 7290483000.0 | 24301610.0 | GSM7905867 r1 | 0:150 1:150 | A:2201443580;C:1310250352;G:1667114316;T:2111120776;N:553976 | 150 | 150 | 2201443580 | 1310250352 | 1667114316 | 2111120776 | 553976 | SRX22556949 | SRS19565490 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.80458 | 0.80677 | 0.27528 | 0.27217 | 0.8228 | 0.82507 | 0.58018 | 0.57745 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28971 | 28971 | SRR26862030 | SRX22556948 | SRS19565489 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | sec31anju221 7dpf liver rep2 | GSM7905866 | source name:liver|tissue:liver|genotype:sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | sec31anju221 7dpf liver rep2 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905866 | GSM7905866: sec31anju221 7dpf liver rep2; Danio rerio; RNA Seq | GSM7905866 r1 | GSM7905866 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | sec31a_7dpf_liver_2_R1.fastq.gz sec31a_7dpf_liver_2_R2.fastq.gz | fastq fastq | 7290483300.0 | 24301611.0 | GSM7905866 r1 | 0:150 1:150 | A:2201546187;C:1310316929;G:1666786006;T:2111279666;N:554512 | 150 | 150 | 2201546187 | 1310316929 | 1666786006 | 2111279666 | 554512 | SRX22556948 | SRS19565489 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.80528 | 0.80845 | 0.27376 | 0.27196 | 0.82286 | 0.82451 | 0.58075 | 0.57876 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28972 | 28972 | SRR26862031 | SRX22556947 | SRS19565488 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | sec31anju221 7dpf liver rep1 | GSM7905865 | source name:liver|tissue:liver|genotype:sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | sec31anju221 7dpf liver rep1 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:sec31anju221|treatment:Digested with 2.5percent trypsin | GSM7905865 | GSM7905865: sec31anju221 7dpf liver rep1; Danio rerio; RNA Seq | GSM7905865 r1 | GSM7905865 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | sec31a_7dpf_liver_1_R2.fastq.gz sec31a_7dpf_liver_1_R1.fastq.gz | fastq fastq | 7290483300.0 | 24301611.0 | GSM7905865 r1 | 0:150 1:150 | A:2201492232;C:1310255361;G:1666931918;T:2111261791;N:541998 | 150 | 150 | 2201492232 | 1310255361 | 1666931918 | 2111261791 | 541998 | SRX22556947 | SRS19565488 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.80672 | 0.80946 | 0.27449 | 0.27121 | 0.82026 | 0.82238 | 0.58542 | 0.58114 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28973 | 28973 | SRR26862032 | SRX22556946 | SRS19565487 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | WT 7dpf liver rep3 | GSM7905864 | source name:liver|tissue:liver|genotype:wild type|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | WT 7dpf liver rep3 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:wild type|treatment:Digested with 2.5percent trypsin | GSM7905864 | GSM7905864: WT 7dpf liver rep3; Danio rerio; RNA Seq | GSM7905864 r1 | GSM7905864 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | ctrl_7dpf_liver_3_R1.fastq.gz ctrl_7dpf_liver_3_R2.fastq.gz | fastq fastq | 6492651600.0 | 21642172.0 | GSM7905864 r1 | 0:150 1:150 | A:1911454132;C:1210565181;G:1559325152;T:1810846037;N:461098 | 150 | 150 | 1911454132 | 1210565181 | 1559325152 | 1810846037 | 461098 | SRX22556946 | SRS19565487 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.83482 | 0.84576 | 0.18949 | 0.18912 | 0.84853 | 0.84914 | 0.67518 | 0.67721 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28974 | 28974 | SRR26862033 | SRX22556945 | SRS19565486 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | WT 7dpf liver rep2 | GSM7905863 | source name:liver|tissue:liver|genotype:wild type|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | WT 7dpf liver rep2 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:wild type|treatment:Digested with 2.5percent trypsin | GSM7905863 | GSM7905863: WT 7dpf liver rep2; Danio rerio; RNA Seq | GSM7905863 r1 | GSM7905863 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | ctrl_7dpf_liver_2_R1.fastq.gz ctrl_7dpf_liver_2_R2.fastq.gz | fastq fastq | 6492651600.0 | 21642172.0 | GSM7905863 r1 | 0:150 1:150 | A:1911298884;C:1210698281;G:1559339763;T:1810859879;N:454793 | 150 | 150 | 1911298884 | 1210698281 | 1559339763 | 1810859879 | 454793 | SRX22556945 | SRS19565486 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.83478 | 0.84217 | 0.19106 | 0.18909 | 0.84642 | 0.84717 | 0.67888 | 0.67654 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 28975 | 28975 | SRR26862034 | SRX22556944 | SRS19565485 | SRP472550 | PRJNA1041773 | Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing | GSE248098 | Transcriptome Analysis | We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform. | pubmed:39139065 | WT 7dpf liver rep1 | GSM7905862 | source name:liver|tissue:liver|genotype:wild type|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing | WT 7dpf liver rep1 | Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample | liver | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | tissue:liver|genotype:wild type|treatment:Digested with 2.5percent trypsin | GSM7905862 | GSM7905862: WT 7dpf liver rep1; Danio rerio; RNA Seq | GSM7905862 r1 | GSM7905862 | 1 | At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP472550 | ctrl_7dpf_liver_1_R1.fastq.gz ctrl_7dpf_liver_1_R2.fastq.gz | fastq fastq | 6492651600.0 | 21642172.0 | GSM7905862 r1 | 0:150 1:150 | A:1911338464;C:1210670533;G:1559401753;T:1810786876;N:453974 | 150 | 150 | 1911338464 | 1210670533 | 1559401753 | 1810786876 | 453974 | SRX22556944 | SRS19565485 | SRA1753371 | Xin Lou Lab, Medical School, Nanjing University | Xin Lou Lab, Medical School, Nanjing University | 2 | 0.83368 | 0.84388 | 0.18806 | 0.18877 | 0.84713 | 0.84932 | 0.67925 | 0.67975 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | China | 2023-11-17 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 29816 | 29816 | SRR27496346 | SRX23167489 | SRS20117077 | SRP483191 | PRJNA1063616 | Protection from starvation induced liver atrophy. | GSE252997 | Transcriptome Analysis | Starvation causes the accumulation of lipid droplets in the liver a somewhat counterintuitive phenomenon that is nevertheless conserved from flies to humans. Much like fatty liver resulting from overfeeding hepatic lipid accumulation steatosis during undernourishment can lead to lipotoxicity and atrophy of the liver. Here we found that while surface populations of Astyanax mexicanus undergo this evolutionarily conserved response to starvation the starvation resistant cavefish larvae of the same species do not display an accumulation of lipid droplets upon starvation. Moreover cavefish are resistant to liver atrophy during starvation providing a unique system to explore strategies for liver protection. Using comparative transcriptomics between zebrafish surface fish and cavefish we identified the fatty acid transporter slc27a2a/fatp2 to be correlated with the development of fatty liver. Pharmacological inhibition of slc27a2a in zebrafish rescues steatosis and atrophy of the liver upon starvation. Further down regulation of FATP2 in drosophila larvae inhibits the development of starvation induced steatosis suggesting the evolutionary conserved importance of the gene in regulating fatty liver upon nutrition deprivation. Overall our study identifies a conserved druggable target to protect the liver from atrophy during starvation. Overall design: Zebrafish larvae at 4 dpf were treated with Lipofermata 5 uM or vehicle DMSO for 48 hours. During treatment no exogenous food was added. At 6 dpf the livers were isolated for RNA Sequencing. Experiment was performed in duplicate. | pubmed:38467419 | Liver 6dpf DMSO rep1 | GSM8012203 | source name:Liver|tissue:Liver|genotype:AB|treatment:DMSO|geo loc name:missing|collection date:missing | Liver 6dpf DMSO rep1 | Raw reads were mapped using HiSAT2 against the GRCz11 zebrafish genome and counted using FeatureCounts. For normalization differential gene expression analysis and GO analysis iDEP version 0.951 was utilized with default parameters. For differential gene expression a fold change of 2 and false discovery rate of 0.1 was used for cut off. Assembly: GRCz11 Supplementary files format and content: comma separate file csv with raw counts for all samples. | Liver | Lipofermata or DMSO treatment for 48 hours | For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture’s instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode. | Zebrafish larvae at 6 dpf. | tissue:Liver|genotype:AB|treatment:DMSO | GSM8012203 | GSM8012203: Liver 6dpf DMSO rep1; Danio rerio; RNA Seq | GSM8012203 r1 | GSM8012203 | 1 | For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture's instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483191 | loader:fastq load.py | DMSO_1_R1.fastq.gz DMSO_1_R2.fastq.gz | fastq fastq | 3947938488.0 | 13072644.0 | GSM8012203 r1 | 0:151 1:151 | A:1068152483;C:899059502;G:921482728;T:1059209932;N:33843 | 151 | 151 | 1068152483 | 899059502 | 921482728 | 1059209932 | 33843 | SRX23167489 | SRS20117077 | SRA1784007 | Regeneration and Stress Biology, IRIBHM, ULB | Regeneration and Stress Biology, IRIBHM, ULB | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Belgium | 2024-01-11 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||
| 29817 | 29817 | SRR27496347 | SRX23167488 | SRS20117076 | SRP483191 | PRJNA1063616 | Protection from starvation induced liver atrophy. | GSE252997 | Transcriptome Analysis | Starvation causes the accumulation of lipid droplets in the liver a somewhat counterintuitive phenomenon that is nevertheless conserved from flies to humans. Much like fatty liver resulting from overfeeding hepatic lipid accumulation steatosis during undernourishment can lead to lipotoxicity and atrophy of the liver. Here we found that while surface populations of Astyanax mexicanus undergo this evolutionarily conserved response to starvation the starvation resistant cavefish larvae of the same species do not display an accumulation of lipid droplets upon starvation. Moreover cavefish are resistant to liver atrophy during starvation providing a unique system to explore strategies for liver protection. Using comparative transcriptomics between zebrafish surface fish and cavefish we identified the fatty acid transporter slc27a2a/fatp2 to be correlated with the development of fatty liver. Pharmacological inhibition of slc27a2a in zebrafish rescues steatosis and atrophy of the liver upon starvation. Further down regulation of FATP2 in drosophila larvae inhibits the development of starvation induced steatosis suggesting the evolutionary conserved importance of the gene in regulating fatty liver upon nutrition deprivation. Overall our study identifies a conserved druggable target to protect the liver from atrophy during starvation. Overall design: Zebrafish larvae at 4 dpf were treated with Lipofermata 5 uM or vehicle DMSO for 48 hours. During treatment no exogenous food was added. At 6 dpf the livers were isolated for RNA Sequencing. Experiment was performed in duplicate. | pubmed:38467419 | Liver 6dpf Lipofermata rep2 | GSM8012206 | source name:Liver|tissue:Liver|genotype:AB|treatment:Lipofermata|geo loc name:missing|collection date:missing | Liver 6dpf Lipofermata rep2 | Raw reads were mapped using HiSAT2 against the GRCz11 zebrafish genome and counted using FeatureCounts. For normalization differential gene expression analysis and GO analysis iDEP version 0.951 was utilized with default parameters. For differential gene expression a fold change of 2 and false discovery rate of 0.1 was used for cut off. Assembly: GRCz11 Supplementary files format and content: comma separate file csv with raw counts for all samples. | Liver | Lipofermata or DMSO treatment for 48 hours | For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture’s instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode. | Zebrafish larvae at 6 dpf. | tissue:Liver|genotype:AB|treatment:Lipofermata | GSM8012206 | GSM8012206: Liver 6dpf Lipofermata rep2; Danio rerio; RNA Seq | GSM8012206 r1 | GSM8012206 | 1 | For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture's instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483191 | loader:fastq load.py | Lipofermata_2_R1.fastq.gz Lipofermata_2_R2.fastq.gz | fastq fastq | 3365739868.0 | 11144834.0 | GSM8012206 r1 | 0:151 1:151 | A:904693218;C:775639535;G:792394997;T:892981123;N:30995 | 151 | 151 | 904693218 | 775639535 | 792394997 | 892981123 | 30995 | SRX23167488 | SRS20117076 | SRA1784007 | Regeneration and Stress Biology, IRIBHM, ULB | Regeneration and Stress Biology, IRIBHM, ULB | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Belgium | 2024-01-11 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||
| 29818 | 29818 | SRR27496348 | SRX23167487 | SRS20117075 | SRP483191 | PRJNA1063616 | Protection from starvation induced liver atrophy. | GSE252997 | Transcriptome Analysis | Starvation causes the accumulation of lipid droplets in the liver a somewhat counterintuitive phenomenon that is nevertheless conserved from flies to humans. Much like fatty liver resulting from overfeeding hepatic lipid accumulation steatosis during undernourishment can lead to lipotoxicity and atrophy of the liver. Here we found that while surface populations of Astyanax mexicanus undergo this evolutionarily conserved response to starvation the starvation resistant cavefish larvae of the same species do not display an accumulation of lipid droplets upon starvation. Moreover cavefish are resistant to liver atrophy during starvation providing a unique system to explore strategies for liver protection. Using comparative transcriptomics between zebrafish surface fish and cavefish we identified the fatty acid transporter slc27a2a/fatp2 to be correlated with the development of fatty liver. Pharmacological inhibition of slc27a2a in zebrafish rescues steatosis and atrophy of the liver upon starvation. Further down regulation of FATP2 in drosophila larvae inhibits the development of starvation induced steatosis suggesting the evolutionary conserved importance of the gene in regulating fatty liver upon nutrition deprivation. Overall our study identifies a conserved druggable target to protect the liver from atrophy during starvation. Overall design: Zebrafish larvae at 4 dpf were treated with Lipofermata 5 uM or vehicle DMSO for 48 hours. During treatment no exogenous food was added. At 6 dpf the livers were isolated for RNA Sequencing. Experiment was performed in duplicate. | pubmed:38467419 | Liver 6dpf Lipofermata rep1 | GSM8012205 | source name:Liver|tissue:Liver|genotype:AB|treatment:Lipofermata|geo loc name:missing|collection date:missing | Liver 6dpf Lipofermata rep1 | Raw reads were mapped using HiSAT2 against the GRCz11 zebrafish genome and counted using FeatureCounts. For normalization differential gene expression analysis and GO analysis iDEP version 0.951 was utilized with default parameters. For differential gene expression a fold change of 2 and false discovery rate of 0.1 was used for cut off. Assembly: GRCz11 Supplementary files format and content: comma separate file csv with raw counts for all samples. | Liver | Lipofermata or DMSO treatment for 48 hours | For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture’s instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode. | Zebrafish larvae at 6 dpf. | tissue:Liver|genotype:AB|treatment:Lipofermata | GSM8012205 | GSM8012205: Liver 6dpf Lipofermata rep1; Danio rerio; RNA Seq | GSM8012205 r1 | GSM8012205 | 1 | For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture's instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483191 | loader:fastq load.py | Lipofermata_1_R1.fastq.gz Lipofermata_1_R2.fastq.gz | fastq fastq | 3645146040.0 | 12070020.0 | GSM8012205 r1 | 0:151 1:151 | A:981366033;C:836975744;G:858564002;T:968208667;N:31594 | 151 | 151 | 981366033 | 836975744 | 858564002 | 968208667 | 31594 | SRX23167487 | SRS20117075 | SRA1784007 | Regeneration and Stress Biology, IRIBHM, ULB | Regeneration and Stress Biology, IRIBHM, ULB | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Belgium | 2024-01-11 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||
| 29819 | 29819 | SRR27496349 | SRX23167486 | SRS20117074 | SRP483191 | PRJNA1063616 | Protection from starvation induced liver atrophy. | GSE252997 | Transcriptome Analysis | Starvation causes the accumulation of lipid droplets in the liver a somewhat counterintuitive phenomenon that is nevertheless conserved from flies to humans. Much like fatty liver resulting from overfeeding hepatic lipid accumulation steatosis during undernourishment can lead to lipotoxicity and atrophy of the liver. Here we found that while surface populations of Astyanax mexicanus undergo this evolutionarily conserved response to starvation the starvation resistant cavefish larvae of the same species do not display an accumulation of lipid droplets upon starvation. Moreover cavefish are resistant to liver atrophy during starvation providing a unique system to explore strategies for liver protection. Using comparative transcriptomics between zebrafish surface fish and cavefish we identified the fatty acid transporter slc27a2a/fatp2 to be correlated with the development of fatty liver. Pharmacological inhibition of slc27a2a in zebrafish rescues steatosis and atrophy of the liver upon starvation. Further down regulation of FATP2 in drosophila larvae inhibits the development of starvation induced steatosis suggesting the evolutionary conserved importance of the gene in regulating fatty liver upon nutrition deprivation. Overall our study identifies a conserved druggable target to protect the liver from atrophy during starvation. Overall design: Zebrafish larvae at 4 dpf were treated with Lipofermata 5 uM or vehicle DMSO for 48 hours. During treatment no exogenous food was added. At 6 dpf the livers were isolated for RNA Sequencing. Experiment was performed in duplicate. | pubmed:38467419 | Liver 6dpf DMSO rep2 | GSM8012204 | source name:Liver|tissue:Liver|genotype:AB|treatment:DMSO|geo loc name:missing|collection date:missing | Liver 6dpf DMSO rep2 | Raw reads were mapped using HiSAT2 against the GRCz11 zebrafish genome and counted using FeatureCounts. For normalization differential gene expression analysis and GO analysis iDEP version 0.951 was utilized with default parameters. For differential gene expression a fold change of 2 and false discovery rate of 0.1 was used for cut off. Assembly: GRCz11 Supplementary files format and content: comma separate file csv with raw counts for all samples. | Liver | Lipofermata or DMSO treatment for 48 hours | For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture’s instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode. | Zebrafish larvae at 6 dpf. | tissue:Liver|genotype:AB|treatment:DMSO | GSM8012204 | GSM8012204: Liver 6dpf DMSO rep2; Danio rerio; RNA Seq | GSM8012204 r1 | GSM8012204 | 1 | For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture's instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483191 | loader:fastq load.py | DMSO_2_R1.fastq.gz DMSO_2_R2.fastq.gz | fastq fastq | 3062768334.0 | 10141617.0 | GSM8012204 r1 | 0:151 1:151 | A:815902447;C:711030547;G:726159250;T:809648102;N:27988 | 151 | 151 | 815902447 | 711030547 | 726159250 | 809648102 | 27988 | SRX23167486 | SRS20117074 | SRA1784007 | Regeneration and Stress Biology, IRIBHM, ULB | Regeneration and Stress Biology, IRIBHM, ULB | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Belgium | 2024-01-11 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||
| 30605 | 30605 | SRR27885298 | SRX23547062 | SRS20394839 | SRP488393 | PRJNA1073712 | Danio rerio Raw sequence reads | PRJNA1073712 | Whole Genome Sequencing | normal RNAseq of Danio rerio | Treat3 | breed:AB|dev stage:7 dpf|collection date:2022 01 06|geo loc name:China: Wuhan|sex:not determined|tissue:liver|replicate:replicate=treat biolobical replicate 3|BioSampleModel:Model organism or animal | RNA seq of Danio rerio | t3 | t3 | normal RNA seq of Danio rerio | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP488393 | treat3_1.fq.gz treat3_2.fq.gz | fastq fastq | 11227897200.0 | 37426324.0 | treat3 1.fq.gz | 0:150 1:150 | A:2841991870;C:2760705502;G:2843113319;T:2781984816;N:101693 | 150 | 150 | 2841991870 | 2760705502 | 2843113319 | 2781984816 | 101693 | SRX23547062 | SRS20394839 | SRA1798310 | Wuhan University|School of Basic Medical Sciences | Wuhan University | 2 | 0.9395 | 0.93765 | 0.03042 | 0.02991 | 0.75943 | 0.76282 | 0.52931 | 0.52802 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | China | 2024-02-06 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||
| 30606 | 30606 | SRR27885299 | SRX23547061 | SRS20394838 | SRP488393 | PRJNA1073712 | Danio rerio Raw sequence reads | PRJNA1073712 | Whole Genome Sequencing | normal RNAseq of Danio rerio | Control3 | breed:AB|dev stage:7 dpf|collection date:2022 01 06|geo loc name:China: Wuhan|sex:not determined|tissue:liver|replicate:replicate=control biolobical replicate 3|BioSampleModel:Model organism or animal | RNA seq of Danio rerio | c3 | c3 | normal RNA seq of Danio rerio | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP488393 | control3_1.fq.gz control3_2.fq.gz | fastq fastq | 13204860600.0 | 44016202.0 | control3 1.fq.gz | 0:150 1:150 | A:3362002161;C:3237033953;G:3340888463;T:3264815850;N:120173 | 150 | 150 | 3362002161 | 3237033953 | 3340888463 | 3264815850 | 120173 | SRX23547061 | SRS20394838 | SRA1798310 | Wuhan University|School of Basic Medical Sciences | Wuhan University | 2 | 0.94114 | 0.94099 | 0.03313 | 0.0336 | 0.7611 | 0.76562 | 0.52598 | 0.54255 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | China | 2024-02-06 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||
| 30607 | 30607 | SRR27885300 | SRX23547060 | SRS20394837 | SRP488393 | PRJNA1073712 | Danio rerio Raw sequence reads | PRJNA1073712 | Whole Genome Sequencing | normal RNAseq of Danio rerio | Treat2 | breed:AB|dev stage:7 dpf|collection date:2022 01 02|geo loc name:China: Wuhan|sex:not determined|tissue:liver|replicate:replicate=treat biolobical replicate 2|BioSampleModel:Model organism or animal | RNA seq of Danio rerio | t2 | t2 | normal RNA seq of Danio rerio | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP488393 | treat2_1.fq.gz treat2_2.fq.gz | fastq fastq | 13686972300.0 | 45623241.0 | treat2 1.fq.gz | 0:150 1:150 | A:3497540140;C:3330959709;G:3473656510;T:3384780397;N:35544 | 150 | 150 | 3497540140 | 3330959709 | 3473656510 | 3384780397 | 35544 | SRX23547060 | SRS20394837 | SRA1798310 | Wuhan University|School of Basic Medical Sciences | Wuhan University | 2 | 0.94978 | 0.9476 | 0.02247 | 0.02209 | 0.77508 | 0.78104 | 0.5376 | 0.54975 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | China | 2024-02-06 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||
| 30608 | 30608 | SRR27885301 | SRX23547059 | SRS20394836 | SRP488393 | PRJNA1073712 | Danio rerio Raw sequence reads | PRJNA1073712 | Whole Genome Sequencing | normal RNAseq of Danio rerio | Control2 | breed:AB|dev stage:7 dpf|collection date:2022 01 02|geo loc name:China: Wuhan|sex:not determined|tissue:liver|replicate:replicate=control biolobical replicate 2|BioSampleModel:Model organism or animal | RNA seq of Danio rerio | c2 | c2 | normal RNA seq of Danio rerio | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP488393 | control2_1.fq.gz control2_2.fq.gz | fastq fastq | 13075274400.0 | 43584248.0 | control2 1.fq.gz | 0:150 1:150 | A:3297304643;C:3196925316;G:3364735785;T:3216273784;N:34872 | 150 | 150 | 3297304643 | 3196925316 | 3364735785 | 3216273784 | 34872 | SRX23547059 | SRS20394836 | SRA1798310 | Wuhan University|School of Basic Medical Sciences | Wuhan University | 2 | 0.94539 | 0.94301 | 0.02162 | 0.02151 | 0.78358 | 0.78886 | 0.53728 | 0.52362 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | China | 2024-02-06 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||
| 30609 | 30609 | SRR27885302 | SRX23547058 | SRS20394835 | SRP488393 | PRJNA1073712 | Danio rerio Raw sequence reads | PRJNA1073712 | Whole Genome Sequencing | normal RNAseq of Danio rerio | Treat1 | breed:AB|dev stage:7 dpf|collection date:2021 12 22|geo loc name:China: Wuhan|sex:not determined|tissue:liver|replicate:replicate=treat biolobical replicate 1|BioSampleModel:Model organism or animal | RNA seq of Danio rerio | t1 | t1 | normal RNA seq of Danio rerio | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP488393 | treat1_1.fq.gz treat1_2.fq.gz | fastq fastq | 14810228700.0 | 49367429.0 | treat1 1.fq.gz | 0:150 1:150 | A:3737682638;C:3643663419;G:3815975423;T:3612867530;N:39690 | 150 | 150 | 3737682638 | 3643663419 | 3815975423 | 3612867530 | 39690 | SRX23547058 | SRS20394835 | SRA1798310 | Wuhan University|School of Basic Medical Sciences | Wuhan University | 2 | 0.94911 | 0.94637 | 0.0196 | 0.0194 | 0.76928 | 0.77406 | 0.52665 | 0.53607 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | China | 2024-02-06 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||
| 30610 | 30610 | SRR27885303 | SRX23547057 | SRS20394834 | SRP488393 | PRJNA1073712 | Danio rerio Raw sequence reads | PRJNA1073712 | Whole Genome Sequencing | normal RNAseq of Danio rerio | Control1 | breed:AB|dev stage:7 dpf|collection date:2021 12 22|geo loc name:China: Wuhan|sex:not determined|tissue:liver|replicate:replicate=control biolobical replicate 1|BioSampleModel:Model organism or animal | RNA seq of Danio rerio | c1 | c1 | normal RNA seq of Danio rerio | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP488393 | control1_1.fq.gz control1_2.fq.gz | fastq fastq | 13024707900.0 | 43415693.0 | control1 1.fq.gz | 0:150 1:150 | A:3266649802;C:3212798200;G:3383472165;T:3161753039;N:34694 | 150 | 150 | 3266649802 | 3212798200 | 3383472165 | 3161753039 | 34694 | SRX23547057 | SRS20394834 | SRA1798310 | Wuhan University|School of Basic Medical Sciences | Wuhan University | 2 | 0.93586 | 0.9333 | 0.02078 | 0.02096 | 0.77197 | 0.77729 | 0.53822 | 0.52512 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | China | 2024-02-06 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||
| 35821 | 35821 | SRR33048251 | SRX28313562 | SRS24652529 | SRP577496 | PRJNA1248508 | Transcriptome sequencing of hepatocytes with or without xxx during liver development in zebrafish | PRJNA1248508 | Other | The hepatocytes and non hepatocytes within the livers of 3dpf 7 dpf and adult transgenic Tgfabp10:GFP zebrafish were utilized for experimentation. Upon cessation of opercular movements animals were euthanized via immersion in ice cold water for ten minutes. In this transgenic line hepatocytes in the liver express GFP. Subsequently liver tissues were subjected to enzymatic digestion using 1 mg Collagenase IV dissolved in 1 ml L 15 medium incubated at room temperature for 20 minutes. Liver tissues were then transferred to Leibovitz L 15 medium with an osmolarity of 300 mOsm and pH adjusted to 7.35. Hepatocytes and non hepatocytes were isolated through gentle trituration. The chamber was mounted onto the stage of an Olympus inverted microscope equipped with fluorescence capabilities perfused with fresh L 15 medium for 5 minutes to rinse off debris. Calibrate flow cytometer Moflo XDP Beckman ensuring that the instrument settings such as voltage thresholds and compensation matrices are properly configured for GFP detection. Use beads calibrated for green fluorescent protein to adjust the photomultiplier tube voltages and other parameters. Prepare sterile sorting tubes filled with a suitable buffer to collect sorted cells. Pre chill if necessary. Use an argon laser typically at 488 nm for GFP excitation. Set appropriate filters to detect GFP emission usually centred around 530 nm. Discriminate intact cells from cell fragments based on size and internal complexity. Balance purity and yield by adjusting sort speed and stringency of gating parameters. Follow strict cleaning protocols post sorting to avoid contamination. Isolated cells were collected utilizing flow cytometry enabling precise sorting of GFP positive hepatocytes from GFP negative non hepatocytes. Approximately 400 hepatocytes and non hepatocytes were harvested from around 12 zebrafish with 3 replicates per sample. The careful isolation procedures and subsequent sorting by flow cytometry facilitated acquisition of pure populations of hepatocytes … | D7 GFP | The hepatocytes within the liver of 7 dpf transgenic Tgfabp10:GFP zebrafish | strain:not applicable|isolate:not applicable|breed:hepatocytes|cultivar:transgenic Tgfabp10:GFP zebrafish|ecotype:not applicable|age:not collected|dev stage:7 dpf date:2019 06 19|geo loc name:China: Sichuan|sex:not determined|tissue:liver|BioSampleModel:Model organism or animal | D7 GFP | ED19155408 | ED19155408 | library preparations were sequenced on an Illumina Novaseq platform and 150bp paired end reads were generated | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP577496 | D7_GFP_R1.fq.gz D7_GFP_R2.fq.gz | fastq fastq | 7981076700.0 | 26603589.0 | D7 GFP R1.fq.gz | 0:150 1:150 | A:2179536437;C:1804626545;G:1832481252;T:2164370673;N:61793 | 150 | 150 | 2179536437 | 1804626545 | 1832481252 | 2164370673 | 61793 | SRX28313562 | SRS24652529 | SRA2109063 | Chengdu Medical College|School of Basic Medicine | Chengdu Medical College | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | China | 2025-04-09 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||||||||||||
| 35822 | 35822 | SRR33048252 | SRX28313561 | SRS24652526 | SRP577496 | PRJNA1248508 | Transcriptome sequencing of hepatocytes with or without xxx during liver development in zebrafish | PRJNA1248508 | Other | The hepatocytes and non hepatocytes within the livers of 3dpf 7 dpf and adult transgenic Tgfabp10:GFP zebrafish were utilized for experimentation. Upon cessation of opercular movements animals were euthanized via immersion in ice cold water for ten minutes. In this transgenic line hepatocytes in the liver express GFP. Subsequently liver tissues were subjected to enzymatic digestion using 1 mg Collagenase IV dissolved in 1 ml L 15 medium incubated at room temperature for 20 minutes. Liver tissues were then transferred to Leibovitz L 15 medium with an osmolarity of 300 mOsm and pH adjusted to 7.35. Hepatocytes and non hepatocytes were isolated through gentle trituration. The chamber was mounted onto the stage of an Olympus inverted microscope equipped with fluorescence capabilities perfused with fresh L 15 medium for 5 minutes to rinse off debris. Calibrate flow cytometer Moflo XDP Beckman ensuring that the instrument settings such as voltage thresholds and compensation matrices are properly configured for GFP detection. Use beads calibrated for green fluorescent protein to adjust the photomultiplier tube voltages and other parameters. Prepare sterile sorting tubes filled with a suitable buffer to collect sorted cells. Pre chill if necessary. Use an argon laser typically at 488 nm for GFP excitation. Set appropriate filters to detect GFP emission usually centred around 530 nm. Discriminate intact cells from cell fragments based on size and internal complexity. Balance purity and yield by adjusting sort speed and stringency of gating parameters. Follow strict cleaning protocols post sorting to avoid contamination. Isolated cells were collected utilizing flow cytometry enabling precise sorting of GFP positive hepatocytes from GFP negative non hepatocytes. Approximately 400 hepatocytes and non hepatocytes were harvested from around 12 zebrafish with 3 replicates per sample. The careful isolation procedures and subsequent sorting by flow cytometry facilitated acquisition of pure populations of hepatocytes … | D3 GFP | The hepatocytes within the liver of 3dpf transgenic Tgfabp10:GFP zebrafish | strain:not applicable|isolate:not applicable|breed:hepatocytes|cultivar:transgenic Tgfabp10:GFP zebrafish|ecotype:not applicable|age:not collected|dev stage:3 dpf date:2019 06 19|geo loc name:China: Sichuan|sex:not determined|tissue:liver|BioSampleModel:Model organism or animal | D3 GFP | ED19155403 | ED19155403 | library preparations were sequenced on an Illumina Novaseq platform and 150bp paired end reads were generated | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP577496 | D3_GFP_R1.fq.gz D3_GFP_R2.fq.gz | fastq fastq | 5675477100.0 | 18918257.0 | D3 GFP R1.fq.gz | 0:150 1:150 | A:1686172751;C:1174770916;G:1187685676;T:1626795743;N:52014 | 150 | 150 | 1686172751 | 1174770916 | 1187685676 | 1626795743 | 52014 | SRX28313561 | SRS24652526 | SRA2109063 | Chengdu Medical College|School of Basic Medicine | Chengdu Medical College | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | China | 2025-04-09 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||||||||||||
| 35823 | 35823 | SRR33048253 | SRX28313560 | SRS24652527 | SRP577496 | PRJNA1248508 | Transcriptome sequencing of hepatocytes with or without xxx during liver development in zebrafish | PRJNA1248508 | Other | The hepatocytes and non hepatocytes within the livers of 3dpf 7 dpf and adult transgenic Tgfabp10:GFP zebrafish were utilized for experimentation. Upon cessation of opercular movements animals were euthanized via immersion in ice cold water for ten minutes. In this transgenic line hepatocytes in the liver express GFP. Subsequently liver tissues were subjected to enzymatic digestion using 1 mg Collagenase IV dissolved in 1 ml L 15 medium incubated at room temperature for 20 minutes. Liver tissues were then transferred to Leibovitz L 15 medium with an osmolarity of 300 mOsm and pH adjusted to 7.35. Hepatocytes and non hepatocytes were isolated through gentle trituration. The chamber was mounted onto the stage of an Olympus inverted microscope equipped with fluorescence capabilities perfused with fresh L 15 medium for 5 minutes to rinse off debris. Calibrate flow cytometer Moflo XDP Beckman ensuring that the instrument settings such as voltage thresholds and compensation matrices are properly configured for GFP detection. Use beads calibrated for green fluorescent protein to adjust the photomultiplier tube voltages and other parameters. Prepare sterile sorting tubes filled with a suitable buffer to collect sorted cells. Pre chill if necessary. Use an argon laser typically at 488 nm for GFP excitation. Set appropriate filters to detect GFP emission usually centred around 530 nm. Discriminate intact cells from cell fragments based on size and internal complexity. Balance purity and yield by adjusting sort speed and stringency of gating parameters. Follow strict cleaning protocols post sorting to avoid contamination. Isolated cells were collected utilizing flow cytometry enabling precise sorting of GFP positive hepatocytes from GFP negative non hepatocytes. Approximately 400 hepatocytes and non hepatocytes were harvested from around 12 zebrafish with 3 replicates per sample. The careful isolation procedures and subsequent sorting by flow cytometry facilitated acquisition of pure populations of hepatocytes … | D3 Cont | The non hepatocytes within the liver of 3dp transgenic Tgfabp10:GFP zebrafish | strain:not applicable|isolate:not applicable|breed:non hepatocytes|cultivar:transgenic Tgfabp10:GFP zebrafish|ecotype:not applicable|age:not collected|dev stage:3 dpf date:2019 06 19|geo loc name:China: Sichuan|sex:not determined|tissue:liver|BioSampleModel:Model organism or animal | D3 Cont | ED19155405 | ED19155405 | library preparations were sequenced on an Illumina Novaseq platform and 150bp paired end reads were generated | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP577496 | D3_Cont_R1.fq.gz D3_Cont_R2.fq.gz | fastq fastq | 6351962700.0 | 21173209.0 | D3 Cont R1.fq.gz | 0:150 1:150 | A:1820293872;C:1368447220;G:1385705833;T:1777459731;N:56044 | 150 | 150 | 1820293872 | 1368447220 | 1385705833 | 1777459731 | 56044 | SRX28313560 | SRS24652527 | SRA2109063 | Chengdu Medical College|School of Basic Medicine | Chengdu Medical College | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | China | 2025-04-09 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||||||||||||
| 35953 | 35953 | SRR33299171 | SRX28544214 | SRS24843394 | SRP580984 | PRJNA1255065 | A Novel Transgenic Reporter to Study Vertebrate Epigenetics | PRJNA1255065 | Other | Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates. | WT pos 3 | strain:ppat|isolate:RNA wt pos 3|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal | RNAseq of EpiTag Danio Rerio | RNA wt pos 3 | RNA wt pos 3 | Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP580984 | WT-pos-3_S10_R1_001.fastq.gz WT-pos-3_S10_R2_001.fastq.gz | fastq fastq | 15038194818.0 | 74446509.0 | WT pos 3 S10 R1 001.fastq.gz | 0:101 1:101 | A:4616878123;C:2865206674;G:2927449871;T:4628427327;N:232823 | 101 | 101 | 4616878123 | 2865206674 | 2927449871 | 4628427327 | 232823 | SRX28544214 | SRS24843394 | SRA2117853 | NIH|NICHD | NIH | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United States | 2025-04-24 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||||||||||||||
| 35954 | 35954 | SRR33299172 | SRX28544213 | SRS24843393 | SRP580984 | PRJNA1255065 | A Novel Transgenic Reporter to Study Vertebrate Epigenetics | PRJNA1255065 | Other | Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates. | WT pos 2 | strain:ppat|isolate:RNA wt pos 2|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal | RNAseq of EpiTag Danio Rerio | RNA wt pos 2 | RNA wt pos 2 | Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP580984 | WT-pos-2_S6_R1_001.fastq.gz WT-pos-2_S6_R2_001.fastq.gz | fastq fastq | 12522438742.0 | 61992271.0 | WT pos 2 S6 R1 001.fastq.gz | 0:101 1:101 | A:3774656054;C:2451528285;G:2501043573;T:3795016419;N:194411 | 101 | 101 | 3774656054 | 2451528285 | 2501043573 | 3795016419 | 194411 | SRX28544213 | SRS24843393 | SRA2117853 | NIH|NICHD | NIH | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United States | 2025-04-24 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||||||||||||||
| 35955 | 35955 | SRR33299173 | SRX28544212 | SRS24843392 | SRP580984 | PRJNA1255065 | A Novel Transgenic Reporter to Study Vertebrate Epigenetics | PRJNA1255065 | Other | Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates. | WT pos 1 | strain:ppat|isolate:RNA wt pos 1|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal | RNAseq of EpiTag Danio Rerio | RNA wt pos 1 | RNA wt pos 1 | Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP580984 | WT-pos-1_S2_R1_001.fastq.gz WT-pos-1_S2_R2_001.fastq.gz | fastq fastq | 13192760794.0 | 65310697.0 | WT pos 1 S2 R1 001.fastq.gz | 0:101 1:101 | A:4175600031;C:2392141464;G:2448567492;T:4176248719;N:203088 | 101 | 101 | 4175600031 | 2392141464 | 2448567492 | 4176248719 | 203088 | SRX28544212 | SRS24843392 | SRA2117853 | NIH|NICHD | NIH | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United States | 2025-04-24 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||||||||||||||
| 35956 | 35956 | SRR33299174 | SRX28544211 | SRS24843391 | SRP580984 | PRJNA1255065 | A Novel Transgenic Reporter to Study Vertebrate Epigenetics | PRJNA1255065 | Other | Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates. | WT neg 3 | strain:ppat|isolate:RNA wt neg 3|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal | RNAseq of EpiTag Danio Rerio | RNA wt neg 3 | RNA wt neg 3 | Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP580984 | WT-neg-3_S9_R1_001.fastq.gz WT-neg-3_S9_R2_001.fastq.gz | fastq fastq | 14228466708.0 | 70437954.0 | WT neg 3 S9 R1 001.fastq.gz | 0:101 1:101 | A:4251988096;C:2825656049;G:2882063617;T:4268538044;N:220902 | 101 | 101 | 4251988096 | 2825656049 | 2882063617 | 4268538044 | 220902 | SRX28544211 | SRS24843391 | SRA2117853 | NIH|NICHD | NIH | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United States | 2025-04-24 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||||||||||||||
| 35957 | 35957 | SRR33299176 | SRX28544209 | SRS24843389 | SRP580984 | PRJNA1255065 | A Novel Transgenic Reporter to Study Vertebrate Epigenetics | PRJNA1255065 | Other | Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates. | WT neg 2 | strain:ppat|isolate:RNA wt neg 2|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal | RNAseq of EpiTag Danio Rerio | RNA wt neg 2 | RNA wt neg 2 | Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP580984 | WT-neg-2_S5_R1_001.fastq.gz WT-neg-2_S5_R2_001.fastq.gz | fastq fastq | 29197644388.0 | 144542794.0 | WT neg 2 S5 R1 001.fastq.gz | 0:101 1:101 | A:8825536643;C:5697075068;G:5851684325;T:8822896313;N:452039 | 101 | 101 | 8825536643 | 5697075068 | 5851684325 | 8822896313 | 452039 | SRX28544209 | SRS24843389 | SRA2117853 | NIH|NICHD | NIH | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United States | 2025-04-24 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||||||||||||||
| 35958 | 35958 | SRR33299177 | SRX28544208 | SRS24843388 | SRP580984 | PRJNA1255065 | A Novel Transgenic Reporter to Study Vertebrate Epigenetics | PRJNA1255065 | Other | Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates. | WT neg 1 | strain:ppat|isolate:RNA wt neg 1|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal | RNAseq of EpiTag Danio Rerio | RNA wt neg 1 | RNA wt neg 1 | Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP580984 | WT-neg-1_S1_R1_001.fastq.gz WT-neg-1_S1_R2_001.fastq.gz | fastq fastq | 24310317816.0 | 120348108.0 | WT neg 1 S1 R1 001.fastq.gz | 0:101 1:101 | A:7529245228;C:4579294064;G:4681930604;T:7519470895;N:377025 | 101 | 101 | 7529245228 | 4579294064 | 4681930604 | 7519470895 | 377025 | SRX28544208 | SRS24843388 | SRA2117853 | NIH|NICHD | NIH | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United States | 2025-04-24 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||||||||||||||
| 35959 | 35959 | SRR33299178 | SRX28544207 | SRS24843387 | SRP580984 | PRJNA1255065 | A Novel Transgenic Reporter to Study Vertebrate Epigenetics | PRJNA1255065 | Other | Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates. | Mut pos 3 | strain:ppat|isolate:RNA mut pos 3|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal | RNAseq of EpiTag Danio Rerio | RNA mut pos 3 | RNA mut pos 3 | Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP580984 | Mutant-pos-3_S12_R1_001.fastq.gz Mutant-pos-3_S12_R2_001.fastq.gz | fastq fastq | 12331802050.0 | 61048525.0 | Mutant pos 3 S12 R1 001.fastq.gz | 0:101 1:101 | A:3738975619;C:2387112788;G:2450941491;T:3754579907;N:192245 | 101 | 101 | 3738975619 | 2387112788 | 2450941491 | 3754579907 | 192245 | SRX28544207 | SRS24843387 | SRA2117853 | NIH|NICHD | NIH | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United States | 2025-04-24 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||||||||||||||
| 35960 | 35960 | SRR33299179 | SRX28544206 | SRS24843386 | SRP580984 | PRJNA1255065 | A Novel Transgenic Reporter to Study Vertebrate Epigenetics | PRJNA1255065 | Other | Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates. | Mut pos 2 | strain:ppat|isolate:RNA mut pos 2|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal | RNAseq of EpiTag Danio Rerio | RNA mut pos 2 | RNA mut pos 2 | Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP580984 | Mutant-pos-2_S8_R1_001.fastq.gz Mutant-pos-2_S8_R2_001.fastq.gz | fastq fastq | 14310451034.0 | 70843817.0 | Mutant pos 2 S8 R1 001.fastq.gz | 0:101 1:101 | A:4323214668;C:2795555578;G:2854780783;T:4336680703;N:219302 | 101 | 101 | 4323214668 | 2795555578 | 2854780783 | 4336680703 | 219302 | SRX28544206 | SRS24843386 | SRA2117853 | NIH|NICHD | NIH | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United States | 2025-04-24 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||||||||||||||
| 35961 | 35961 | SRR33299180 | SRX28544205 | SRS24843385 | SRP580984 | PRJNA1255065 | A Novel Transgenic Reporter to Study Vertebrate Epigenetics | PRJNA1255065 | Other | Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates. | Mut pos 1 | strain:ppat|isolate:RNA mut pos 1|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal | RNAseq of EpiTag Danio Rerio | RNA mut pos 1 | RNA mut pos 1 | Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP580984 | Mutant-pos-1_S4_R1_001.fastq.gz Mutant-pos-1_S4_R2_001.fastq.gz | fastq fastq | 11742623802.0 | 58131801.0 | Mutant pos 1 S4 R1 001.fastq.gz | 0:101 1:101 | A:3631609351;C:2213363935;G:2258388450;T:3639080712;N:181354 | 101 | 101 | 3631609351 | 2213363935 | 2258388450 | 3639080712 | 181354 | SRX28544205 | SRS24843385 | SRA2117853 | NIH|NICHD | NIH | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United States | 2025-04-24 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||||||||||||||
| 35962 | 35962 | SRR33299181 | SRX28544204 | SRS24843384 | SRP580984 | PRJNA1255065 | A Novel Transgenic Reporter to Study Vertebrate Epigenetics | PRJNA1255065 | Other | Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates. | Mut neg 3 | strain:ppat|isolate:RNA mut neg 3|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal | RNAseq of EpiTag Danio Rerio | RNA mut neg 3 | RNA mut neg 3 | Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP580984 | Mutant-neg-3_S11_R1_001.fastq.gz Mutant-neg-3_S11_R2_001.fastq.gz | fastq fastq | 24089537270.0 | 119255135.0 | Mutant neg 3 S11 R1 001.fastq.gz | 0:101 1:101 | A:7187277815;C:4790199860;G:4897671441;T:7214028116;N:360038 | 101 | 101 | 7187277815 | 4790199860 | 4897671441 | 7214028116 | 360038 | SRX28544204 | SRS24843384 | SRA2117853 | NIH|NICHD | NIH | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United States | 2025-04-24 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||||||||||||||
| 35963 | 35963 | SRR33299182 | SRX28544203 | SRS24843383 | SRP580984 | PRJNA1255065 | A Novel Transgenic Reporter to Study Vertebrate Epigenetics | PRJNA1255065 | Other | Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates. | Mut neg 2 | strain:ppat|isolate:RNA mut neg 2|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal | RNAseq of EpiTag Danio Rerio | RNA mut neg 2 | RNA mut neg 2 | Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP580984 | Mutant-neg-2_S7_R1_001.fastq.gz Mutant-neg-2_S7_R2_001.fastq.gz | fastq fastq | 27776865470.0 | 137509235.0 | Mutant neg 2 S7 R1 001.fastq.gz | 0:101 1:101 | A:8522694394;C:5302545250;G:5464259742;T:8486935677;N:430407 | 101 | 101 | 8522694394 | 5302545250 | 5464259742 | 8486935677 | 430407 | SRX28544203 | SRS24843383 | SRA2117853 | NIH|NICHD | NIH | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United States | 2025-04-24 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||||||||||||||
| 35964 | 35964 | SRR33299183 | SRX28544202 | SRS24843382 | SRP580984 | PRJNA1255065 | A Novel Transgenic Reporter to Study Vertebrate Epigenetics | PRJNA1255065 | Other | Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates. | Mut neg 1 | strain:ppat|isolate:RNA mut neg 1|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal | RNAseq of EpiTag Danio Rerio | RNA mut neg 1 | RNA mut neg 1 | Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000 | RNA-Seq | TRANSCRIPTOMIC | PolyA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP580984 | Mutant-neg-1_S3_R1_001.fastq.gz Mutant-neg-1_S3_R2_001.fastq.gz | fastq fastq | 12942402802.0 | 64071301.0 | Mutant neg 1 S3 R1 001.fastq.gz | 0:101 1:101 | A:3952970077;C:2483104981;G:2560604982;T:3945521897;N:200865 | 101 | 101 | 3952970077 | 2483104981 | 2560604982 | 3945521897 | 200865 | SRX28544202 | SRS24843382 | SRA2117853 | NIH|NICHD | NIH | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | United States | 2025-04-24 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||||||||||||||||
| 36506 | 36506 | SRR566696 | SRX185761 | SRS361914 | SRP015680 | PRJNA174800 | Transcriptomic analyses of Myc induced zebrafish liver cancer | GSE40745 | Transcriptome Analysis | To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system. | pubmed:23038063 | source: liver tumor M+D+ | GSM1000561: M+D+ 2 | GSM1000561 | genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:doxycycline | M+D+ 2 | The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. | liver tumor M+D+ | Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. | Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol. | genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:doxycycline | GSM1000561 | GSM1000561: M+D+ 2; Danio rerio; RNA Seq | GSM1000561 1 | 1 | GEO Accession:GSM1000561 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD 3 Plus System | SRP015680 | M+D+_2_QV.qual M+D+_2.csfasta | SOLiD_native SOLiD_native | 1493416960.0 | 42669056.0 | GSM1000561 r1 | 0:35 | 0:377247910;1:348861020;2:522134600;3:237405266;.:7768164 | 35 | SRX185761 | SRS361914 | SRA058618 | GEO | National University of Singapore | 1 | 0.06244 | 0.00306 | 0.99567 | 0.34618 | 35 | B | usable mapping rate | legacy | early | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Singapore | 2012-09-10 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||||
| 36507 | 36507 | SRR566695 | SRX185760 | SRS361913 | SRP015680 | PRJNA174800 | Transcriptomic analyses of Myc induced zebrafish liver cancer | GSE40745 | Transcriptome Analysis | To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system. | pubmed:23038063 | source: liver tumor M+D+ | GSM1000560: M+D+ 1 | GSM1000560 | genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:doxycycline | M+D+ 1 | The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. | liver tumor M+D+ | Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. | Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol. | genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:doxycycline | GSM1000560 | GSM1000560: M+D+ 1; Danio rerio; RNA Seq | GSM1000560 1 | 1 | GEO Accession:GSM1000560 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD 3 Plus System | SRP015680 | 1291539515.0 | 36901129.0 | GSM1000560 r1 | 0:35 | 0:266006021;1:328523841;2:440474617;3:254266912;.:2268124 | 35 | SRX185760 | SRS361913 | SRA058618 | GEO | National University of Singapore | 1 | 0.10629 | 0.0044 | 0.99239 | 0.31953 | 35 | B | usable mapping rate | legacy | early | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Singapore | 2012-09-10 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||||||
| 36508 | 36508 | SRR566694 | SRX185759 | SRS361912 | SRP015680 | PRJNA174800 | Transcriptomic analyses of Myc induced zebrafish liver cancer | GSE40745 | Transcriptome Analysis | To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system. | pubmed:23038063 | source: control liver M D+ | GSM1000559: M D+ 2 | GSM1000559 | genotype:wildtype|tissue:liver|treatment:doxycycline | M D+ 2 | The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. | control liver M D+ | Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. | Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol. | genotype:wildtype|tissue:liver|treatment:doxycycline | GSM1000559 | GSM1000559: M D+ 2; Danio rerio; RNA Seq | GSM1000559 1 | 1 | GEO Accession:GSM1000559 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD 3 Plus System | SRP015680 | M-D+_2_QV.qual | SOLiD_native | 1438423910.0 | 41097826.0 | GSM1000559 r1 | 0:35 | 0:353104627;1:349496969;2:433338629;3:275089557;.:27394128 | 35 | SRX185759 | SRS361912 | SRA058618 | GEO | National University of Singapore | 1 | 0.04748 | 0.00442 | 0.99425 | 0.53794 | 35 | B | usable mapping rate | legacy | early | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Singapore | 2012-09-10 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||||
| 36509 | 36509 | SRR566693 | SRX185758 | SRS361911 | SRP015680 | PRJNA174800 | Transcriptomic analyses of Myc induced zebrafish liver cancer | GSE40745 | Transcriptome Analysis | To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system. | pubmed:23038063 | source: control liver M D+ | GSM1000558: M D+ 1 | GSM1000558 | genotype:wildtype|tissue:liver|treatment:doxycycline | M D+ 1 | The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. | control liver M D+ | Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. | Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol. | genotype:wildtype|tissue:liver|treatment:doxycycline | GSM1000558 | GSM1000558: M D+ 1; Danio rerio; RNA Seq | GSM1000558 1 | 1 | GEO Accession:GSM1000558 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD 3 Plus System | SRP015680 | M-D+_1.csfasta | SOLiD_native | 1284638285.0 | 36703951.0 | GSM1000558 r1 | 0:35 | 0:328871758;1:317693850;2:402981931;3:233637468;.:1453278 | 35 | SRX185758 | SRS361911 | SRA058618 | GEO | National University of Singapore | 1 | 0.10539 | 0.00562 | 0.99141 | 0.37635 | 35 | B | usable mapping rate | legacy | early | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Singapore | 2012-09-10 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||||
| 36510 | 36510 | SRR566692 | SRX185757 | SRS361910 | SRP015680 | PRJNA174800 | Transcriptomic analyses of Myc induced zebrafish liver cancer | GSE40745 | Transcriptome Analysis | To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system. | pubmed:23038063 | source: control liver M+D | GSM1000557: M+D 2 | GSM1000557 | genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:n1 | M+D 2 | The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. | control liver M+D | Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. | Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol. | genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:n1 | GSM1000557 | GSM1000557: M+D 2; Danio rerio; RNA Seq | GSM1000557 1 | 1 | GEO Accession:GSM1000557 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD 3 Plus System | SRP015680 | M+D-_2_QV.qual | SOLiD_native | 1404966080.0 | 40141888.0 | GSM1000557 r1 | 0:35 | 0:371691603;1:354481639;2:405221861;3:271978812;.:1592165 | 35 | SRX185757 | SRS361910 | SRA058618 | GEO | National University of Singapore | 1 | 0.07869 | 0.00455 | 0.99253 | 0.51508 | 35 | B | usable mapping rate | legacy | early | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Singapore | 2012-09-10 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||||
| 36511 | 36511 | SRR566691 | SRX185756 | SRS361909 | SRP015680 | PRJNA174800 | Transcriptomic analyses of Myc induced zebrafish liver cancer | GSE40745 | Transcriptome Analysis | To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system. | pubmed:23038063 | source: control liver M+D | GSM1000556: M+D 1 | GSM1000556 | genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:n1 | M+D 1 | The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. | control liver M+D | Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. | Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol. | genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:n1 | GSM1000556 | GSM1000556: M+D 1; Danio rerio; RNA Seq | GSM1000556 1 | 1 | GEO Accession:GSM1000556 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD 3 Plus System | SRP015680 | M+D-_1_QV.qual M+D-_1.csfasta | SOLiD_native SOLiD_native | 1286706820.0 | 36763052.0 | GSM1000556 r1 | 0:35 | 0:252864341;1:338709089;2:436928155;3:256235022;.:1970213 | 35 | SRX185756 | SRS361909 | SRA058618 | GEO | National University of Singapore | 1 | 0.12399 | 0.00617 | 0.98752 | 0.50351 | 35 | B | usable mapping rate | legacy | early | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Singapore | 2012-09-10 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||||
| 36512 | 36512 | SRR566690 | SRX185755 | SRS361908 | SRP015680 | PRJNA174800 | Transcriptomic analyses of Myc induced zebrafish liver cancer | GSE40745 | Transcriptome Analysis | To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system. | pubmed:23038063 | source: control liver M D | GSM1000555: M D 2 | GSM1000555 | genotype:wildtype|tissue:liver|treatment:n1 | M D 2 | The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. | control liver M D | Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. | Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol. | genotype:wildtype|tissue:liver|treatment:n1 | GSM1000555 | GSM1000555: M D 2; Danio rerio; RNA Seq | GSM1000555 1 | 1 | GEO Accession:GSM1000555 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD 3 Plus System | SRP015680 | M-D-_2_QV.qual M-D-_2.csfasta | SOLiD_native SOLiD_native | 1337952770.0 | 38227222.0 | GSM1000555 r1 | 0:35 | 0:391863829;1:347720340;2:312814682;3:283542736;.:2011183 | 35 | SRX185755 | SRS361908 | SRA058618 | GEO | National University of Singapore | 1 | 0.04605 | 0.00365 | 0.99494 | 0.51825 | 35 | B | usable mapping rate | legacy | early | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Singapore | 2012-09-10 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||||
| 36513 | 36513 | SRR566689 | SRX185754 | SRS361907 | SRP015680 | PRJNA174800 | Transcriptomic analyses of Myc induced zebrafish liver cancer | GSE40745 | Transcriptome Analysis | To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system. | pubmed:23038063 | source: control liver M D | GSM1000554: M D 1 | GSM1000554 | genotype:wildtype|tissue:liver|treatment:n1 | M D 1 | The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. | control liver M D | Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. | Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol. | genotype:wildtype|tissue:liver|treatment:n1 | GSM1000554 | GSM1000554: M D 1; Danio rerio; RNA Seq | GSM1000554 1 | 1 | GEO Accession:GSM1000554 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD 3 Plus System | SRP015680 | M-D-_1.csfasta | SOLiD_native | 1395143680.0 | 39861248.0 | GSM1000554 r1 | 0:35 | 0:439852883;1:355203725;2:298639546;3:299770820;.:1676706 | 35 | SRX185754 | SRS361907 | SRA058618 | GEO | National University of Singapore | 1 | 0.02094 | 0.00123 | 0.99784 | 0.58426 | 35 | B | usable mapping rate | legacy | early | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Singapore | 2012-09-10 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||||
| 37217 | 37217 | SRR1035240 | SRX381137 | SRS505529 | SRP033231 | PRJNA229468 | Overexpression of UHRF1 drives DNA hypomethylation and hepatocellular carcinoma | GSE52605 | Transcriptome Analysis | UHRF1 is an essential regulator of DNA methylation that is highly expressed in many cancers. Using transgenic zebrafish cultured cells and human tumors we demonstrate that UHRF1 is an oncogene. RNAseq was used to assess the variation in gene expression between control and experimental samples. Overall design: Total small RNA from 2 batches of Tgfabp10:has.UHRF1 GFPHigh and age matched Tgfabp10:nls mCherry control 5 dpf zebrafish livers was purified for preparation of high throughput sequencing libraries. | pubmed:24486181 | mCherry cntr2 | GSM1272461 | source name:Zebrafish 5 dpf liver|genotype/variation:Tgfabp10:nls mCherry|tissue:liver|development stage:5 dpf | mCherry cntr2 | Illumina CASAVA version 1.7 used for basecalling Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes genes and their quantile normalized frequencies. | Zebrafish 5 dpf liver | Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends. | genotype/variation:Tgfabp10:nls mCherry|tissue:liver|developmental stage:5 dpf | GSM1272461 | GSM1272461: mCherry cntr2; Danio rerio; RNA Seq | GSM1272461 | 1 | Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends. | GEO Accession:GSM1272461 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033231 | mCherry_cntr2.fastq.gz | fastq | 2132003100.0 | 21320031.0 | GSM1272461 r1 | 0:100 | A:536532013;C:533562250;G:522685362;T:536641910;N:2581565 | 100 | 536532013 | 533562250 | 522685362 | 536641910 | 2581565 | SRX381137 | SRS505529 | SRA111986 | GEO | sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai | 1 | 0.88347 | 0.04357 | 0.81964 | 0.52384 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2013-11-21 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 37218 | 37218 | SRR1035239 | SRX381136 | SRS505528 | SRP033231 | PRJNA229468 | Overexpression of UHRF1 drives DNA hypomethylation and hepatocellular carcinoma | GSE52605 | Transcriptome Analysis | UHRF1 is an essential regulator of DNA methylation that is highly expressed in many cancers. Using transgenic zebrafish cultured cells and human tumors we demonstrate that UHRF1 is an oncogene. RNAseq was used to assess the variation in gene expression between control and experimental samples. Overall design: Total small RNA from 2 batches of Tgfabp10:has.UHRF1 GFPHigh and age matched Tgfabp10:nls mCherry control 5 dpf zebrafish livers was purified for preparation of high throughput sequencing libraries. | pubmed:24486181 | mCherry cntr1 | GSM1272460 | source name:Zebrafish 5 dpf liver|genotype/variation:Tgfabp10:nls mCherry|tissue:liver|development stage:5 dpf | mCherry cntr1 | Illumina CASAVA version 1.7 used for basecalling Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes genes and their quantile normalized frequencies. | Zebrafish 5 dpf liver | Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends. | genotype/variation:Tgfabp10:nls mCherry|tissue:liver|developmental stage:5 dpf | GSM1272460 | GSM1272460: mCherry cntr1; Danio rerio; RNA Seq | GSM1272460 | 1 | Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends. | GEO Accession:GSM1272460 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033231 | mCherry_cntr1.fastq.gz | fastq | 2098395500.0 | 20983955.0 | GSM1272460 r1 | 0:100 | A:533756912;C:521877600;G:512200617;T:528020965;N:2539406 | 100 | 533756912 | 521877600 | 512200617 | 528020965 | 2539406 | SRX381136 | SRS505528 | SRA111986 | GEO | sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai | 1 | 0.89445 | 0.02866 | 0.82426 | 0.50861 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2013-11-21 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 37219 | 37219 | SRR1035238 | SRX381135 | SRS505527 | SRP033231 | PRJNA229468 | Overexpression of UHRF1 drives DNA hypomethylation and hepatocellular carcinoma | GSE52605 | Transcriptome Analysis | UHRF1 is an essential regulator of DNA methylation that is highly expressed in many cancers. Using transgenic zebrafish cultured cells and human tumors we demonstrate that UHRF1 is an oncogene. RNAseq was used to assess the variation in gene expression between control and experimental samples. Overall design: Total small RNA from 2 batches of Tgfabp10:has.UHRF1 GFPHigh and age matched Tgfabp10:nls mCherry control 5 dpf zebrafish livers was purified for preparation of high throughput sequencing libraries. | pubmed:24486181 | UHRF1 hi B | GSM1272459 | source name:Zebrafish 5 dpf liver|genotype/variation:Tgfabp10:has.UHRF1 GFP|tissue:liver|development stage:5 dpf | UHRF1 hi B | Illumina CASAVA version 1.7 used for basecalling Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes genes and their quantile normalized frequencies. | Zebrafish 5 dpf liver | Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends. | genotype/variation:Tgfabp10:has.UHRF1 GFP|tissue:liver|developmental stage:5 dpf | GSM1272459 | GSM1272459: UHRF1 hi B; Danio rerio; RNA Seq | GSM1272459 | 1 | Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends. | GEO Accession:GSM1272459 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033231 | UHRF1_hi_B.fastq.gz | fastq | 2127061900.0 | 21270619.0 | GSM1272459 r1 | 0:100 | A:540147604;C:542900044;G:522760277;T:518703604;N:2550371 | 100 | 540147604 | 542900044 | 522760277 | 518703604 | 2550371 | SRX381135 | SRS505527 | SRA111986 | GEO | sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai | 1 | 0.7609 | 0.0395 | 0.77788 | 0.51544 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2013-11-21 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 37220 | 37220 | SRR1035237 | SRX381134 | SRS505526 | SRP033231 | PRJNA229468 | Overexpression of UHRF1 drives DNA hypomethylation and hepatocellular carcinoma | GSE52605 | Transcriptome Analysis | UHRF1 is an essential regulator of DNA methylation that is highly expressed in many cancers. Using transgenic zebrafish cultured cells and human tumors we demonstrate that UHRF1 is an oncogene. RNAseq was used to assess the variation in gene expression between control and experimental samples. Overall design: Total small RNA from 2 batches of Tgfabp10:has.UHRF1 GFPHigh and age matched Tgfabp10:nls mCherry control 5 dpf zebrafish livers was purified for preparation of high throughput sequencing libraries. | pubmed:24486181 | UHRF1 hi A | GSM1272458 | source name:Zebrafish 5 dpf liver|genotype/variation:Tgfabp10:has.UHRF1 GFP|tissue:liver|development stage:5 dpf | UHRF1 hi A | Illumina CASAVA version 1.7 used for basecalling Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes genes and their quantile normalized frequencies. | Zebrafish 5 dpf liver | Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends. | genotype/variation:Tgfabp10:has.UHRF1 GFP|tissue:liver|developmental stage:5 dpf | GSM1272458 | GSM1272458: UHRF1 hi A; Danio rerio; RNA Seq | GSM1272458 | 1 | Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends. | GEO Accession:GSM1272458 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033231 | UHRF1_hi_A.fastq.gz | fastq | 2476218900.0 | 24762189.0 | GSM1272458 r1 | 0:100 | A:625575890;C:631605318;G:620422311;T:595617894;N:2997487 | 100 | 625575890 | 631605318 | 620422311 | 595617894 | 2997487 | SRX381134 | SRS505526 | SRA111986 | GEO | sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai | 1 | 0.80154 | 0.04243 | 0.80409 | 0.50831 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2013-11-21 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 37985 | 37985 | SRR1216351 | SRX510531 | SRS588958 | SRP040940 | PRJNA243510 | Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish | GSE56498 | Transcriptome Analysis | ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | parent bioproject:PRJNA541472 | pubmed:24874946 | nls Cherry Ethanol #2 | GSM1362715 | tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf | nls Cherry Ethanol #2 | Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. | Zebrafish 5 dpf liver | Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf | GSM1362715 | GSM1362715: nls Cherry Ethanol #2; Danio rerio; ncRNA Seq | GSM1362715 | 1 | Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | GEO Accession:GSM1362715 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP040940 | Cherry2-ethanol_raw.txt.gz | fastq | 2547597500.0 | 25475975.0 | GSM1362715 r1 | 0:100 | A:667878423;C:617022069;G:603019059;T:656604341;N:3073608 | 100 | 667878423 | 617022069 | 603019059 | 656604341 | 3073608 | SRX510531 | SRS588958 | SRA156310 | GEO | sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai | 1 | 0.903 | 0.06203 | 0.78173 | 0.47105 | 100 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | United States | 2014-04-03 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||
| 37986 | 37986 | SRR1216350 | SRX510530 | SRS588959 | SRP040940 | PRJNA243510 | Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish | GSE56498 | Transcriptome Analysis | ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | parent bioproject:PRJNA541472 | pubmed:24874946 | nls Cherry Ethanol #1 | GSM1362714 | tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf | nls Cherry Ethanol #1 | Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. | Zebrafish 5 dpf liver | Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf | GSM1362714 | GSM1362714: nls Cherry Ethanol #1; Danio rerio; ncRNA Seq | GSM1362714 | 1 | Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | GEO Accession:GSM1362714 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP040940 | Cherry1-ethanol_raw.txt.gz | fastq | 2848772300.0 | 28487723.0 | GSM1362714 r1 | 0:100 | A:754173668;C:673034180;G:669171787;T:748900638;N:3492027 | 100 | 754173668 | 673034180 | 669171787 | 748900638 | 3492027 | SRX510530 | SRS588959 | SRA156310 | GEO | sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai | 1 | 0.93424 | 0.04344 | 0.80365 | 0.45184 | 100 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | United States | 2014-04-03 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||
| 37987 | 37987 | SRR1216349 | SRX510529 | SRS588957 | SRP040940 | PRJNA243510 | Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish | GSE56498 | Transcriptome Analysis | ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | parent bioproject:PRJNA541472 | pubmed:24874946 | nAtf6 Cherry #1 | GSM1362713 | tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nAtf6 cherry; cmlc2:GFP|developmental stage:5 dpf | nAtf6 Cherry #1 | Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. | Zebrafish 5 dpf liver | Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | tissue type:liver|genotype:Tgfabp10:nAtf6 cherry; cmlc2:GFP|developmental stage:5 dpf | GSM1362713 | GSM1362713: nAtf6 Cherry #1; Danio rerio; ncRNA Seq | GSM1362713 | 1 | Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | GEO Accession:GSM1362713 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP040940 | nAtf61_raw.txt.gz | fastq | 2259581400.0 | 22595814.0 | GSM1362713 r1 | 0:100 | A:577752854;C:550694305;G:551105918;T:577235877;N:2792446 | 100 | 577752854 | 550694305 | 551105918 | 577235877 | 2792446 | SRX510529 | SRS588957 | SRA156310 | GEO | sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai | 1 | 0.94581 | 0.04947 | 0.80375 | 0.52352 | 100 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | United States | 2014-04-03 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||
| 37988 | 37988 | SRR1216348 | SRX510528 | SRS588956 | SRP040940 | PRJNA243510 | Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish | GSE56498 | Transcriptome Analysis | ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | parent bioproject:PRJNA541472 | pubmed:24874946 | nls Cherry #2 | GSM1362712 | tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf | nls Cherry #2 | Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. | Zebrafish 5 dpf liver | Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf | GSM1362712 | GSM1362712: nls Cherry #2; Danio rerio; ncRNA Seq | GSM1362712 | 1 | Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | GEO Accession:GSM1362712 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP040940 | Cherry2_raw.txt.gz | fastq | 2132003100.0 | 21320031.0 | GSM1362712 r1 | 0:100 | A:536532013;C:533562250;G:522685362;T:536641910;N:2581565 | 100 | 536532013 | 533562250 | 522685362 | 536641910 | 2581565 | SRX510528 | SRS588956 | SRA156310 | GEO | sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai | 1 | 0.88352 | 0.04379 | 0.81947 | 0.52367 | 100 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | United States | 2014-04-03 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||
| 37989 | 37989 | SRR1216347 | SRX510527 | SRS588955 | SRP040940 | PRJNA243510 | Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish | GSE56498 | Transcriptome Analysis | ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | parent bioproject:PRJNA541472 | pubmed:24874946 | nls Cherry #1 | GSM1362711 | tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf | nls Cherry #1 | Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. | Zebrafish 5 dpf liver | Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf | GSM1362711 | GSM1362711: nls Cherry #1; Danio rerio; ncRNA Seq | GSM1362711 | 1 | Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. | GEO Accession:GSM1362711 | ncRNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | SRP040940 | Cherry1_raw.txt.gz | fastq | 2098395500.0 | 20983955.0 | GSM1362711 r1 | 0:100 | A:533756912;C:521877600;G:512200617;T:528020965;N:2539406 | 100 | 533756912 | 521877600 | 512200617 | 528020965 | 2539406 | SRX510527 | SRS588955 | SRA156310 | GEO | sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai | 1 | 0.89447 | 0.02865 | 0.82436 | 0.50802 | 100 | B | usable mapping rate | illumina | early_illumina | unknown | size_fractionation | unknown | bulk | unknown | unknown | United States | 2014-04-03 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||||||||
| 40352 | 40352 | SRR3098582 | SRX1528549 | SRS1246175 | SRP068364 | PRJNA308582 | Transcriptional profiling through RNA seq of zebrafish larval liver post exposure to biliatresone a biliary toxin. | GSE76780 | Transcriptome Analysis | We sequenced liver mRNA isolated from biliatresone treated zebrafish larvae and DMSO treated controls in order to elucidate the molecular pathways induced by biliatresone a biliary toxin that is responsible for outbreaks of biliary atresia in Australian liverstock. Overall design: Liver mRNA profiles of biliatresone treated zebrafish larvae and DMSO treated controls were generated by deep sequencing in duplicates. | pubmed:27102575 | Biliatres1 2 | GSM2037741 | source name:liver|tissue:liver|treatment:Biliatres1 | Biliatres1 2 | Hiseq control software HCS was used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to zv9 whole genome using STAR. Python Htseq script was used to count the number of reads. Genome build: zv9 Supplementary files format and content: tab delimited text files include htseq count output. | liver | Zebrafish larvae were treated with biliatresone 0.5 ug/ml for four hours. | Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit. | tissue:liver|treatment:Biliatres1 | GSM2037741 | GSM2037741: Biliatres1 2; Danio rerio; RNA Seq | GSM2037741 | 1 | Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit. | GEO Accession:GSM2037741 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP068364 | Toxin_2-Pack_1.fq.gz Toxin_2-Pack_2.fq.gz | fastq fastq | 11821468800.0 | 59107344.0 | GSM2037741 r1 | 0:100 1:100 | A:2991132983;C:2918961261;G:2932581309;T:2978195946;N:597301 | 100 | 100 | 2991132983 | 2918961261 | 2932581309 | 2978195946 | 597301 | SRX1528549 | SRS1246175 | SRA333195 | GEO | Michael Pack, Medicine/DIgestive Diseases, University of Pennsylvania | 2 | 0.84122 | 0.83891 | 0.11156 | 0.10952 | 0.76073 | 0.76049 | 0.61886 | 0.62136 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | bulk | bulk | United States | 2016-01-12 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||
| 40353 | 40353 | SRR3098581 | SRX1528548 | SRS1246176 | SRP068364 | PRJNA308582 | Transcriptional profiling through RNA seq of zebrafish larval liver post exposure to biliatresone a biliary toxin. | GSE76780 | Transcriptome Analysis | We sequenced liver mRNA isolated from biliatresone treated zebrafish larvae and DMSO treated controls in order to elucidate the molecular pathways induced by biliatresone a biliary toxin that is responsible for outbreaks of biliary atresia in Australian liverstock. Overall design: Liver mRNA profiles of biliatresone treated zebrafish larvae and DMSO treated controls were generated by deep sequencing in duplicates. | pubmed:27102575 | Biliatres1 1 | GSM2037740 | source name:liver|tissue:liver|treatment:Biliatres1 | Biliatres1 1 | Hiseq control software HCS was used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to zv9 whole genome using STAR. Python Htseq script was used to count the number of reads. Genome build: zv9 Supplementary files format and content: tab delimited text files include htseq count output. | liver | Zebrafish larvae were treated with biliatresone 0.5 ug/ml for four hours. | Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit. | tissue:liver|treatment:Biliatres1 | GSM2037740 | GSM2037740: Biliatres1 1; Danio rerio; RNA Seq | GSM2037740 | 1 | Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit. | GEO Accession:GSM2037740 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP068364 | Toxin_1-Pack_1.fq.gz Toxin_1-Pack_2.fq.gz | fastq fastq | 11256964600.0 | 56284823.0 | GSM2037740 r1 | 0:100 1:100 | A:2904557741;C:2723715275;G:2731673206;T:2896488406;N:529972 | 100 | 100 | 2904557741 | 2723715275 | 2731673206 | 2896488406 | 529972 | SRX1528548 | SRS1246176 | SRA333195 | GEO | Michael Pack, Medicine/DIgestive Diseases, University of Pennsylvania | 2 | 0.88354 | 0.88079 | 0.10204 | 0.10016 | 0.76088 | 0.76142 | 0.61543 | 0.61859 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | bulk | bulk | United States | 2016-01-12 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||
| 40354 | 40354 | SRR3098580 | SRX1528547 | SRS1246177 | SRP068364 | PRJNA308582 | Transcriptional profiling through RNA seq of zebrafish larval liver post exposure to biliatresone a biliary toxin. | GSE76780 | Transcriptome Analysis | We sequenced liver mRNA isolated from biliatresone treated zebrafish larvae and DMSO treated controls in order to elucidate the molecular pathways induced by biliatresone a biliary toxin that is responsible for outbreaks of biliary atresia in Australian liverstock. Overall design: Liver mRNA profiles of biliatresone treated zebrafish larvae and DMSO treated controls were generated by deep sequencing in duplicates. | pubmed:27102575 | Control 2 | GSM2037739 | source name:liver|tissue:liver|treatment:DMSO | Control 2 | Hiseq control software HCS was used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to zv9 whole genome using STAR. Python Htseq script was used to count the number of reads. Genome build: zv9 Supplementary files format and content: tab delimited text files include htseq count output. | liver | Zebrafish larvae were treated with biliatresone 0.5 ug/ml for four hours. | Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit. | tissue:liver|treatment:DMSO | GSM2037739 | GSM2037739: Control 2; Danio rerio; RNA Seq | GSM2037739 | 1 | Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit. | GEO Accession:GSM2037739 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP068364 | Control_2-Pack_1.fq.gz Control_2-Pack_2.fq.gz | fastq fastq | 11100792600.0 | 55503963.0 | GSM2037739 r1 | 0:100 1:100 | A:2815807606;C:2731691384;G:2743610074;T:2809211211;N:472325 | 100 | 100 | 2815807606 | 2731691384 | 2743610074 | 2809211211 | 472325 | SRX1528547 | SRS1246177 | SRA333195 | GEO | Michael Pack, Medicine/DIgestive Diseases, University of Pennsylvania | 2 | 0.85048 | 0.84831 | 0.10818 | 0.10631 | 0.76025 | 0.76041 | 0.6032 | 0.60884 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | bulk | bulk | United States | 2016-01-12 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||
| 40355 | 40355 | SRR3098579 | SRX1528546 | SRS1246178 | SRP068364 | PRJNA308582 | Transcriptional profiling through RNA seq of zebrafish larval liver post exposure to biliatresone a biliary toxin. | GSE76780 | Transcriptome Analysis | We sequenced liver mRNA isolated from biliatresone treated zebrafish larvae and DMSO treated controls in order to elucidate the molecular pathways induced by biliatresone a biliary toxin that is responsible for outbreaks of biliary atresia in Australian liverstock. Overall design: Liver mRNA profiles of biliatresone treated zebrafish larvae and DMSO treated controls were generated by deep sequencing in duplicates. | pubmed:27102575 | Control 1 | GSM2037738 | source name:liver|tissue:liver|treatment:DMSO | Control 1 | Hiseq control software HCS was used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to zv9 whole genome using STAR. Python Htseq script was used to count the number of reads. Genome build: zv9 Supplementary files format and content: tab delimited text files include htseq count output. | liver | Zebrafish larvae were treated with biliatresone 0.5 ug/ml for four hours. | Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit. | tissue:liver|treatment:DMSO | GSM2037738 | GSM2037738: Control 1; Danio rerio; RNA Seq | GSM2037738 | 1 | Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit. | GEO Accession:GSM2037738 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP068364 | Control_1-Pack_2.fq.gz Control_1-Pack_1.fq.gz | fastq fastq | 11315242000.0 | 56576210.0 | GSM2037738 r1 | 0:100 1:100 | A:2768862811;C:2888735322;G:2893616488;T:2763590339;N:437040 | 100 | 100 | 2768862811 | 2888735322 | 2893616488 | 2763590339 | 437040 | SRX1528546 | SRS1246178 | SRA333195 | GEO | Michael Pack, Medicine/DIgestive Diseases, University of Pennsylvania | 2 | 0.7716 | 0.76823 | 0.09579 | 0.09326 | 0.78447 | 0.78472 | 0.62953 | 0.62992 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | bulk | bulk | United States | 2016-01-12 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||
| 40743 | 40743 | SRR3342393 | SRX1684659 | SRS1379870 | SRP072957 | PRJNA317597 | FOXN3 regulates hepatic glucose utilization | GSE80003 | Transcriptome Analysis | We sequenced mRNA from livers of 7 dpf transgenic zebrafish overexpressing foxn3 in the liver and non transgenic siblings Overall design: Examination of the changes in level of different mRNAs in foxn3 transgenic and wild type siblings | pubmed:27292639 | Transgenic3 | GSM2109873 | source name:foxn3 overexpression liver|tissue:Liver|transgene:foxn3|developmental stage:7 dpf larvae | Transgenic3 | Reads were aligned to the genome using novoalign Annotated splice junctions generated by the MakeTranscriptome command in the USeq Splice junction reads were then converted to genomic coordinates using the SamTranscriptomeParser command in USeq Differential gene expression analysis was performed on the resulting count table using DESeq2 Genome build: Zv9 genome build Supplementary files format and content: excel file with read counts FPKM and statistical analysis | foxn3 overexpression liver | Total RNA extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine | tissue:Liver|transgene:foxn3|developmental stage:7 dpf larvae | GSM2109873 | GSM2109873: Transgenic3; Danio rerio; RNA Seq | GSM2109873 | 1 | Total RNA extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine | GEO Accession:GSM2109873 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP072957 | 11405X8_150225_D00294_0165_AC6BKMANXX_7.txt.gz | fastq | 1538486450.0 | 30769729.0 | GSM2109873 r1 | 0:50 | A:399631224;C:339577730;G:345815787;T:453436273;N:25436 | 50 | 399631224 | 339577730 | 345815787 | 453436273 | 25436 | SRX1684659 | SRS1379870 | SRA405566 | GEO | Amnon Schlegel, Molecular Medicine Program, University of Utah School of Medicine | 1 | 0.89036 | 0.28368 | 0.75461 | 0.63309 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | United States | 2016-04-06 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 40744 | 40744 | SRR3342392 | SRX1684658 | SRS1379871 | SRP072957 | PRJNA317597 | FOXN3 regulates hepatic glucose utilization | GSE80003 | Transcriptome Analysis | We sequenced mRNA from livers of 7 dpf transgenic zebrafish overexpressing foxn3 in the liver and non transgenic siblings Overall design: Examination of the changes in level of different mRNAs in foxn3 transgenic and wild type siblings | pubmed:27292639 | Transgenic2 | GSM2109872 | source name:foxn3 overexpression liver|tissue:Liver|transgene:foxn3|developmental stage:7 dpf larvae | Transgenic2 | Reads were aligned to the genome using novoalign Annotated splice junctions generated by the MakeTranscriptome command in the USeq Splice junction reads were then converted to genomic coordinates using the SamTranscriptomeParser command in USeq Differential gene expression analysis was performed on the resulting count table using DESeq2 Genome build: Zv9 genome build Supplementary files format and content: excel file with read counts FPKM and statistical analysis | foxn3 overexpression liver | Total RNA extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine | tissue:Liver|transgene:foxn3|developmental stage:7 dpf larvae | GSM2109872 | GSM2109872: Transgenic2; Danio rerio; RNA Seq | GSM2109872 | 1 | Total RNA extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine | GEO Accession:GSM2109872 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP072957 | 11405X7_150225_D00294_0165_AC6BKMANXX_7.txt.gz | fastq | 1500971700.0 | 30019434.0 | GSM2109872 r1 | 0:50 | A:389353802;C:331408746;G:327481397;T:452703447;N:24308 | 50 | 389353802 | 331408746 | 327481397 | 452703447 | 24308 | SRX1684658 | SRS1379871 | SRA405566 | GEO | Amnon Schlegel, Molecular Medicine Program, University of Utah School of Medicine | 1 | 0.9148 | 0.242 | 0.76784 | 0.44492 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | United States | 2016-04-06 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 40745 | 40745 | SRR3342391 | SRX1684657 | SRS1379872 | SRP072957 | PRJNA317597 | FOXN3 regulates hepatic glucose utilization | GSE80003 | Transcriptome Analysis | We sequenced mRNA from livers of 7 dpf transgenic zebrafish overexpressing foxn3 in the liver and non transgenic siblings Overall design: Examination of the changes in level of different mRNAs in foxn3 transgenic and wild type siblings | pubmed:27292639 | Transgenic1 | GSM2109871 | source name:foxn3 overexpression liver|tissue:Liver|transgene:foxn3|developmental stage:7 dpf larvae | Transgenic1 | Reads were aligned to the genome using novoalign Annotated splice junctions generated by the MakeTranscriptome command in the USeq Splice junction reads were then converted to genomic coordinates using the SamTranscriptomeParser command in USeq Differential gene expression analysis was performed on the resulting count table using DESeq2 Genome build: Zv9 genome build Supplementary files format and content: excel file with read counts FPKM and statistical analysis | foxn3 overexpression liver | Total RNA extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine | tissue:Liver|transgene:foxn3|developmental stage:7 dpf larvae | GSM2109871 | GSM2109871: Transgenic1; Danio rerio; RNA Seq | GSM2109871 | 1 | Total RNA extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine | GEO Accession:GSM2109871 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP072957 | 11405X6_150225_D00294_0165_AC6BKMANXX_7.txt.gz | fastq | 1672645200.0 | 33452904.0 | GSM2109871 r1 | 0:50 | A:446934700;C:363616773;G:354194568;T:507871249;N:27910 | 50 | 446934700 | 363616773 | 354194568 | 507871249 | 27910 | SRX1684657 | SRS1379872 | SRA405566 | GEO | Amnon Schlegel, Molecular Medicine Program, University of Utah School of Medicine | 1 | 0.90431 | 0.33357 | 0.75075 | 0.62394 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | United States | 2016-04-06 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 40746 | 40746 | SRR3342390 | SRX1684656 | SRS1379873 | SRP072957 | PRJNA317597 | FOXN3 regulates hepatic glucose utilization | GSE80003 | Transcriptome Analysis | We sequenced mRNA from livers of 7 dpf transgenic zebrafish overexpressing foxn3 in the liver and non transgenic siblings Overall design: Examination of the changes in level of different mRNAs in foxn3 transgenic and wild type siblings | pubmed:27292639 | WT3 | GSM2109870 | source name:wildtype liver|tissue:Liver|developmental stage:7 dpf larvae | WT3 | Reads were aligned to the genome using novoalign Annotated splice junctions generated by the MakeTranscriptome command in the USeq Splice junction reads were then converted to genomic coordinates using the SamTranscriptomeParser command in USeq Differential gene expression analysis was performed on the resulting count table using DESeq2 Genome build: Zv9 genome build Supplementary files format and content: excel file with read counts FPKM and statistical analysis | wildtype liver | Total RNA extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine | tissue:Liver|developmental stage:7 dpf larvae | GSM2109870 | GSM2109870: WT3; Danio rerio; RNA Seq | GSM2109870 | 1 | Total RNA extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine | GEO Accession:GSM2109870 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP072957 | 11405X4_150225_D00294_0165_AC6BKMANXX_7.txt.gz | fastq | 1621245550.0 | 32424911.0 | GSM2109870 r1 | 0:50 | A:387275594;C:392477306;G:410916447;T:430550072;N:26131 | 50 | 387275594 | 392477306 | 410916447 | 430550072 | 26131 | SRX1684656 | SRS1379873 | SRA405566 | GEO | Amnon Schlegel, Molecular Medicine Program, University of Utah School of Medicine | 1 | 0.75787 | 0.22112 | 0.80858 | 0.6379 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | United States | 2016-04-06 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 40747 | 40747 | SRR3342389 | SRX1684655 | SRS1379874 | SRP072957 | PRJNA317597 | FOXN3 regulates hepatic glucose utilization | GSE80003 | Transcriptome Analysis | We sequenced mRNA from livers of 7 dpf transgenic zebrafish overexpressing foxn3 in the liver and non transgenic siblings Overall design: Examination of the changes in level of different mRNAs in foxn3 transgenic and wild type siblings | pubmed:27292639 | WT2 | GSM2109869 | source name:wildtype liver|tissue:Liver|developmental stage:7 dpf larvae | WT2 | Reads were aligned to the genome using novoalign Annotated splice junctions generated by the MakeTranscriptome command in the USeq Splice junction reads were then converted to genomic coordinates using the SamTranscriptomeParser command in USeq Differential gene expression analysis was performed on the resulting count table using DESeq2 Genome build: Zv9 genome build Supplementary files format and content: excel file with read counts FPKM and statistical analysis | wildtype liver | Total RNA extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine | tissue:Liver|developmental stage:7 dpf larvae | GSM2109869 | GSM2109869: WT2; Danio rerio; RNA Seq | GSM2109869 | 1 | Total RNA extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine | GEO Accession:GSM2109869 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP072957 | 11405X3_150225_D00294_0165_AC6BKMANXX_7.txt.gz | fastq | 1660295850.0 | 33205917.0 | GSM2109869 r1 | 0:50 | A:441731711;C:362842137;G:351944677;T:503749546;N:27779 | 50 | 441731711 | 362842137 | 351944677 | 503749546 | 27779 | SRX1684655 | SRS1379874 | SRA405566 | GEO | Amnon Schlegel, Molecular Medicine Program, University of Utah School of Medicine | 1 | 0.90993 | 0.31148 | 0.74602 | 0.62587 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | United States | 2016-04-06 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 40748 | 40748 | SRR3342388 | SRX1684654 | SRS1379875 | SRP072957 | PRJNA317597 | FOXN3 regulates hepatic glucose utilization | GSE80003 | Transcriptome Analysis | We sequenced mRNA from livers of 7 dpf transgenic zebrafish overexpressing foxn3 in the liver and non transgenic siblings Overall design: Examination of the changes in level of different mRNAs in foxn3 transgenic and wild type siblings | pubmed:27292639 | WT1 | GSM2109868 | source name:wildtype liver|tissue:Liver|developmental stage:7 dpf larvae | WT1 | Reads were aligned to the genome using novoalign Annotated splice junctions generated by the MakeTranscriptome command in the USeq Splice junction reads were then converted to genomic coordinates using the SamTranscriptomeParser command in USeq Differential gene expression analysis was performed on the resulting count table using DESeq2 Genome build: Zv9 genome build Supplementary files format and content: excel file with read counts FPKM and statistical analysis | wildtype liver | Total RNA extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine | tissue:Liver|developmental stage:7 dpf larvae | GSM2109868 | GSM2109868: WT1; Danio rerio; RNA Seq | GSM2109868 | 1 | Total RNA extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine | GEO Accession:GSM2109868 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP072957 | 11405X2_150225_D00294_0165_AC6BKMANXX_7.txt.gz | fastq | 1588346650.0 | 31766933.0 | GSM2109868 r1 | 0:50 | A:427469407;C:345629775;G:329846628;T:485374945;N:25895 | 50 | 427469407 | 345629775 | 329846628 | 485374945 | 25895 | SRX1684654 | SRS1379875 | SRA405566 | GEO | Amnon Schlegel, Molecular Medicine Program, University of Utah School of Medicine | 1 | 0.89836 | 0.33182 | 0.75694 | 0.62202 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | United States | 2016-04-06 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||
| 43836 | 43836 | SRR6170100 | SRX3280949 | SRS2591760 | SRP119921 | PRJNA414225 | Differential gene expression in the liver of zebrafish larvae exposed to 1 mM inorganic arsenic from xxx 120 hpf | GSE104953 | Transcriptome Analysis | The goal of this study is to compare gene expression levels in the livers of larval Tgfabp10:nls mcherry exposed to 1 mM inorganic arsenic from xxx 120 hpf to the unexposed siblings. Samples were collected from Tgfabp10:nls mcherry zebrafish larvae that were derived from incrossed parents of the same strain. The background of transgenic lines were typically from mixed outcrosses of the transgenics to AB TAB5 and TAB14 strains when regenerating the lines as the working stocks aged. All samples were collected at approximately 120 hpf natural spawning at 8:30 9:00AM EST on day zero samples were collected at 8 10AM EST on day 5. Overall design: Zebrafish larvae that were untreated control or those exposed to 1 mM inorganic arsenic from 4 hpf 120 hpf were anesthetized and the liver was microdissected from xxx 20 larvae and pooled per treatment group. The transgenic line Tgfabp10:nls mcherry was used to facilitate microdissection of the liver. RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment. Libraries were prepared according to Illumina Truseq RNA sample prep kit version 2 followed by Ribo Zero Gold treatment. | pubmed:29361514 | C3 | GSM2810893 | source name:5dpf embryos liver control|genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:n1 control|tissue:liver | C3 | Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and low quality sequence p 4 e 100 y a m 10 best strata Trimmed read were mapped to GRCz10 whole genome using tophat2 v2.1.0 with parameters no novel juncs G Accepted bam files were used for counting read numbers of each gene with HTSeq s no t exon i gene id Test of differential expression of each genes was implemented by DESeq2 in Bioconductor genes with reads number less than 10 were filtered out Genome build: GRCz10 https://www.ncbi.nlm.nih.gov/grc/zebrafish Supplementary files format and content: .txt file. Reads count of genes | 5dpf embryos liver control | 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol | genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:n1 control|tissue:liver | GSM2810893 | GSM2810893: C3; Danio rerio; RNA Seq | GSM2810893 | 1 | 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol | GEO Accession:GSM2810893 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP119921 | Sample_C3-302_read1.fastq.gz Sample_C3-302_read2.fastq.gz | fastq fastq | 10027139610.0 | 49639305.0 | GSM2810893 r1 | 0:101 1:101 | A:2626098652;C:2366641673;G:2449308862;T:2460503397;N:124587026 | 101 | 101 | 2626098652 | 2366641673 | 2449308862 | 2460503397 | 124587026 | SRX3280949 | SRS2591760 | SRA619573 | GEO | Biology, New York University Abu Dhabi | 2 | 0.92114 | 0.91895 | 0.03472 | 0.03624 | 0.80815 | 0.8225 | 0.51053 | 0.44025 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United Arab Emirates | 2017-10-13 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 43837 | 43837 | SRR6170099 | SRX3280948 | SRS2591759 | SRP119921 | PRJNA414225 | Differential gene expression in the liver of zebrafish larvae exposed to 1 mM inorganic arsenic from xxx 120 hpf | GSE104953 | Transcriptome Analysis | The goal of this study is to compare gene expression levels in the livers of larval Tgfabp10:nls mcherry exposed to 1 mM inorganic arsenic from xxx 120 hpf to the unexposed siblings. Samples were collected from Tgfabp10:nls mcherry zebrafish larvae that were derived from incrossed parents of the same strain. The background of transgenic lines were typically from mixed outcrosses of the transgenics to AB TAB5 and TAB14 strains when regenerating the lines as the working stocks aged. All samples were collected at approximately 120 hpf natural spawning at 8:30 9:00AM EST on day zero samples were collected at 8 10AM EST on day 5. Overall design: Zebrafish larvae that were untreated control or those exposed to 1 mM inorganic arsenic from 4 hpf 120 hpf were anesthetized and the liver was microdissected from xxx 20 larvae and pooled per treatment group. The transgenic line Tgfabp10:nls mcherry was used to facilitate microdissection of the liver. RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment. Libraries were prepared according to Illumina Truseq RNA sample prep kit version 2 followed by Ribo Zero Gold treatment. | pubmed:29361514 | C2 | GSM2810892 | source name:5dpf embryos liver control|genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:n1 control|tissue:liver | C2 | Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and low quality sequence p 4 e 100 y a m 10 best strata Trimmed read were mapped to GRCz10 whole genome using tophat2 v2.1.0 with parameters no novel juncs G Accepted bam files were used for counting read numbers of each gene with HTSeq s no t exon i gene id Test of differential expression of each genes was implemented by DESeq2 in Bioconductor genes with reads number less than 10 were filtered out Genome build: GRCz10 https://www.ncbi.nlm.nih.gov/grc/zebrafish Supplementary files format and content: .txt file. Reads count of genes | 5dpf embryos liver control | 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol | genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:n1 control|tissue:liver | GSM2810892 | GSM2810892: C2; Danio rerio; RNA Seq | GSM2810892 | 1 | 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol | GEO Accession:GSM2810892 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP119921 | Sample_C2-299_read1.fastq.gz Sample_C2-299_read2.fastq.gz | fastq fastq | 9926753488.0 | 49142344.0 | GSM2810892 r1 | 0:101 1:101 | A:2477603964;C:2430411156;G:2471233920;T:2424071855;N:123432593 | 101 | 101 | 2477603964 | 2430411156 | 2471233920 | 2424071855 | 123432593 | SRX3280948 | SRS2591759 | SRA619573 | GEO | Biology, New York University Abu Dhabi | 2 | 0.93846 | 0.93739 | 0.02418 | 0.02481 | 0.79918 | 0.81416 | 0.50574 | 0.50088 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United Arab Emirates | 2017-10-13 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 43838 | 43838 | SRR6170098 | SRX3280947 | SRS2591758 | SRP119921 | PRJNA414225 | Differential gene expression in the liver of zebrafish larvae exposed to 1 mM inorganic arsenic from xxx 120 hpf | GSE104953 | Transcriptome Analysis | The goal of this study is to compare gene expression levels in the livers of larval Tgfabp10:nls mcherry exposed to 1 mM inorganic arsenic from xxx 120 hpf to the unexposed siblings. Samples were collected from Tgfabp10:nls mcherry zebrafish larvae that were derived from incrossed parents of the same strain. The background of transgenic lines were typically from mixed outcrosses of the transgenics to AB TAB5 and TAB14 strains when regenerating the lines as the working stocks aged. All samples were collected at approximately 120 hpf natural spawning at 8:30 9:00AM EST on day zero samples were collected at 8 10AM EST on day 5. Overall design: Zebrafish larvae that were untreated control or those exposed to 1 mM inorganic arsenic from 4 hpf 120 hpf were anesthetized and the liver was microdissected from xxx 20 larvae and pooled per treatment group. The transgenic line Tgfabp10:nls mcherry was used to facilitate microdissection of the liver. RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment. Libraries were prepared according to Illumina Truseq RNA sample prep kit version 2 followed by Ribo Zero Gold treatment. | pubmed:29361514 | C1 | GSM2810891 | source name:5dpf embryos liver control|genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:n1 control|tissue:liver | C1 | Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and low quality sequence p 4 e 100 y a m 10 best strata Trimmed read were mapped to GRCz10 whole genome using tophat2 v2.1.0 with parameters no novel juncs G Accepted bam files were used for counting read numbers of each gene with HTSeq s no t exon i gene id Test of differential expression of each genes was implemented by DESeq2 in Bioconductor genes with reads number less than 10 were filtered out Genome build: GRCz10 https://www.ncbi.nlm.nih.gov/grc/zebrafish Supplementary files format and content: .txt file. Reads count of genes | 5dpf embryos liver control | 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol | genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:n1 control|tissue:liver | GSM2810891 | GSM2810891: C1; Danio rerio; RNA Seq | GSM2810891 | 1 | 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol | GEO Accession:GSM2810891 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP119921 | Sample_C1-296_read1.fastq.gz Sample_C1-296_read2.fastq.gz | fastq fastq | 8822209206.0 | 43674303.0 | GSM2810891 r1 | 0:101 1:101 | A:2342189977;C:2066915142;G:2164189762;T:2139380119;N:109534206 | 101 | 101 | 2342189977 | 2066915142 | 2164189762 | 2139380119 | 109534206 | SRX3280947 | SRS2591758 | SRA619573 | GEO | Biology, New York University Abu Dhabi | 2 | 0.92169 | 0.91926 | 0.03524 | 0.03609 | 0.79786 | 0.81266 | 0.50354 | 0.51033 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United Arab Emirates | 2017-10-13 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 43839 | 43839 | SRR6170097 | SRX3280946 | SRS2591755 | SRP119921 | PRJNA414225 | Differential gene expression in the liver of zebrafish larvae exposed to 1 mM inorganic arsenic from xxx 120 hpf | GSE104953 | Transcriptome Analysis | The goal of this study is to compare gene expression levels in the livers of larval Tgfabp10:nls mcherry exposed to 1 mM inorganic arsenic from xxx 120 hpf to the unexposed siblings. Samples were collected from Tgfabp10:nls mcherry zebrafish larvae that were derived from incrossed parents of the same strain. The background of transgenic lines were typically from mixed outcrosses of the transgenics to AB TAB5 and TAB14 strains when regenerating the lines as the working stocks aged. All samples were collected at approximately 120 hpf natural spawning at 8:30 9:00AM EST on day zero samples were collected at 8 10AM EST on day 5. Overall design: Zebrafish larvae that were untreated control or those exposed to 1 mM inorganic arsenic from 4 hpf 120 hpf were anesthetized and the liver was microdissected from xxx 20 larvae and pooled per treatment group. The transgenic line Tgfabp10:nls mcherry was used to facilitate microdissection of the liver. RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment. Libraries were prepared according to Illumina Truseq RNA sample prep kit version 2 followed by Ribo Zero Gold treatment. | pubmed:29361514 | A3 | GSM2810890 | source name:5dpf embryos liver arsenic|genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:1 mM inorganic arsenic|tissue:liver | A3 | Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and low quality sequence p 4 e 100 y a m 10 best strata Trimmed read were mapped to GRCz10 whole genome using tophat2 v2.1.0 with parameters no novel juncs G Accepted bam files were used for counting read numbers of each gene with HTSeq s no t exon i gene id Test of differential expression of each genes was implemented by DESeq2 in Bioconductor genes with reads number less than 10 were filtered out Genome build: GRCz10 https://www.ncbi.nlm.nih.gov/grc/zebrafish Supplementary files format and content: .txt file. Reads count of genes | 5dpf embryos liver arsenic | 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol | genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:1 mM inorganic arsenic|tissue:liver | GSM2810890 | GSM2810890: A3; Danio rerio; RNA Seq | GSM2810890 | 1 | 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol | GEO Accession:GSM2810890 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP119921 | Sample_A3-299_read1.fastq.gz Sample_A3-299_read2.fastq.gz | fastq fastq | 13287203066.0 | 65778233.0 | GSM2810890 r1 | 0:101 1:101 | A:3662325148;C:3087171770;G:3305939687;T:3067414232;N:164352229 | 101 | 101 | 3662325148 | 3087171770 | 3305939687 | 3067414232 | 164352229 | SRX3280946 | SRS2591755 | SRA619573 | GEO | Biology, New York University Abu Dhabi | 2 | 0.92398 | 0.92463 | 0.03399 | 0.03434 | 0.79547 | 0.81044 | 0.52707 | 0.53016 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United Arab Emirates | 2017-10-13 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 43840 | 43840 | SRR6170096 | SRX3280945 | SRS2591757 | SRP119921 | PRJNA414225 | Differential gene expression in the liver of zebrafish larvae exposed to 1 mM inorganic arsenic from xxx 120 hpf | GSE104953 | Transcriptome Analysis | The goal of this study is to compare gene expression levels in the livers of larval Tgfabp10:nls mcherry exposed to 1 mM inorganic arsenic from xxx 120 hpf to the unexposed siblings. Samples were collected from Tgfabp10:nls mcherry zebrafish larvae that were derived from incrossed parents of the same strain. The background of transgenic lines were typically from mixed outcrosses of the transgenics to AB TAB5 and TAB14 strains when regenerating the lines as the working stocks aged. All samples were collected at approximately 120 hpf natural spawning at 8:30 9:00AM EST on day zero samples were collected at 8 10AM EST on day 5. Overall design: Zebrafish larvae that were untreated control or those exposed to 1 mM inorganic arsenic from 4 hpf 120 hpf were anesthetized and the liver was microdissected from xxx 20 larvae and pooled per treatment group. The transgenic line Tgfabp10:nls mcherry was used to facilitate microdissection of the liver. RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment. Libraries were prepared according to Illumina Truseq RNA sample prep kit version 2 followed by Ribo Zero Gold treatment. | pubmed:29361514 | A2 | GSM2810889 | source name:5dpf embryos liver arsenic|genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:1 mM inorganic arsenic|tissue:liver | A2 | Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and low quality sequence p 4 e 100 y a m 10 best strata Trimmed read were mapped to GRCz10 whole genome using tophat2 v2.1.0 with parameters no novel juncs G Accepted bam files were used for counting read numbers of each gene with HTSeq s no t exon i gene id Test of differential expression of each genes was implemented by DESeq2 in Bioconductor genes with reads number less than 10 were filtered out Genome build: GRCz10 https://www.ncbi.nlm.nih.gov/grc/zebrafish Supplementary files format and content: .txt file. Reads count of genes | 5dpf embryos liver arsenic | 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol | genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:1 mM inorganic arsenic|tissue:liver | GSM2810889 | GSM2810889: A2; Danio rerio; RNA Seq | GSM2810889 | 1 | 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol | GEO Accession:GSM2810889 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP119921 | Sample_A2-299_read1.fastq.gz Sample_A2-299_read2.fastq.gz | fastq fastq | 14280123360.0 | 70693680.0 | GSM2810889 r1 | 0:101 1:101 | A:3585176558;C:3480271791;G:3551853285;T:3484955380;N:177866346 | 101 | 101 | 3585176558 | 3480271791 | 3551853285 | 3484955380 | 177866346 | SRX3280945 | SRS2591757 | SRA619573 | GEO | Biology, New York University Abu Dhabi | 2 | 0.93368 | 0.93329 | 0.02628 | 0.02609 | 0.78871 | 0.80215 | 0.53969 | 0.54196 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United Arab Emirates | 2017-10-13 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 43841 | 43841 | SRR6170095 | SRX3280944 | SRS2591756 | SRP119921 | PRJNA414225 | Differential gene expression in the liver of zebrafish larvae exposed to 1 mM inorganic arsenic from xxx 120 hpf | GSE104953 | Transcriptome Analysis | The goal of this study is to compare gene expression levels in the livers of larval Tgfabp10:nls mcherry exposed to 1 mM inorganic arsenic from xxx 120 hpf to the unexposed siblings. Samples were collected from Tgfabp10:nls mcherry zebrafish larvae that were derived from incrossed parents of the same strain. The background of transgenic lines were typically from mixed outcrosses of the transgenics to AB TAB5 and TAB14 strains when regenerating the lines as the working stocks aged. All samples were collected at approximately 120 hpf natural spawning at 8:30 9:00AM EST on day zero samples were collected at 8 10AM EST on day 5. Overall design: Zebrafish larvae that were untreated control or those exposed to 1 mM inorganic arsenic from 4 hpf 120 hpf were anesthetized and the liver was microdissected from xxx 20 larvae and pooled per treatment group. The transgenic line Tgfabp10:nls mcherry was used to facilitate microdissection of the liver. RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment. Libraries were prepared according to Illumina Truseq RNA sample prep kit version 2 followed by Ribo Zero Gold treatment. | pubmed:29361514 | A1 | GSM2810888 | source name:5dpf embryos liver arsenic|genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:1 mM inorganic arsenic|tissue:liver | A1 | Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and low quality sequence p 4 e 100 y a m 10 best strata Trimmed read were mapped to GRCz10 whole genome using tophat2 v2.1.0 with parameters no novel juncs G Accepted bam files were used for counting read numbers of each gene with HTSeq s no t exon i gene id Test of differential expression of each genes was implemented by DESeq2 in Bioconductor genes with reads number less than 10 were filtered out Genome build: GRCz10 https://www.ncbi.nlm.nih.gov/grc/zebrafish Supplementary files format and content: .txt file. Reads count of genes | 5dpf embryos liver arsenic | 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol | genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:1 mM inorganic arsenic|tissue:liver | GSM2810888 | GSM2810888: A1; Danio rerio; RNA Seq | GSM2810888 | 1 | 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol | GEO Accession:GSM2810888 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP119921 | Sample_A1-296_read1.fastq.gz Sample_A1-296_read2.fastq.gz | fastq fastq | 7384848108.0 | 36558654.0 | GSM2810888 r1 | 0:101 1:101 | A:1929553962;C:1740175990;G:1822053733;T:1801314520;N:91749903 | 101 | 101 | 1929553962 | 1740175990 | 1822053733 | 1801314520 | 91749903 | SRX3280944 | SRS2591756 | SRA619573 | GEO | Biology, New York University Abu Dhabi | 2 | 0.91907 | 0.91541 | 0.03673 | 0.03751 | 0.77962 | 0.79444 | 0.52016 | 0.51802 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United Arab Emirates | 2017-10-13 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 44922 | 44922 | SRR6297670 | SRX3398649 | SRS2692829 | SRP125098 | PRJNA418729 | The CCCH type zinc finger transcription factor Zc3h8 protects hepatocytes from degeneration by repressing the inflammatory response in zebrafish. | GSE106985 | Transcriptome Analysis | Transcriptional profile of hepatocytes during the cq5 mutant liver degeneration middle stage 5.5 dpf and later stage 7.5 dpf. Overall design: Examination of gene expression at two different stages for mutant sample group and wild type control group. | D7.5MUT | GSM2858890 | source name:Hepatocytes|strain:ABGO|tissue:liver|developmental stage:7.5 dpf | D7.5MUT | Raw data were filtered to obtain clean data using Perl scripts. Reference genome and annotations were downloaded from the ENSEMBL website http://www.ensembl.org/index.html. Reference genome library was built using the Bowtie2 v2.2.3 software and clean data was aligned to the library using the TopHat v2.0.12 software. Gene expression levels were calculated by the RPKM method using the HTSeq v0.6.0 software. Genes with P value<0.05 and |log2 ratio|≥1 were identified as differentially expressed genes using the DESeq v1.16.0 software These data were then subject to GO gene ontology http://geneontology.org/ analyses and aligned to KEGG Kyoto Encyclopedia of Genes and Genomes http://www.kegg.jp/ database to build pathway maps. Genome build: zv9 Supplementary files format and content: [rpkm.xls] tab delimited text file includes RPKMs for each Sample. [Table s1.xls] foldChange between developmental stages in each genotype cells. | Hepatocytes | Choose two different stages 5.5 and 7.5 dpf of zc3h8 / mutant and wild type group larves which hepatocytes were markerd by Tglfabp:Dendra2 NTR transgenic line and the zebrafish livers samples were respectively dissected collected and homogenized in 1 ml 0.5% trypsin at 4 °C. The homogenized cell suspension was centrifuged at 1000x g at 4 °C for 5 minutes. Then the supernatant was removed and the cell pellet was resuspended in PBS followed by cell sorting by flow cytometry Moflo XDP Beckman. | Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol. | strain:ABGO|tissue:liver|developmental stage:7.5 dpf | GSM2858890 | GSM2858890: D7.5MUT; Danio rerio; RNA Seq | GSM2858890 | 1 | Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol. | GEO Accession:GSM2858890 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP125098 | D7_5MUT1_R1.fq.gz D7_5MUT1_R2.fq.gz | fastq fastq | 6317511200.0 | 31587556.0 | GSM2858890 r1 | 0:100 1:100 | A:1754225166;C:1427299863;G:1424315769;T:1697747107;N:13923295 | 100 | 100 | 1754225166 | 1427299863 | 1424315769 | 1697747107 | 13923295 | SRX3398649 | SRS2692829 | SRA631311 | GEO | Southwest university | 2 | 0.85186 | 0.83894 | 0.11172 | 0.10823 | 0.82731 | 0.82852 | 0.60784 | 0.60651 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | China | 2017-11-16 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 44923 | 44923 | SRR6297669 | SRX3398648 | SRS2692828 | SRP125098 | PRJNA418729 | The CCCH type zinc finger transcription factor Zc3h8 protects hepatocytes from degeneration by repressing the inflammatory response in zebrafish. | GSE106985 | Transcriptome Analysis | Transcriptional profile of hepatocytes during the cq5 mutant liver degeneration middle stage 5.5 dpf and later stage 7.5 dpf. Overall design: Examination of gene expression at two different stages for mutant sample group and wild type control group. | D7.5WT | GSM2858889 | source name:Hepatocytes|strain:ABGO|tissue:liver|developmental stage:7.5 dpf | D7.5WT | Raw data were filtered to obtain clean data using Perl scripts. Reference genome and annotations were downloaded from the ENSEMBL website http://www.ensembl.org/index.html. Reference genome library was built using the Bowtie2 v2.2.3 software and clean data was aligned to the library using the TopHat v2.0.12 software. Gene expression levels were calculated by the RPKM method using the HTSeq v0.6.0 software. Genes with P value<0.05 and |log2 ratio|≥1 were identified as differentially expressed genes using the DESeq v1.16.0 software These data were then subject to GO gene ontology http://geneontology.org/ analyses and aligned to KEGG Kyoto Encyclopedia of Genes and Genomes http://www.kegg.jp/ database to build pathway maps. Genome build: zv9 Supplementary files format and content: [rpkm.xls] tab delimited text file includes RPKMs for each Sample. [Table s1.xls] foldChange between developmental stages in each genotype cells. | Hepatocytes | Choose two different stages 5.5 and 7.5 dpf of zc3h8 / mutant and wild type group larves which hepatocytes were markerd by Tglfabp:Dendra2 NTR transgenic line and the zebrafish livers samples were respectively dissected collected and homogenized in 1 ml 0.5% trypsin at 4 °C. The homogenized cell suspension was centrifuged at 1000x g at 4 °C for 5 minutes. Then the supernatant was removed and the cell pellet was resuspended in PBS followed by cell sorting by flow cytometry Moflo XDP Beckman. | Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol. | strain:ABGO|tissue:liver|developmental stage:7.5 dpf | GSM2858889 | GSM2858889: D7.5WT; Danio rerio; RNA Seq | GSM2858889 | 1 | Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol. | GEO Accession:GSM2858889 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP125098 | D7_5WT1_R1.fq.gz D7_5WT1_R2.fq.gz | fastq fastq | 6300586000.0 | 31502930.0 | GSM2858889 r1 | SRX3398648 | SRS2692828 | SRA631311 | GEO | Southwest university | 2 | 0.86687 | 0.85977 | 0.07521 | 0.07369 | 0.85871 | 0.85888 | 0.5932 | 0.59571 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | China | 2017-11-16 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||||||||||||
| 44924 | 44924 | SRR6297668 | SRX3398647 | SRS2692827 | SRP125098 | PRJNA418729 | The CCCH type zinc finger transcription factor Zc3h8 protects hepatocytes from degeneration by repressing the inflammatory response in zebrafish. | GSE106985 | Transcriptome Analysis | Transcriptional profile of hepatocytes during the cq5 mutant liver degeneration middle stage 5.5 dpf and later stage 7.5 dpf. Overall design: Examination of gene expression at two different stages for mutant sample group and wild type control group. | D5.5MUT | GSM2858888 | source name:Hepatocytes|strain:ABGO|tissue:liver|developmental stage:5.5 dpf | D5.5MUT | Raw data were filtered to obtain clean data using Perl scripts. Reference genome and annotations were downloaded from the ENSEMBL website http://www.ensembl.org/index.html. Reference genome library was built using the Bowtie2 v2.2.3 software and clean data was aligned to the library using the TopHat v2.0.12 software. Gene expression levels were calculated by the RPKM method using the HTSeq v0.6.0 software. Genes with P value<0.05 and |log2 ratio|≥1 were identified as differentially expressed genes using the DESeq v1.16.0 software These data were then subject to GO gene ontology http://geneontology.org/ analyses and aligned to KEGG Kyoto Encyclopedia of Genes and Genomes http://www.kegg.jp/ database to build pathway maps. Genome build: zv9 Supplementary files format and content: [rpkm.xls] tab delimited text file includes RPKMs for each Sample. [Table s1.xls] foldChange between developmental stages in each genotype cells. | Hepatocytes | Choose two different stages 5.5 and 7.5 dpf of zc3h8 / mutant and wild type group larves which hepatocytes were markerd by Tglfabp:Dendra2 NTR transgenic line and the zebrafish livers samples were respectively dissected collected and homogenized in 1 ml 0.5% trypsin at 4 °C. The homogenized cell suspension was centrifuged at 1000x g at 4 °C for 5 minutes. Then the supernatant was removed and the cell pellet was resuspended in PBS followed by cell sorting by flow cytometry Moflo XDP Beckman. | Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol. | strain:ABGO|tissue:liver|developmental stage:5.5 dpf | GSM2858888 | GSM2858888: D5.5MUT; Danio rerio; RNA Seq | GSM2858888 | 1 | Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol. | GEO Accession:GSM2858888 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP125098 | D5_5MUT1_R1.fq.gz D5_5MUT1_R2.fq.gz | fastq fastq | 6393315400.0 | 31966577.0 | GSM2858888 r1 | 0:100 1:100 | A:1762470726;C:1454470731;G:1456571327;T:1712530332;N:7272284 | 100 | 100 | 1762470726 | 1454470731 | 1456571327 | 1712530332 | 7272284 | SRX3398647 | SRS2692827 | SRA631311 | GEO | Southwest university | 2 | 0.86434 | 0.86515 | 0.06559 | 0.06514 | 0.84315 | 0.84275 | 0.57299 | 0.44229 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | China | 2017-11-16 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 44925 | 44925 | SRR6297667 | SRX3398646 | SRS2692826 | SRP125098 | PRJNA418729 | The CCCH type zinc finger transcription factor Zc3h8 protects hepatocytes from degeneration by repressing the inflammatory response in zebrafish. | GSE106985 | Transcriptome Analysis | Transcriptional profile of hepatocytes during the cq5 mutant liver degeneration middle stage 5.5 dpf and later stage 7.5 dpf. Overall design: Examination of gene expression at two different stages for mutant sample group and wild type control group. | D5.5WT | GSM2858887 | source name:Hepatocytes|strain:ABGO|tissue:liver|developmental stage:5.5 dpf | D5.5WT | Raw data were filtered to obtain clean data using Perl scripts. Reference genome and annotations were downloaded from the ENSEMBL website http://www.ensembl.org/index.html. Reference genome library was built using the Bowtie2 v2.2.3 software and clean data was aligned to the library using the TopHat v2.0.12 software. Gene expression levels were calculated by the RPKM method using the HTSeq v0.6.0 software. Genes with P value<0.05 and |log2 ratio|≥1 were identified as differentially expressed genes using the DESeq v1.16.0 software These data were then subject to GO gene ontology http://geneontology.org/ analyses and aligned to KEGG Kyoto Encyclopedia of Genes and Genomes http://www.kegg.jp/ database to build pathway maps. Genome build: zv9 Supplementary files format and content: [rpkm.xls] tab delimited text file includes RPKMs for each Sample. [Table s1.xls] foldChange between developmental stages in each genotype cells. | Hepatocytes | Choose two different stages 5.5 and 7.5 dpf of zc3h8 / mutant and wild type group larves which hepatocytes were markerd by Tglfabp:Dendra2 NTR transgenic line and the zebrafish livers samples were respectively dissected collected and homogenized in 1 ml 0.5% trypsin at 4 °C. The homogenized cell suspension was centrifuged at 1000x g at 4 °C for 5 minutes. Then the supernatant was removed and the cell pellet was resuspended in PBS followed by cell sorting by flow cytometry Moflo XDP Beckman. | Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol. | strain:ABGO|tissue:liver|developmental stage:5.5 dpf | GSM2858887 | GSM2858887: D5.5WT; Danio rerio; RNA Seq | GSM2858887 | 1 | Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol. | GEO Accession:GSM2858887 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP125098 | D5_5WT1_R1.fq.gz D5_5WT1_R2.fq.gz | fastq fastq | 8603691600.0 | 43018458.0 | GSM2858887 r1 | 0:100 1:100 | A:2356107531;C:1974663463;G:1971836234;T:2292265726;N:8818646 | 100 | 100 | 2356107531 | 1974663463 | 1971836234 | 2292265726 | 8818646 | SRX3398646 | SRS2692826 | SRA631311 | GEO | Southwest university | 2 | 0.92814 | 0.92445 | 0.06252 | 0.06384 | 0.82873 | 0.82911 | 0.57879 | 0.57933 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | sc | single_cell_plate | smartseq | China | 2017-11-16 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 52231 | 52231 | SRR13912630 | SRX10292187 | SRS8427102 | SRP195753 | PRJNA541476 | Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf | GSE130800 | Transcriptome Analysis | Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina | parent bioproject:PRJNA541472 | 78 hpf liver from sibling of transgenics overexpressing nAtf6 Clutch 1 | GSM5145706 | tissue:Liver|genotype:Tgfabp10a:CAAX EGFP; Tgfabp10:nAtf6 mcherry; cmlc2:EGFP C|pool:20 | 78 hpf liver from sibling of transgenics overexpressing nAtf6 Clutch 1 | Illumina Casava software used for basecalling. Sequencing quality was assessed by using MultiQC v1.7 Alignment by HISTA2 with default parameters only paired reads are aligned and multiple alignments are kept Gene expression is counted in the exon of ensemble gene annotation with HTseq in union mode Test of differential expression of Genes or transposonis was implemented by DESeq2 in Bioconductor V4.0.2 Genome build: GRCz10 Supplementary files format and content: csv files for raw reads count of genes | Liver | 20 livers were microdissected and immediately placed into 500 uL of TRIzol Thermo Fisher 15596026. RNA from pooled livers was then extracted per standard TRIzol/Chloroform method and concentrated through isopronanol and resuspended in 20 uL of DNase/RNase free water Thermo Fisher Scientifc.RNA was quantified by Qubit flurometer.Thermo Scientific. The 120 hpf samples were DNAseI treated for 30 minutes at 37°C followed by RNA purification RapidOut DNA Removal Kit–Thermo Fisher Scientific. | Zebrafish larvae were kept in petri dish at a density of 60 larvae/plate in a 10:14 light/dark cycle. | genotype:Tgfabp10a:CAAX EGFP; Tgfabp10:nAtf6 mcherry; cmlc2:EGFP C|pool:20|rna qbit concentrationng/ul:20 | GSM5145706 | GSM5145706: LIV Sibs 1; Danio rerio; RNA Seq | GSM5145706 | 1 | TRIzol/Choloform RNA seq libraries treated with polyA were prepared by Mehar | GEO Accession:GSM5145706 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 550 | SRP195753 | Liv_Natf6_1_S4_read1.fastq.gz Liv_Natf6_1_S4_read2.fastq.gz | fastq fastq | 2582704927.0 | 8953945.0 | GSM5145706 r1 | 0:144.03 1:144.41 | A:676590553;C:621558282;G:621024501;T:663061630;N:469961 | 144 | 144 | 676590553 | 621558282 | 621024501 | 663061630 | 469961 | SRX10292187 | SRS8427102 | SRA883585 | GEO | Biology, New York University Abu Dhabi | 2 | 0.932 | 0.938 | 0.0482 | 0.04905 | 0.75099 | 0.75808 | 0.55706 | 0.54258 | 151 | 150 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | ribozero | bulk | unknown | unknown | United Arab Emirates | 2021-03-09 | Larval | Larval | Liver | Liver and Biliary System | |||||||||||
| 52232 | 52232 | SRR9022958 | SRX5800872 | SRS4730904 | SRP195753 | PRJNA541476 | Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf | GSE130800 | Transcriptome Analysis | Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina | parent bioproject:PRJNA541472 | sibslivr2: 5 dpf Livers non transgenic siblings 2 | GSM3754094 | source name:liver/pooled|tissue:pooled liver|genotype/variation:WT | sibslivr2: 5 dpf Livers non transgenic siblings 2 | Illumina Casava1.8 software used for basecalling. The raw reads were quality assessed using FastQC v0.11.5. The raw reads were then quality trimmed using Trimmomatic trimmomatic adapter.fa:2:30:10 TRAILING:3 LEADING:3 SLIDINGWINDOW:4:15 MINLEN:36 Alignments of trimmed reads were performed using tophat2 v2.1.0 with the parameters “–no novel junctions” and “–G” Accepted bam files were used for counting gene read numbers with HTSeq a 10 s no Test of differential expression of each transposonis was implemented by DESeq2 in Bioconductor Genome build: GRCz10 Supplementary files format and content: .txt Reads count of genes | liver/pooled | Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 | tissue:pooled liver|genotype/variation:WT | GSM3754094 | GSM3754094: sibslivr2: 5 dpf Livers non transgenic siblings 2; Danio rerio; RNA Seq | GSM3754094 | 1 | Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 | GEO Accession:GSM3754094 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP195753 | Sample_sibslivr2_read2.fastq.gz Sample_sibslivr2_read1.fastq.gz | fastq fastq | 6668700740.0 | 33013370.0 | GSM3754094 r1 | 0:101 1:101 | A:1776745925;C:1552207841;G:1534346043;T:1799762965;N:5637966 | 101 | 101 | 1776745925 | 1552207841 | 1534346043 | 1799762965 | 5637966 | SRX5800872 | SRS4730904 | SRA883585 | GEO | Biology, New York University Abu Dhabi | 2 | 0.9218 | 0.91989 | 0.21964 | 0.21932 | 0.80424 | 0.80641 | 0.60361 | 0.60234 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | ribozero | bulk | unknown | unknown | United Arab Emirates | 2019-05-07 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 52233 | 52233 | SRR9022957 | SRX5800871 | SRS4730903 | SRP195753 | PRJNA541476 | Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf | GSE130800 | Transcriptome Analysis | Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina | parent bioproject:PRJNA541472 | sibslivr1: 5 dpf Livers non transgenic siblings 1 | GSM3754093 | source name:liver/pooled|tissue:pooled liver|genotype/variation:WT | sibslivr1: 5 dpf Livers non transgenic siblings 1 | Illumina Casava1.8 software used for basecalling. The raw reads were quality assessed using FastQC v0.11.5. The raw reads were then quality trimmed using Trimmomatic trimmomatic adapter.fa:2:30:10 TRAILING:3 LEADING:3 SLIDINGWINDOW:4:15 MINLEN:36 Alignments of trimmed reads were performed using tophat2 v2.1.0 with the parameters “–no novel junctions” and “–G” Accepted bam files were used for counting gene read numbers with HTSeq a 10 s no Test of differential expression of each transposonis was implemented by DESeq2 in Bioconductor Genome build: GRCz10 Supplementary files format and content: .txt Reads count of genes | liver/pooled | Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 | tissue:pooled liver|genotype/variation:WT | GSM3754093 | GSM3754093: sibslivr1: 5 dpf Livers non transgenic siblings 1; Danio rerio; RNA Seq | GSM3754093 | 1 | Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 | GEO Accession:GSM3754093 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP195753 | Sample_sibslivr1_read1.fastq.gz Sample_sibslivr1_read2.fastq.gz | fastq fastq | 6725147216.0 | 33292808.0 | GSM3754093 r1 | 0:101 1:101 | A:1807945249;C:1550856849;G:1534573991;T:1826050327;N:5720800 | 101 | 101 | 1807945249 | 1550856849 | 1534573991 | 1826050327 | 5720800 | SRX5800871 | SRS4730903 | SRA883585 | GEO | Biology, New York University Abu Dhabi | 2 | 0.90678 | 0.9037 | 0.2571 | 0.25652 | 0.76278 | 0.76577 | 0.58002 | 0.58511 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | ribozero | bulk | unknown | unknown | United Arab Emirates | 2019-05-07 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 52234 | 52234 | SRR9022962 | SRX5800870 | SRS4730902 | SRP195753 | PRJNA541476 | Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf | GSE130800 | Transcriptome Analysis | Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina | parent bioproject:PRJNA541472 | nATF63: 5 dpf Livers of ATF6 transgenic zebrafish 3 | GSM3754098 | source name:liver/pooled|tissue:pooled liver|genotype/variation:ATF6 transgenic | nATF63: 5 dpf Livers of ATF6 transgenic zebrafish 3 | Illumina Casava1.8 software used for basecalling. The raw reads were quality assessed using FastQC v0.11.5. The raw reads were then quality trimmed using Trimmomatic trimmomatic adapter.fa:2:30:10 TRAILING:3 LEADING:3 SLIDINGWINDOW:4:15 MINLEN:36 Alignments of trimmed reads were performed using tophat2 v2.1.0 with the parameters “–no novel junctions” and “–G” Accepted bam files were used for counting gene read numbers with HTSeq a 10 s no Test of differential expression of each transposonis was implemented by DESeq2 in Bioconductor Genome build: GRCz10 Supplementary files format and content: .txt Reads count of genes | liver/pooled | Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 | tissue:pooled liver|genotype/variation:ATF6 transgenic | GSM3754098 | GSM3754098: nATF63: 5 dpf Livers of ATF6 transgenic zebrafish 3; Danio rerio; RNA Seq | GSM3754098 | 1 | Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 | GEO Accession:GSM3754098 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP195753 | Sample_nATf6livr3_read1.fastq.gz Sample_nATf6livr3_read2.fastq.gz | fastq fastq | 7130808262.0 | 35301031.0 | GSM3754098 r1 | 0:101 1:101 | A:1932123103;C:1630530590;G:1610405576;T:1951735071;N:6013922 | 101 | 101 | 1932123103 | 1630530590 | 1610405576 | 1951735071 | 6013922 | SRX5800870 | SRS4730902 | SRA883585 | GEO | Biology, New York University Abu Dhabi | 2 | 0.92219 | 0.92075 | 0.23152 | 0.23034 | 0.76921 | 0.77082 | 0.57948 | 0.56906 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | ribozero | bulk | unknown | unknown | United Arab Emirates | 2019-05-07 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 52235 | 52235 | SRR9022961 | SRX5800869 | SRS4730901 | SRP195753 | PRJNA541476 | Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf | GSE130800 | Transcriptome Analysis | Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina | parent bioproject:PRJNA541472 | nATF62: 5 dpf Livers of ATF6 transgenic zebrafish 2 | GSM3754097 | source name:liver/pooled|tissue:pooled liver|genotype/variation:ATF6 transgenic | nATF62: 5 dpf Livers of ATF6 transgenic zebrafish 2 | Illumina Casava1.8 software used for basecalling. The raw reads were quality assessed using FastQC v0.11.5. The raw reads were then quality trimmed using Trimmomatic trimmomatic adapter.fa:2:30:10 TRAILING:3 LEADING:3 SLIDINGWINDOW:4:15 MINLEN:36 Alignments of trimmed reads were performed using tophat2 v2.1.0 with the parameters “–no novel junctions” and “–G” Accepted bam files were used for counting gene read numbers with HTSeq a 10 s no Test of differential expression of each transposonis was implemented by DESeq2 in Bioconductor Genome build: GRCz10 Supplementary files format and content: .txt Reads count of genes | liver/pooled | Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 | tissue:pooled liver|genotype/variation:ATF6 transgenic | GSM3754097 | GSM3754097: nATF62: 5 dpf Livers of ATF6 transgenic zebrafish 2; Danio rerio; RNA Seq | GSM3754097 | 1 | Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 | GEO Accession:GSM3754097 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP195753 | Sample_nATf6livr2_read2.fastq.gz Sample_nATf6livr2_read1.fastq.gz | fastq fastq | 5486331312.0 | 27160056.0 | GSM3754097 r1 | 0:101 1:101 | A:1493169496;C:1246316651;G:1231427098;T:1510719043;N:4699024 | 101 | 101 | 1493169496 | 1246316651 | 1231427098 | 1510719043 | 4699024 | SRX5800869 | SRS4730901 | SRA883585 | GEO | Biology, New York University Abu Dhabi | 2 | 0.92507 | 0.92307 | 0.23526 | 0.23571 | 0.77037 | 0.77309 | 0.57584 | 0.57036 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | ribozero | bulk | unknown | unknown | United Arab Emirates | 2019-05-07 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 52236 | 52236 | SRR9022960 | SRX5800868 | SRS4730900 | SRP195753 | PRJNA541476 | Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf | GSE130800 | Transcriptome Analysis | Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina | parent bioproject:PRJNA541472 | nATF61: 5 dpf Livers of ATF6 transgenic zebrafish 1 | GSM3754096 | source name:liver/pooled|tissue:pooled liver|genotype/variation:ATF6 transgenic | nATF61: 5 dpf Livers of ATF6 transgenic zebrafish 1 | Illumina Casava1.8 software used for basecalling. The raw reads were quality assessed using FastQC v0.11.5. The raw reads were then quality trimmed using Trimmomatic trimmomatic adapter.fa:2:30:10 TRAILING:3 LEADING:3 SLIDINGWINDOW:4:15 MINLEN:36 Alignments of trimmed reads were performed using tophat2 v2.1.0 with the parameters “–no novel junctions” and “–G” Accepted bam files were used for counting gene read numbers with HTSeq a 10 s no Test of differential expression of each transposonis was implemented by DESeq2 in Bioconductor Genome build: GRCz10 Supplementary files format and content: .txt Reads count of genes | liver/pooled | Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 | tissue:pooled liver|genotype/variation:ATF6 transgenic | GSM3754096 | GSM3754096: nATF61: 5 dpf Livers of ATF6 transgenic zebrafish 1; Danio rerio; RNA Seq | GSM3754096 | 1 | Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 | GEO Accession:GSM3754096 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP195753 | Sample_nATf6lvr1_read1.fastq.gz Sample_nATf6lvr1_read2.fastq.gz | fastq fastq | 5630223992.0 | 27872396.0 | GSM3754096 r1 | 0:101 1:101 | A:1522612856;C:1288278884;G:1272888351;T:1541688412;N:4755489 | 101 | 101 | 1522612856 | 1288278884 | 1272888351 | 1541688412 | 4755489 | SRX5800868 | SRS4730900 | SRA883585 | GEO | Biology, New York University Abu Dhabi | 2 | 0.92611 | 0.92447 | 0.2306 | 0.23075 | 0.77197 | 0.77327 | 0.59605 | 0.58935 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | ribozero | bulk | unknown | unknown | United Arab Emirates | 2019-05-07 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 52237 | 52237 | SRR9022959 | SRX5800867 | SRS4730899 | SRP195753 | PRJNA541476 | Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf | GSE130800 | Transcriptome Analysis | Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina | parent bioproject:PRJNA541472 | sibslivr3: 5 dpf Livers non transgenic siblings 3 | GSM3754095 | source name:liver/pooled|tissue:pooled liver|genotype/variation:WT | sibslivr3: 5 dpf Livers non transgenic siblings 3 | Illumina Casava1.8 software used for basecalling. The raw reads were quality assessed using FastQC v0.11.5. The raw reads were then quality trimmed using Trimmomatic trimmomatic adapter.fa:2:30:10 TRAILING:3 LEADING:3 SLIDINGWINDOW:4:15 MINLEN:36 Alignments of trimmed reads were performed using tophat2 v2.1.0 with the parameters “–no novel junctions” and “–G” Accepted bam files were used for counting gene read numbers with HTSeq a 10 s no Test of differential expression of each transposonis was implemented by DESeq2 in Bioconductor Genome build: GRCz10 Supplementary files format and content: .txt Reads count of genes | liver/pooled | Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 | tissue:pooled liver|genotype/variation:WT | GSM3754095 | GSM3754095: sibslivr3: 5 dpf Livers non transgenic siblings 3; Danio rerio; RNA Seq | GSM3754095 | 1 | Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 | GEO Accession:GSM3754095 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP195753 | Sample_sibsliver3_read1.fastq.gz Sample_sibsliver3_read2.fastq.gz | fastq fastq | 6850257532.0 | 33912166.0 | GSM3754095 r1 | 0:101 1:101 | A:1828622009;C:1589528833;G:1578789352;T:1847472374;N:5844964 | 101 | 101 | 1828622009 | 1589528833 | 1578789352 | 1847472374 | 5844964 | SRX5800867 | SRS4730899 | SRA883585 | GEO | Biology, New York University Abu Dhabi | 2 | 0.90629 | 0.9034 | 0.25074 | 0.24972 | 0.76266 | 0.7657 | 0.56281 | 0.56537 | 101 | 101 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | ribozero | bulk | unknown | unknown | United Arab Emirates | 2019-05-07 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||||
| 55264 | 55264 | SRR10210692 | SRX6930433 | SRS5460728 | SRP223875 | PRJNA575225 | Biliary Atresia associated Mannosidase 1 alpha 2 gene regulates biliary and ciliary morphogenesis and laterality zebrafish | GSE138251 | Transcriptome Analysis | The effect of MAN1A2 on biliary morphogenesis left right patterning and ciliogenesis was evaluated with knockdown in zebrafish and subsequent RNAseq experiment/analysis. Overall design: Total RNA sequencing protocol was performed on pooled liver tissue from all three batches one from controls and one from man1a2 morphant zebrafish. Each pool consisted of 100 livers from three batches of zebrafish larvae at 5 dpf | pubmed:33192543 | Pooled MAN1A2 RNA seq | GSM4103428 | source name:liver tissue|tissue:liver|condition:MAN1A2 knockdown|developmental stage:Larvae at 5 dpf | Pooled MAN1A2 RNA seq | The quality of the sequencing reads was verified using FastQC. Omicsoft Sequence Aligner 2 was used to align the sequencing reads to Zebrafish genome. DEseq2 R package for RNAseq data was used for differential analysis. Genome build: GRCz10 Supplementary files format and content: For each processed data file there are 2 columns: the first column being Ensembl gene ID and the second column being raw read counts. | liver tissue | arf6 ATG MO 5’ GATCTTGGAAAGCATCTTCCCCATG 3’ man1a2 ATG MO 5’ CCGGCGTGGTCATATTTTGATGATC 3’ and man1a2 splicing MO 5’ AAGAATGTAAACTCACCTCTCTGAT 3’ were purchased from Gene Tools LLC. Embryos were injected at the one cell stage with man1a2 ATG MO 1.5 or 4.5 ng man1a2 splicing MO 5 or 7.5 ng or arf6 ATG MO 0.5 ng. | Total RNA was extracted from three different batches of 100 livers of uninjected control and man1a2 MO injected larvae at xxx dpf by using RNeasy Mini Kit. The pooled RNA was used to generate mRNA sequencing libraries using Illumina TruSeq Stranded mRNA sample preparation kit. Poly A containing mRNA molecules were purified using poly T oligo attached magnetic beads mRNA fragmented into small pieces using divalent cations and copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by using dUTP in the Second Strand Marking Mix followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. These cDNA fragments were ligated to single 'A' base and adapter then purified and enriched with PCR to create the final cDNA libraries. | Embryos and adult fish were raised and maintained under standard laboratory conditions. We used the following transgenic lines: Tgdusp6:d2EGFPpt6 10 Tgkrt18:EGFPp314 11 TgEPV.Tp1 Mmu.Hbb:EGFPum14 12 TgEPV.Tp1 Mmu.Hbb:hist2h2l mCherrys939 13 and Tgfabp10a:DsRed ela3l:EGFPgz15 14 [the last three referred to here as TgTp1:GFP TgTp1:H2B mCherry and Tgfabp10a:DsRed respectively]. | tissue:liver|condition:MAN1A2 knockdown|developmental stage:Larvae at 5 dpf | GSM4103428 | GSM4103428: Pooled MAN1A2 RNA seq; Danio rerio; RNA Seq | GSM4103428 | 1 | Total RNA was extracted from three different batches of 100 livers of uninjected control and man1a2 MO injected larvae at xxx dpf by using RNeasy Mini Kit. The pooled RNA was used to generate mRNA sequencing libraries using Illumina TruSeq Stranded mRNA sample preparation kit. Poly A containing mRNA molecules were purified using poly T oligo attached magnetic beads mRNA fragmented into small pieces using divalent cations and copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by using dUTP in the Second Strand Marking Mix followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. These cDNA fragments were ligated to single 'A' base and adapter then purified and enriched with PCR to create the final cDNA libraries. | GEO Accession:GSM4103428 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP223875 | dr_man1a2_m_S16_all_R1_001.fastq.gz dr_man1a2_m_S16_all_R2_001.fastq.gz | fastq fastq | 5936191400.0 | 29680957.0 | GSM4103428 r1 | 0:100 1:100 | A:1578413598;C:1390775252;G:1427068571;T:1535244145;N:4689834 | 100 | 100 | 1578413598 | 1390775252 | 1427068571 | 1535244145 | 4689834 | SRX6930433 | SRS5460728 | SRA970723 | GEO | Systems Biology, Bioengineering, UCSD | 2 | 0.95924 | 0.8982 | 0.03926 | 0.03468 | 0.79622 | 0.80925 | 0.49947 | 0.48222 | 100 | 100 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | trueseq | bulk | unknown | unknown | United States | 2019-10-01 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||
| 55265 | 55265 | SRR10210691 | SRX6930432 | SRS5460727 | SRP223875 | PRJNA575225 | Biliary Atresia associated Mannosidase 1 alpha 2 gene regulates biliary and ciliary morphogenesis and laterality zebrafish | GSE138251 | Transcriptome Analysis | The effect of MAN1A2 on biliary morphogenesis left right patterning and ciliogenesis was evaluated with knockdown in zebrafish and subsequent RNAseq experiment/analysis. Overall design: Total RNA sequencing protocol was performed on pooled liver tissue from all three batches one from controls and one from man1a2 morphant zebrafish. Each pool consisted of 100 livers from three batches of zebrafish larvae at 5 dpf | pubmed:33192543 | Pooled control RNA seq | GSM4103427 | source name:liver tissue|tissue:liver|condition:Normal|developmental stage:Larvae at 5 dpf | Pooled control RNA seq | The quality of the sequencing reads was verified using FastQC. Omicsoft Sequence Aligner 2 was used to align the sequencing reads to Zebrafish genome. DEseq2 R package for RNAseq data was used for differential analysis. Genome build: GRCz10 Supplementary files format and content: For each processed data file there are 2 columns: the first column being Ensembl gene ID and the second column being raw read counts. | liver tissue | arf6 ATG MO 5’ GATCTTGGAAAGCATCTTCCCCATG 3’ man1a2 ATG MO 5’ CCGGCGTGGTCATATTTTGATGATC 3’ and man1a2 splicing MO 5’ AAGAATGTAAACTCACCTCTCTGAT 3’ were purchased from Gene Tools LLC. Embryos were injected at the one cell stage with man1a2 ATG MO 1.5 or 4.5 ng man1a2 splicing MO 5 or 7.5 ng or arf6 ATG MO 0.5 ng. | Total RNA was extracted from three different batches of 100 livers of uninjected control and man1a2 MO injected larvae at xxx dpf by using RNeasy Mini Kit. The pooled RNA was used to generate mRNA sequencing libraries using Illumina TruSeq Stranded mRNA sample preparation kit. Poly A containing mRNA molecules were purified using poly T oligo attached magnetic beads mRNA fragmented into small pieces using divalent cations and copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by using dUTP in the Second Strand Marking Mix followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. These cDNA fragments were ligated to single 'A' base and adapter then purified and enriched with PCR to create the final cDNA libraries. | Embryos and adult fish were raised and maintained under standard laboratory conditions. We used the following transgenic lines: Tgdusp6:d2EGFPpt6 10 Tgkrt18:EGFPp314 11 TgEPV.Tp1 Mmu.Hbb:EGFPum14 12 TgEPV.Tp1 Mmu.Hbb:hist2h2l mCherrys939 13 and Tgfabp10a:DsRed ela3l:EGFPgz15 14 [the last three referred to here as TgTp1:GFP TgTp1:H2B mCherry and Tgfabp10a:DsRed respectively]. | tissue:liver|condition:Normal|developmental stage:Larvae at 5 dpf | GSM4103427 | GSM4103427: Pooled control RNA seq; Danio rerio; RNA Seq | GSM4103427 | 1 | Total RNA was extracted from three different batches of 100 livers of uninjected control and man1a2 MO injected larvae at xxx dpf by using RNeasy Mini Kit. The pooled RNA was used to generate mRNA sequencing libraries using Illumina TruSeq Stranded mRNA sample preparation kit. Poly A containing mRNA molecules were purified using poly T oligo attached magnetic beads mRNA fragmented into small pieces using divalent cations and copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by using dUTP in the Second Strand Marking Mix followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. These cDNA fragments were ligated to single 'A' base and adapter then purified and enriched with PCR to create the final cDNA libraries. | GEO Accession:GSM4103427 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP223875 | dr_control_S15_all_R2_001.fastq.gz dr_control_S15_all_R1_001.fastq.gz | fastq fastq | 6246641800.0 | 31233209.0 | GSM4103427 r1 | 0:100 1:100 | A:1630491563;C:1497737062;G:1532797800;T:1580737839;N:4877536 | 100 | 100 | 1630491563 | 1497737062 | 1532797800 | 1580737839 | 4877536 | SRX6930432 | SRS5460727 | SRA970723 | GEO | Systems Biology, Bioengineering, UCSD | 2 | 0.96082 | 0.96474 | 0.05307 | 0.05238 | 0.80164 | 0.80846 | 0.50767 | 0.5068 | 100 | 100 | B | B | biological fallback assumption | illumina | nextseq | unknown | poly_a | trueseq | bulk | unknown | unknown | United States | 2019-10-01 | Larval | Larval | Liver | Liver and Biliary System | ||||||||||
| 56826 | 56826 | SRR11114801 | SRX7751804 | SRS6171095 | SRP250035 | PRJNA607563 | Transcriptomic profile of zebrafish liver cells in thioacetamide TAA model | GSE145564 | Transcriptome Analysis | Zebrafish transgenic lines Tgfabp10a:dsRed Tghand2:EGFP and Tgkdrl:ras mCherry in AB wild type background were anesthetized with MS 222 and adult females were injected intraperitoneally with 500 mg/kg thioacetamide TAA or sterile water as a control 6 times over the course of 2 weeks. We have characterized transcriptomic profiles of FACS isolated hepatocytes dsRed+ stellate cells EGFP+ and liver endothelial cells mCherry+ from fishes treated with TAA or sterile water. Cells negative for the fluorescence were used as a control. Overall design: Examination of transcriptomic profile of zebrafish hepatocytes stellate cells and liver enothelial cells treated with thioacetamide TAA and control sterile water cell specific reporters: fabp = hep hepatocytes hand = hsc hepatic stellate cells kdlr = ec endothelial cells | parent bioproject:PRJNA607562 | pubmed:34920711 | RNA kdlr pos 3 TAA | GSM4321576 | tissue:FACS sorted liver cells|treatment:TAA|genetic background:AB|genotype:Tgkdrl:ras mCherry|fluorescence:mCherry positive|Sex:female|cell type:FACS sorted liver cells | RNA kdlr pos 3 TAA | Raw RNA seq and ATAC seq reads were quality checked using Fastqc 0.11.8 Adapters were removed using Cutadapt 1.18 Reads quality filtering was performed using SAMtools 1.9 RNA seq reads were aligned to the zebrafish reference genome GRCz11 using STAR 2.6 Gene counts were calculated by using R GenomicRanges Bioconductor package and tranformed to regularized logarithm DESeq2 Bioconductor package Genome build: GRCz11 Supplementary files format and content: comma separated file containing normalized read counts rlog of Ensembl annotated genes organized in columns for each sample separately | FACS sorted liver cells | Adult females were anesthetized with MS 222 Sigma Aldrich Germany as previously described and injected intraperitoneally with 500 mg/kg thioacetamide TAA or sterile water as a control 6 times over the course of 2 weeks. | For RNA sequencing 100 000 of fluorescent liver cells were sorted directly to TRIzol LS Thermo Fisher Scientific USA. post ethanol precipitation RNA was depleted of DNA by using DNase I treatment and purified on columns by using RNA Clean & Concentrator™ 5 Zymo Research USA Sequencing libraries were performed from total RNA by using SMARTer low input RNA Kit Clontech according to manufacturer protocol. | Zebrafish transgenic lines Tgfabp10a:dsRed Tghand2:EGFP and Tgkdrl:ras mCherry in AB wild type background were maintained in the IIMCB zebrafish facility License no. PL14656251 according to standard procedures. | treatment:TAA|genetic background:AB|genotype:Tgkdrl:ras mCherry|fluorescence:mCherry positive|Sex:female|cell type:FACS sorted liver cells | GSM4321576 | GSM4321576: RNA kdlr pos 3 TAA; Danio rerio; RNA Seq | GSM4321576 | 1 | For RNA sequencing 100 000 of fluorescent liver cells were sorted directly to TRIzol LS Thermo Fisher Scientific USA. post ethanol precipitation RNA was depleted of DNA by using DNase I treatment and purified on columns by using RNA Clean & Concentrator™ 5 Zymo Research USA Sequencing libraries were performed from total RNA by using SMARTer low input RNA Kit Clontech according to manufacturer protocol. | GEO Accession:GSM4321576 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP250035 | RNA_kdlr_pos_3_TAA_R2.fastq.gz RNA_kdlr_pos_3_TAA_R1.fastq.gz | fastq fastq | 6811611264.0 | 44813232.0 | GSM4321576 r1 | 0:76 1:76 | A:1225138550;C:2147122785;G:2282464539;T:1155950193;N:935197 | 76 | 76 | 1225138550 | 2147122785 | 2282464539 | 1155950193 | 935197 | SRX7751804 | SRS6171095 | SRA1044822 | GEO | Zebrafish Developmental Genomics Lab, International Institute of Molecular and Cell Biology | 2 | 0.9507 | 0.95579 | 0.08932 | 0.08493 | 0.94371 | 0.96053 | 0.57322 | 0.60678 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | Poland | 2020-02-19 | Larval | Larval | Liver | Liver and Biliary System | |||||||||
| 56827 | 56827 | SRR11114800 | SRX7751803 | SRS6171094 | SRP250035 | PRJNA607563 | Transcriptomic profile of zebrafish liver cells in thioacetamide TAA model | GSE145564 | Transcriptome Analysis | Zebrafish transgenic lines Tgfabp10a:dsRed Tghand2:EGFP and Tgkdrl:ras mCherry in AB wild type background were anesthetized with MS 222 and adult females were injected intraperitoneally with 500 mg/kg thioacetamide TAA or sterile water as a control 6 times over the course of 2 weeks. We have characterized transcriptomic profiles of FACS isolated hepatocytes dsRed+ stellate cells EGFP+ and liver endothelial cells mCherry+ from fishes treated with TAA or sterile water. Cells negative for the fluorescence were used as a control. Overall design: Examination of transcriptomic profile of zebrafish hepatocytes stellate cells and liver enothelial cells treated with thioacetamide TAA and control sterile water cell specific reporters: fabp = hep hepatocytes hand = hsc hepatic stellate cells kdlr = ec endothelial cells | parent bioproject:PRJNA607562 | pubmed:34920711 | RNA kdlr pos 3 ctrl | GSM4321575 | tissue:FACS sorted liver cells|treatment:sterile water|genetic background:AB|genotype:Tgkdrl:ras mCherry|fluorescence:mCherry positive|Sex:female|cell type:FACS sorted liver cells | RNA kdlr pos 3 ctrl | Raw RNA seq and ATAC seq reads were quality checked using Fastqc 0.11.8 Adapters were removed using Cutadapt 1.18 Reads quality filtering was performed using SAMtools 1.9 RNA seq reads were aligned to the zebrafish reference genome GRCz11 using STAR 2.6 Gene counts were calculated by using R GenomicRanges Bioconductor package and tranformed to regularized logarithm DESeq2 Bioconductor package Genome build: GRCz11 Supplementary files format and content: comma separated file containing normalized read counts rlog of Ensembl annotated genes organized in columns for each sample separately | FACS sorted liver cells | Adult females were anesthetized with MS 222 Sigma Aldrich Germany as previously described and injected intraperitoneally with 500 mg/kg thioacetamide TAA or sterile water as a control 6 times over the course of 2 weeks. | For RNA sequencing 100 000 of fluorescent liver cells were sorted directly to TRIzol LS Thermo Fisher Scientific USA. post ethanol precipitation RNA was depleted of DNA by using DNase I treatment and purified on columns by using RNA Clean & Concentrator™ 5 Zymo Research USA Sequencing libraries were performed from total RNA by using SMARTer low input RNA Kit Clontech according to manufacturer protocol. | Zebrafish transgenic lines Tgfabp10a:dsRed Tghand2:EGFP and Tgkdrl:ras mCherry in AB wild type background were maintained in the IIMCB zebrafish facility License no. PL14656251 according to standard procedures. | treatment:sterile water|genetic background:AB|genotype:Tgkdrl:ras mCherry|fluorescence:mCherry positive|Sex:female|cell type:FACS sorted liver cells | GSM4321575 | GSM4321575: RNA kdlr pos 3 ctrl; Danio rerio; RNA Seq | GSM4321575 | 1 | For RNA sequencing 100 000 of fluorescent liver cells were sorted directly to TRIzol LS Thermo Fisher Scientific USA. post ethanol precipitation RNA was depleted of DNA by using DNase I treatment and purified on columns by using RNA Clean & Concentrator™ 5 Zymo Research USA Sequencing libraries were performed from total RNA by using SMARTer low input RNA Kit Clontech according to manufacturer protocol. | GEO Accession:GSM4321575 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP250035 | RNA_kdlr_pos_3_ctrl_R2.fastq.gz RNA_kdlr_pos_3_ctrl_R1.fastq.gz | fastq fastq | 4676256819.0 | 31322059.0 | GSM4321575 r1 | 0:74.66 1:74.64 | A:847890577;C:1438938414;G:1559940415;T:829247648;N:239765 | 74 | 74 | 847890577 | 1438938414 | 1559940415 | 829247648 | 239765 | SRX7751803 | SRS6171094 | SRA1044822 | GEO | Zebrafish Developmental Genomics Lab, International Institute of Molecular and Cell Biology | 2 | 0.95001 | 0.96334 | 0.12275 | 0.12123 | 0.86393 | 0.8704 | 0.75026 | 0.75617 | 75 | 73 | B | B | biological fallback assumption | illumina | nextseq | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | Poland | 2020-02-19 | Larval | Larval | Liver | Liver and Biliary System | |||||||||
| 56828 | 56828 | SRR11114799 | SRX7751802 | SRS6171093 | SRP250035 | PRJNA607563 | Transcriptomic profile of zebrafish liver cells in thioacetamide TAA model | GSE145564 | Transcriptome Analysis | Zebrafish transgenic lines Tgfabp10a:dsRed Tghand2:EGFP and Tgkdrl:ras mCherry in AB wild type background were anesthetized with MS 222 and adult females were injected intraperitoneally with 500 mg/kg thioacetamide TAA or sterile water as a control 6 times over the course of 2 weeks. We have characterized transcriptomic profiles of FACS isolated hepatocytes dsRed+ stellate cells EGFP+ and liver endothelial cells mCherry+ from fishes treated with TAA or sterile water. Cells negative for the fluorescence were used as a control. Overall design: Examination of transcriptomic profile of zebrafish hepatocytes stellate cells and liver enothelial cells treated with thioacetamide TAA and control sterile water cell specific reporters: fabp = hep hepatocytes hand = hsc hepatic stellate cells kdlr = ec endothelial cells | parent bioproject:PRJNA607562 | pubmed:34920711 | RNA kdlr pos 2 TAA | GSM4321574 | tissue:FACS sorted liver cells|treatment:TAA|genetic background:AB|genotype:Tgkdrl:ras mCherry|fluorescence:mCherry positive|Sex:female|cell type:FACS sorted liver cells | RNA kdlr pos 2 TAA | Raw RNA seq and ATAC seq reads were quality checked using Fastqc 0.11.8 Adapters were removed using Cutadapt 1.18 Reads quality filtering was performed using SAMtools 1.9 RNA seq reads were aligned to the zebrafish reference genome GRCz11 using STAR 2.6 Gene counts were calculated by using R GenomicRanges Bioconductor package and tranformed to regularized logarithm DESeq2 Bioconductor package Genome build: GRCz11 Supplementary files format and content: comma separated file containing normalized read counts rlog of Ensembl annotated genes organized in columns for each sample separately | FACS sorted liver cells | Adult females were anesthetized with MS 222 Sigma Aldrich Germany as previously described and injected intraperitoneally with 500 mg/kg thioacetamide TAA or sterile water as a control 6 times over the course of 2 weeks. | For RNA sequencing 100 000 of fluorescent liver cells were sorted directly to TRIzol LS Thermo Fisher Scientific USA. post ethanol precipitation RNA was depleted of DNA by using DNase I treatment and purified on columns by using RNA Clean & Concentrator™ 5 Zymo Research USA Sequencing libraries were performed from total RNA by using SMARTer low input RNA Kit Clontech according to manufacturer protocol. | Zebrafish transgenic lines Tgfabp10a:dsRed Tghand2:EGFP and Tgkdrl:ras mCherry in AB wild type background were maintained in the IIMCB zebrafish facility License no. PL14656251 according to standard procedures. | treatment:TAA|genetic background:AB|genotype:Tgkdrl:ras mCherry|fluorescence:mCherry positive|Sex:female|cell type:FACS sorted liver cells | GSM4321574 | GSM4321574: RNA kdlr pos 2 TAA; Danio rerio; RNA Seq | GSM4321574 | 1 | For RNA sequencing 100 000 of fluorescent liver cells were sorted directly to TRIzol LS Thermo Fisher Scientific USA. post ethanol precipitation RNA was depleted of DNA by using DNase I treatment and purified on columns by using RNA Clean & Concentrator™ 5 Zymo Research USA Sequencing libraries were performed from total RNA by using SMARTer low input RNA Kit Clontech according to manufacturer protocol. | GEO Accession:GSM4321574 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP250035 | RNA_kdlr_pos_2_TAA_R1.fastq.gz RNA_kdlr_pos_2_TAA_R2.fastq.gz | fastq fastq | 5569241392.0 | 36639746.0 | GSM4321574 r1 | 0:76 1:76 | A:1021150275;C:1717497658;G:1851818735;T:978010673;N:764051 | 76 | 76 | 1021150275 | 1717497658 | 1851818735 | 978010673 | 764051 | SRX7751802 | SRS6171093 | SRA1044822 | GEO | Zebrafish Developmental Genomics Lab, International Institute of Molecular and Cell Biology | 2 | 0.94843 | 0.95051 | 0.07004 | 0.06371 | 0.92732 | 0.94838 | 0.62057 | 0.63854 | 76 | 76 | B | B | biological fallback assumption | illumina | nextseq | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | Poland | 2020-02-19 | Larval | Larval | Liver | Liver and Biliary System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;