RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

43 rows where devstage_curation = "Larval" and tissue_curation = "Skin"

✎ View and edit SQL

This data as json, CSV (advanced)

technology 4

experiment.library_selection 3

experiment.library_source 2

experiment.library_layout 2

tissue_curation_coarse 1

tissue_curation 1

  • Skin · 43 ✖

experiment.platform 1

experiment.library_strategy 1

devstage_curation_coarse 1

devstage_curation 1

  • Larval · 43 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
36712 36712 SRR835167 SRX271963 SRS416259 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 116h 53 GSM1129625   tissue:melanocytes|hpf dm 116h 53 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129625 GSM1129625: dm 116h 53; Danio rerio; RNA Seq GSM1129625 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129625 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_116h_53_440.fq.bz2 fastq 203842506.0 4853393.0 GSM1129625 r1 0:42 A:49784918;C:48871504;G:45835011;T:59338271;N:12802 42       49784918 48871504 45835011 59338271 12802 SRX271963 SRS416259 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.82741   0.14973   0.84893   0.53644   42   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36713 36713 SRR835166 SRX271962 SRS416258 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 97h 41 440 GSM1129624   tissue:melanocytes|hpf dm 97h 41 440 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129624 GSM1129624: dm 97h 41 440; Danio rerio; RNA Seq GSM1129624 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129624 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_97h_41_440.fq.bz2 fastq 199638768.0 4753304.0 GSM1129624 r1 0:42 A:45958194;C:50367228;G:48451580;T:54849238;N:12528 42       45958194 50367228 48451580 54849238 12528 SRX271962 SRS416258 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.85741   0.09897   0.84112   0.53299   42   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36714 36714 SRR835165 SRX271961 SRS416257 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h FM 351 GSM1129623   tissue:melanocytes|hpf dm 77h FM 351 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129623 GSM1129623: dm 77h FM 351; Danio rerio; RNA Seq GSM1129623 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129623 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_77h_FM_351_ATT.fq.bz2 fastq 194385384.0 5399594.0 GSM1129623 r1 0:36 A:45805148;C:47931006;G:41165284;T:59482433;N:1513 36       45805148 47931006 41165284 59482433 1513 SRX271961 SRS416257 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.77748   0.07764   0.87687   0.51575   36   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36715 36715 SRR835164 SRX271960 SRS416256 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 52 440 GSM1129622   tissue:melanocytes|hpf dm 77h 52 440 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129622 GSM1129622: dm 77h 52 440; Danio rerio; RNA Seq GSM1129622 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129622 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_77h_52_440.fq.bz2 fastq 105047586.0 2501133.0 GSM1129622 r1 0:42 A:24711000;C:26459041;G:24869198;T:29001957;N:6390 42       24711000 26459041 24869198 29001957 6390 SRX271960 SRS416256 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.88862   0.09219   0.83611   0.55476   42   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36716 36716 SRR835163 SRX271959 SRS416255 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 43 440 GSM1129621   tissue:melanocytes|hpf dm 77h 43 440 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129621 GSM1129621: dm 77h 43 440; Danio rerio; RNA Seq GSM1129621 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129621 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_77h_43_440.fq.bz2 fastq 371553084.0 8846502.0 GSM1129621 r1 0:42 A:84994407;C:91269417;G:87188701;T:108077735;N:22824 42       84994407 91269417 87188701 108077735 22824 SRX271959 SRS416255 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.86495   0.09748   0.83684   0.52833   42   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36717 36717 SRR835162 SRX271958 SRS416254 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 28 399s62 GSM1129620   tissue:melanocytes|hpf dm 77h 28 399s62 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129620 GSM1129620: dm 77h 28 399s62; Danio rerio; RNA Seq GSM1129620 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129620 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP021517         731276158.0 3620179.0 GSM1129620 r1 0:101 1:101 A:173989639;C:199270484;G:188281318;T:169725601;N:9116 101 101     173989639 199270484 188281318 169725601 9116 SRX271958 SRS416254 SRA074390 GEO Rob Mitra, Genetics, Washington University 2 0.84122 0.79964 0.02274 0.02168 0.89645 0.89073 0.63341 0.63015 101 101 B B biological fallback assumption illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36718 36718 SRR835161 SRX271957 SRS416253 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 28 399s61 GSM1129619   tissue:melanocytes|hpf dm 77h 28 399s61 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129619 GSM1129619: dm 77h 28 399s61; Danio rerio; RNA Seq GSM1129619 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129619 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP021517     dm_77h_28_399s61_CACT.fq.bz2 dm_77h_28_399s62_CACT.fq.bz2 fastq fastq 731276158.0 3620179.0 GSM1129619 r1 0:101 1:101 A:173989639;C:199270484;G:188281318;T:169725601;N:9116 101 101     173989639 199270484 188281318 169725601 9116 SRX271957 SRS416253 SRA074390 GEO Rob Mitra, Genetics, Washington University 2 0.84121 0.79968 0.02287 0.02141 0.89658 0.89051 0.63318 0.63061 101 101 B B biological fallback assumption illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36719 36719 SRR835160 SRX271956 SRS416252 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 28 436 GSM1129618   tissue:melanocytes|hpf dm 77h 28 436 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129618 GSM1129618: dm 77h 28 436; Danio rerio; RNA Seq GSM1129618 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129618 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_77h_28_436_CACT.fq.bz2 fastq 214752678.0 5113159.0 GSM1129618 r1 0:42 A:50210098;C:62230664;G:49216487;T:52926929;N:168500 42       50210098 62230664 49216487 52926929 168500 SRX271956 SRS416252 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.80956   0.02412   0.87024   0.62475   42   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36720 36720 SRR835159 SRX271955 SRS416251 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 28 351 GSM1129617   tissue:melanocytes|hpf dm 77h 28 351 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129617 GSM1129617: dm 77h 28 351; Danio rerio; RNA Seq GSM1129617 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129617 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_77h_28_351_CACT.fq.bz2 fastq 84584556.0 2349571.0 GSM1129617 r1 0:36 A:19843286;C:24761303;G:18855233;T:21124051;N:683 36       19843286 24761303 18855233 21124051 683 SRX271955 SRS416251 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.75246   0.02663   0.87054   0.59024   36   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36721 36721 SRR835158 SRX271954 SRS416250 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 27 436 GSM1129616   tissue:melanocytes|hpf dm 77h 27 436 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129616 GSM1129616: dm 77h 27 436; Danio rerio; RNA Seq GSM1129616 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129616 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_77h_27_436_TTAT.fq.bz2 fastq 194114466.0 4621773.0 GSM1129616 r1 0:42 A:44579558;C:47759429;G:44539735;T:57080409;N:155335 42       44579558 47759429 44539735 57080409 155335 SRX271954 SRS416250 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.80787   0.04019   0.86263   0.57373   42   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36722 36722 SRR835157 SRX271953 SRS416249 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 27 351 GSM1129615   tissue:melanocytes|hpf dm 77h 27 351 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129615 GSM1129615: dm 77h 27 351; Danio rerio; RNA Seq GSM1129615 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129615 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_77h_27_351_TTAT.fq.bz2 fastq 113087304.0 3141314.0 GSM1129615 r1 0:36 A:26171623;C:27323878;G:24871328;T:34719586;N:889 36       26171623 27323878 24871328 34719586 889 SRX271953 SRS416249 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.75375   0.04337   0.85878   0.5311   36   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36723 36723 SRR835156 SRX271952 SRS416248 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 26 433 GSM1129614   tissue:melanocytes|hpf dm 77h 26 433 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129614 GSM1129614: dm 77h 26 433; Danio rerio; RNA Seq GSM1129614 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129614 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_77h_26_433_AGAT.fq.bz2 fastq 34005804.0 809662.0 GSM1129614 r1 0:42 A:8766789;C:8066807;G:8338043;T:8833768;N:397 42       8766789 8066807 8338043 8833768 397 SRX271952 SRS416248 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.81802   0.05684   0.88787   0.56756   42   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36724 36724 SRR835155 SRX271951 SRS416247 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 26 351 GSM1129613   tissue:melanocytes|hpf dm 77h 26 351 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129613 GSM1129613: dm 77h 26 351; Danio rerio; RNA Seq GSM1129613 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129613 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_77h_26_351_AGAT.fq.bz2 fastq 101340432.0 2815012.0 GSM1129613 r1 0:36 A:26592120;C:23518331;G:24503636;T:26725495;N:850 36       26592120 23518331 24503636 26725495 850 SRX271951 SRS416247 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.75158   0.05787   0.88986   0.57167   36   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36725 36725 SRR835154 SRX271950 SRS416245 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 25 399s62 GSM1129612   tissue:melanocytes|hpf dm 77h 25 399s62 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129612 GSM1129612: dm 77h 25 399s62; Danio rerio; RNA Seq GSM1129612 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129612 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP021517         1715809008.0 8494104.0 GSM1129612 r1 0:101 1:101 A:405310561;C:444474389;G:467897835;T:398105078;N:21145 101 101     405310561 444474389 467897835 398105078 21145 SRX271950 SRS416245 SRA074390 GEO Rob Mitra, Genetics, Washington University 2 0.66327 0.58026 0.07911 0.07288 0.91721 0.9083 0.56907 0.5363 101 101 B B biological fallback assumption illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36726 36726 SRR835153 SRX271949 SRS416246 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 25 399s61 GSM1129611   tissue:melanocytes|hpf dm 77h 25 399s61 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129611 GSM1129611: dm 77h 25 399s61; Danio rerio; RNA Seq GSM1129611 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129611 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP021517     dm_77h_25_399s61_TCTT.fq.bz2 dm_77h_25_399s62_TCTT.fq.bz2 fastq fastq 1715809008.0 8494104.0 GSM1129611 r1 0:101 1:101 A:405310561;C:444474389;G:467897835;T:398105078;N:21145 101 101     405310561 444474389 467897835 398105078 21145 SRX271949 SRS416246 SRA074390 GEO Rob Mitra, Genetics, Washington University 2 0.66325 0.58027 0.0792 0.07327 0.91741 0.90847 0.56374 0.53632 101 101 B B biological fallback assumption illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36727 36727 SRR835152 SRX271948 SRS416244 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 25 433 GSM1129610   tissue:melanocytes|hpf dm 77h 25 433 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129610 GSM1129610: dm 77h 25 433; Danio rerio; RNA Seq GSM1129610 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129610 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_77h_25_433_TCTT.fq.bz2 fastq 489386604.0 11652062.0 GSM1129610 r1 0:42 A:99597908;C:134563195;G:119005661;T:136214210;N:5630 42       99597908 134563195 119005661 136214210 5630 SRX271948 SRS416244 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.79072   0.08396   0.87497   0.51318   42   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36728 36728 SRR835151 SRX271947 SRS416243 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 77h 25 351 GSM1129609   tissue:melanocytes|hpf dm 77h 25 351 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129609 GSM1129609: dm 77h 25 351; Danio rerio; RNA Seq GSM1129609 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129609 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_77h_25_351_TCTT.fq.bz2 fastq 98765532.0 2743487.0 GSM1129609 r1 0:36 A:19387910;C:27338385;G:23220852;T:28817575;N:810 36       19387910 27338385 23220852 28817575 810 SRX271947 SRS416243 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.75369   0.08166   0.87667   0.51755   36   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36729 36729 SRR835150 SRX271946 SRS416242 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 58h 45 440 GSM1129608   tissue:melanocytes|hpf dm 58h 45 440 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129608 GSM1129608: dm 58h 45 440; Danio rerio; RNA Seq GSM1129608 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129608 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_58h_45_440.fq.bz2 fastq 203660982.0 4849071.0 GSM1129608 r1 0:42 A:46576136;C:50204145;G:47522343;T:59345685;N:12673 42       46576136 50204145 47522343 59345685 12673 SRX271946 SRS416242 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.86133   0.0978   0.84565   0.53118   42   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
36730 36730 SRR835149 SRX271945 SRS416241 SRP021517 PRJNA198908 Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin GSE46387 Transcriptome Analysis In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing   pubmed:23874447   dm 58h 23 351 GSM1129607   tissue:melanocytes|hpf dm 58h 23 351 Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library melanocytes   This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc…   hpf GSM1129607 GSM1129607: dm 58h 23 351; Danio rerio; RNA Seq GSM1129607 1   1 This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rc… GEO Accession:GSM1129607 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP021517     dm_58h_23_351_GAAT.fq.bz2 fastq 106123464.0 2947874.0 GSM1129607 r1 0:36 A:26495114;C:26882652;G:25518440;T:27226454;N:804 36       26495114 26882652 25518440 27226454 804 SRX271945 SRS416241 SRA074390 GEO Rob Mitra, Genetics, Washington University 1 0.78561   0.06331   0.85107   0.46073   36   B   usable mapping rate illumina hiseq_era 3prime poly_a unknown bulk unknown unknown   United States 2013-04-25 Larval Larval Skin Surface Structure
38116 38116 SRR1551799 SRX681419 SRS685080 SRP045504 PRJNA258223 Danio rerio strain:TL Transcriptome or Gene expression PRJNA258223 Other Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos       keratocytes from 4dpf embryos keratocytes from 4dpf embryos   breed:TL|strain:TL|age:4dpf|biomaterial provider:Julie Theriot Stanford University|sex:not collected|tissue:keratocytes skin|cell type:keratocyte|dev stage:4dpf|BioSampleModel:Model organism or animal                 transcriptome from 4dpf keratocytes replicate 3 4dpf 3 4dpf 3 RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.     RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>40</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP045504     lane4_4dpf707.fastq fastq 1001179200.0 25029480.0 4dpf 3 0:40 A:253770714;C:242097985;G:244642013;T:260557997;N:110491 40       253770714 242097985 244642013 260557997 110491 SRX681419 SRS685080 SRA179326 Stanford University|Julie Theriot Stanford University 1 0.90546   0.2101   0.75185   0.49242   40   B   usable mapping rate illumina early_illumina unknown poly_a trueseq bulk unknown unknown   United States 2015-04-07 Larval Larval Skin Surface Structure
38117 38117 SRR1551798 SRX681418 SRS685080 SRP045504 PRJNA258223 Danio rerio strain:TL Transcriptome or Gene expression PRJNA258223 Other Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos       keratocytes from 4dpf embryos keratocytes from 4dpf embryos   breed:TL|strain:TL|age:4dpf|biomaterial provider:Julie Theriot Stanford University|sex:not collected|tissue:keratocytes skin|cell type:keratocyte|dev stage:4dpf|BioSampleModel:Model organism or animal                 Transcriptome from 4dpf keratocytes replicate 2 4dpf 2 4dpf 2 RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.     RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>40</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP045504     lane7_4col.fastq fastq 1700157430.0 44740985.0 4dpf 2 0:38 A:394789834;C:418821057;G:504852317;T:369111176;N:12583046 38       394789834 418821057 504852317 369111176 12583046 SRX681418 SRS685080 SRA179326 Stanford University|Julie Theriot Stanford University 1 0.68441   0.12529   0.8338   0.45494   38   B   usable mapping rate illumina early_illumina unknown poly_a trueseq bulk unknown unknown   United States 2014-08-14 Larval Larval Skin Surface Structure
38118 38118 SRR1551797 SRX681417 SRS685080 SRP045504 PRJNA258223 Danio rerio strain:TL Transcriptome or Gene expression PRJNA258223 Other Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos       keratocytes from 4dpf embryos keratocytes from 4dpf embryos   breed:TL|strain:TL|age:4dpf|biomaterial provider:Julie Theriot Stanford University|sex:not collected|tissue:keratocytes skin|cell type:keratocyte|dev stage:4dpf|BioSampleModel:Model organism or animal                 4dpf keratocyte transcriptome replicate 1 4dpf 1 4dpf 1 RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.     RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina Genome Analyzer IIx <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>47</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP045504     lane7_1_4dpf.fastq fastq 762138229.0 16215707.0 4dpf 1 0:47 A:183899711;C:180347476;G:190086042;T:189460942;N:18344058 47       183899711 180347476 190086042 189460942 18344058 SRX681417 SRS685080 SRA179326 Stanford University|Julie Theriot Stanford University 1 0.85884   0.2135   0.80077   0.50539   47   B   usable mapping rate illumina early_illumina unknown poly_a trueseq bulk unknown unknown   United States 2014-08-15 Larval Larval Skin Surface Structure
51261 51261 SRR8632324 SRX5431025 SRS4411020 SRP186864 PRJNA524286 The miR 199 CDK2 axis modulates neutrophil migration and systemic inflammation GSE127174 Transcriptome Analysis We performed RNAseq to identify miRNAs that were specifically down regulated in neutrophils and RNAseq for identification of mRNA targets of miRNA 199 in neutrophils Overall design: for miRNA profiles we compared the miRNA present in zebrafish neutrophils and keratinocytes to the whole embryo. for miR 199 target identification we sequenced messenger RNAs in zebrafish neutrophils over expressing miR199 or vector control   pubmed:31451657   Krt4+ GSM3629719   source name:keratinocytes|strain background:AB|gentoype/variation:wild type|tissue:keratinocytes Krt4+ Base calling and quality scoreing were performed by Real Time Analysis RTA v2 in Illumina HiSeq 2500 for Samples 1 5 in Illumina HiSeq 4000 for Samples 6 11. The bcl2fastq2 Conversion software were used to convert base call bcl files to FASTQ files and trim adapter sequence at the same time. The reads were mapped to the zebrafish genome using STAR v2.5 RNA seq aligner with the following parameter: for Samples 1 5: “ alignEndsType EndToEnd outFilterMismatchNmax 1 outFilterMultimapScoreRange 0 outFilterMultimapNmax 10 outSAMunmapped Within outFilterScoreMinOverLread 0 outFilterMatchNminOverLread 0 outFilterMatchNmin 16 alignSJDBoverhangMin 1000” for Samples 6 11: “ outSAMmapqUnique 60”. Uniquely mapped sequencing reads were assigned to genes using featureCounts from subread v1.5.1 with the following parameters: for Samples 1 5: “ s 1 –Q 10” for Samples 6 11 " p Q 10". The data was filtered: for Samples 1 5 using read count > 10 in more than 1 of the samples; for Samples 6 11 using read count per million CPM > 0.5 in more than 3 of the samples normalized using TMM trimmed mean of M values method and subjected to differential expression analysis using edgeR v3.20.8. Genome build: GRCz11 Supplementary files format and content: Raw counts keratinocytes transgenic zebrafish lines were used to produce embryos. For miRNA profiling transgenic lines expressing GFP in either neutrophils or apical keratincyes were used. For miR 199 target discovery transgenic lines expressing miR 199 or a vector control together with a GFP reporter were used. tissue specific isolation: cells were labeled with fluorescent reporters and isolated from 3dpf zebrafish embryos using FACS. mRNA was extracted using Qiagen RNeasy Mini Kit and total RNA was extracted using Invirtogen mirVANA kit for miRNA sequencing. miRNA sequencing library were constructed using Illumina TruSeq Small RNA Preparation and 145 160bp band are excised for sequencing. mRNA sequencing library were constructed withSMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara Clontech Laboratories Inc.. zebrafish embryos were grown to 3 dpf in embryonic media strain background:AB|gentoype/variation:wild type|tissue:keratinocytes GSM3629719 GSM3629719: Krt4+; Danio rerio; RNA Seq GSM3629719   1 tissue specific isolation: cells were labeled with fluorescent reporters and isolated from 3dpf zebrafish embryos using FACS. mRNA was extracted using Qiagen RNeasy Mini Kit and total RNA was extracted using Invirtogen mirVANA kit for miRNA sequencing. miRNA sequencing library were constructed using Illumina TruSeq Small RNA Preparation and 145 160bp band are excised for sequencing. mRNA sequencing library were constructed withSMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara Clontech Laboratories Inc.. GEO Accession:GSM3629719 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP186864     krt4.fastq.gz fastq 101078150.0 2021563.0 GSM3629719 r1 0:50 A:18002613;C:22778088;G:30701792;T:29589610;N:6047 50       18002613 22778088 30701792 29589610 6047 SRX5431025 SRS4411020 SRA852308 GEO Department of Biological Sciences, Purdue University 1 0.05911   0.00807   0.97461   0.77586   50   B   usable mapping rate illumina hiseq_era unknown small_rna trueseq sc single_cell_plate smartseq   United States 2019-02-26 Larval Larval Skin Surface Structure
52249 52249 SRR9050626 SRX5827017 SRS4754831 SRP198298 PRJNA542704 Thyroid hormone regulates distinct paths to maturation in pigment cell lineages GSE131136 Transcriptome Analysis Early and post embryonic neural crest derived lineages in the zebrafish trunk in response to thyroid hormone modulation Overall design: Single cell RNA seq experiments were performed on the 10X Genomics platform from FAC sorted Sox10:CRE positive cells from 5dpf and post embryonic zebrafish trunks with and without xxx hormone.   pubmed:31140974;pubmed:33933422   Neural crest derived cells from hypothyroid post embryonic zebrafish skins biological replicate 2 GSM3764573   tissue:sox10:Cre+ cells from post embryonic zebrafish skin tissue|cell type:3033 cells from Tgsox10:Cre; ubi:switch; tg:nVenus 2a nfnB FAC sorted mCherry+ cells from trunks. Fish range in stage from 7.2 10.4 SSL stage zebrafish. Thyroid ablation was performed at 4 dpf with metronidazole treatment.|treatment:Hypothyroid Neural crest derived cells from hypothyroid post embryonic zebrafish skins biological replicate 2 Expression matrix files and BAM files were generated using cellranger 10X genomics version 2.0.2 as described by the manufacturer using the commands cellranger demux and cellranger count. UMI count matrices representing the filtered set of barcodes representing cells were used as determined by cellranger. All samples were aggregated using the aggregate option in cellranger to normalize mean number of reads per cell across 10X libraries. Genome build: GRCz11 Supplementary files format and content: Expression matrix files and BAM files were generated using cellranger 10X genomics version 2.0.2 as described by the manufacturer using the commands cellranger demux and cellranger count. UMI count matrices representing the filtered set of barcodes representing cells were used as determined by cellranger. Expression matrices are output by cellranger and are in Matrix Market Exchange format and the gene and cell barcode name files that accompany these file are provided as TSV files. sox10:Cre+ cells from post embryonic zebrafish skin tissue Transgenic zebrafish Tgsox10:Cre; ubi:switch; tg:nVenus 2a nfnB were treated either metronidazole 10mM or a vehicle control DMSO at 4dpf. Trunks or skins were collected at a stage range of 7.2 10.4 SSL or 5 dpf as indicated in the sample name. Tissue was dissociated into a single cell suspension and FAC sorted for the presence of mCherry. Then cells were washed and loaded into the 10X chromium chip according to manufacturer recommendations. 10X genomics single cell gene expression V2 protocol following manufacturer recommendations. 10X genomics single cell gene expression V2 protocol following manufacturer recommendations. Zebrafish were maintained at 28.5 °C under 14:10 light:dark cycles. All thyroid ablated Mtz treated and control DMSO treated Tgtg:nVenus v2a nfnB fish were kept under TH free conditions and were fed only Artemia rotifers enriched with TH free Algamac Aquafauna and bloodworms. cell type:3033 cells from Tgsox10:Cre; ubi:switch; tg:nVenus 2a nfnB FAC sorted mCherry+ cells from trunks. Fish range in stage from 7.2 10.4 SSL stage zebrafish. Thyroid ablation was performed at 4 dpf with metronidazole treatment.|treatment:Hypothyroid GSM3764573 GSM3764573: Neural crest derived cells from hypothyroid post embryonic zebrafish skins biological replicate 2; Danio rerio; RNA Seq GSM3764573   1 10X genomics single cell gene expression V2 protocol following manufacturer recommendations. 10X genomics single cell gene expression V2 protocol following manufacturer recommendations.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP198298   dangling references:treat as unmapped hypo6_possorted_genome_bam.bam 10X Genomics bam file 7642585251.0 134080443.0 GSM3764573 r1 0:57 A:2330102138;C:1530481079;G:1741129436;T:2036914417;N:3958181 57       2330102138 1530481079 1741129436 2036914417 3958181 SRX5827017 SRS4754831 SRA886020 GEO Biology, University of Virginia 1 0.92859   0.20322   0.83019   0.51386   57   B   usable mapping rate illumina nextseq unknown cdna_unspecified unknown sc single_cell_droplet 10x   United States 2019-05-13 Larval Larval Skin Surface Structure
52255 52255 SRR9050620 SRX5827011 SRS4754825 SRP198298 PRJNA542704 Thyroid hormone regulates distinct paths to maturation in pigment cell lineages GSE131136 Transcriptome Analysis Early and post embryonic neural crest derived lineages in the zebrafish trunk in response to thyroid hormone modulation Overall design: Single cell RNA seq experiments were performed on the 10X Genomics platform from FAC sorted Sox10:CRE positive cells from 5dpf and post embryonic zebrafish trunks with and without xxx hormone.   pubmed:31140974;pubmed:33933422   Neural crest derived cells from euthyroid post embryonic zebrafish skins biological replicate 2 GSM3764567   tissue:sox10:Cre+ cells from post embryonic zebrafish skin tissue|cell type:3008 cells from Tgsox10:Cre; ubi:switch; tg:nVenus 2a nfnB FAC sorted mCherry+ cells from skins. Zebrafish range in stage from 7.2 10.4 SSL.|treatment:Euthyroid Neural crest derived cells from euthyroid post embryonic zebrafish skins biological replicate 2 Expression matrix files and BAM files were generated using cellranger 10X genomics version 2.0.2 as described by the manufacturer using the commands cellranger demux and cellranger count. UMI count matrices representing the filtered set of barcodes representing cells were used as determined by cellranger. All samples were aggregated using the aggregate option in cellranger to normalize mean number of reads per cell across 10X libraries. Genome build: GRCz11 Supplementary files format and content: Expression matrix files and BAM files were generated using cellranger 10X genomics version 2.0.2 as described by the manufacturer using the commands cellranger demux and cellranger count. UMI count matrices representing the filtered set of barcodes representing cells were used as determined by cellranger. Expression matrices are output by cellranger and are in Matrix Market Exchange format and the gene and cell barcode name files that accompany these file are provided as TSV files. sox10:Cre+ cells from post embryonic zebrafish skin tissue Transgenic zebrafish Tgsox10:Cre; ubi:switch; tg:nVenus 2a nfnB were treated either metronidazole 10mM or a vehicle control DMSO at 4dpf. Trunks or skins were collected at a stage range of 7.2 10.4 SSL or 5 dpf as indicated in the sample name. Tissue was dissociated into a single cell suspension and FAC sorted for the presence of mCherry. Then cells were washed and loaded into the 10X chromium chip according to manufacturer recommendations. 10X genomics single cell gene expression V2 protocol following manufacturer recommendations. 10X genomics single cell gene expression V2 protocol following manufacturer recommendations. Zebrafish were maintained at 28.5 °C under 14:10 light:dark cycles. All thyroid ablated Mtz treated and control DMSO treated Tgtg:nVenus v2a nfnB fish were kept under TH free conditions and were fed only Artemia rotifers enriched with TH free Algamac Aquafauna and bloodworms. cell type:3008 cells from Tgsox10:Cre; ubi:switch; tg:nVenus 2a nfnB FAC sorted mCherry+ cells from skins. Zebrafish range in stage from 7.2 10.4 SSL.|treatment:Euthyroid GSM3764567 GSM3764567: Neural crest derived cells from euthyroid post embryonic zebrafish skins biological replicate 2; Danio rerio; RNA Seq GSM3764567   1 10X genomics single cell gene expression V2 protocol following manufacturer recommendations. 10X genomics single cell gene expression V2 protocol following manufacturer recommendations.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP198298   dangling references:treat as unmapped eu5_possorted_genome_bam.bam 10X Genomics bam file 7562050749.0 132667557.0 GSM3764567 r1 0:57 A:2291130941;C:1508834109;G:1752506997;T:2005478206;N:4100496 57       2291130941 1508834109 1752506997 2005478206 4100496 SRX5827011 SRS4754825 SRA886020 GEO Biology, University of Virginia 1 0.92351   0.19606   0.82913   0.5204   57   B   usable mapping rate illumina nextseq unknown cdna_unspecified unknown sc single_cell_droplet 10x   United States 2019-05-13 Larval Larval Skin Surface Structure
52806 52806 SRR9211497 SRX5982387 SRS4887892 SRP200656 PRJNA547573 Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos GSE132304 Transcriptome Analysis We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.   pubmed:31431477   72 hpf all skin replicate A GSM3855905   source name:FACS isolated all skin cells from whole embryos|strain:AB+TU|developmental stage:72 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed 72 hpf all skin replicate A Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication. FACS isolated all skin cells from whole embryos Transgenic embryos without xxx treatment Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle. strain:AB+TU|developmental stage:72 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed GSM3855905 GSM3855905: 72 hpf all skin replicate A; Danio rerio; RNA Seq GSM3855905   1 Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. GEO Accession:GSM3855905 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP200656     ZFishSkin_Reads_c19_72hpf-allSkin-_repA_i07.CAGATCA.pf1_XA025L6.fastq.gz fastq 1109562250.0 22191245.0 GSM3855905 r1 0:50 A:277535095;C:268480388;G:273593744;T:285667284;N:4285739 50       277535095 268480388 273593744 285667284 4285739 SRX5982387 SRS4887892 SRA894819 GEO UCLA 1 0.91322   0.0619   0.7763   0.40372   50   B   usable mapping rate illumina hiseq_era unknown poly_a trueseq bulk unknown unknown   United States 2019-06-06 Larval Larval Skin Surface Structure
52807 52807 SRR9211496 SRX5982386 SRS4887891 SRP200656 PRJNA547573 Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos GSE132304 Transcriptome Analysis We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.   pubmed:31431477   72 hpf nonskin1 replicate B GSM3855904   source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed 72 hpf nonskin1 replicate B Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication. FACS isolated nonskin cells from whole embryos Transgenic embryos without xxx treatment Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle. strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed GSM3855904 GSM3855904: 72 hpf nonskin1 replicate B; Danio rerio; RNA Seq GSM3855904   1 Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. GEO Accession:GSM3855904 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP200656     ZFishSkin_Reads_c18_72hpf-nonskin1_repB_i12.CTTGTAA.pf1_XA027L8.fastq.gz fastq 1251653750.0 25033075.0 GSM3855904 r1 0:50 A:332120369;C:300029575;G:291543941;T:327925643;N:34222 50       332120369 300029575 291543941 327925643 34222 SRX5982386 SRS4887891 SRA894819 GEO UCLA 1 0.9349   0.0985   0.67947   0.48474   50   B   usable mapping rate illumina hiseq_era unknown poly_a trueseq bulk unknown unknown   United States 2019-06-06 Larval Larval Skin Surface Structure
52808 52808 SRR9211495 SRX5982385 SRS4887890 SRP200656 PRJNA547573 Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos GSE132304 Transcriptome Analysis We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.   pubmed:31431477   72 hpf nonskin1 replicate A GSM3855903   source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed 72 hpf nonskin1 replicate A Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication. FACS isolated nonskin cells from whole embryos Transgenic embryos without xxx treatment Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle. strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed GSM3855903 GSM3855903: 72 hpf nonskin1 replicate A; Danio rerio; RNA Seq GSM3855903   1 Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. GEO Accession:GSM3855903 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP200656     ZFishSkin_Reads_c17_72hpf-nonskin1_repA_i12.CTTGTAA.pf1_XA025L6.fastq.gz fastq 1060666050.0 21213321.0 GSM3855903 r1 0:50 A:268147841;C:255427855;G:259996073;T:272974158;N:4120123 50       268147841 255427855 259996073 272974158 4120123 SRX5982385 SRS4887890 SRA894819 GEO UCLA 1 0.91743   0.1009   0.68972   0.47802   50   B   usable mapping rate illumina hiseq_era unknown poly_a trueseq bulk unknown unknown   United States 2019-06-06 Larval Larval Skin Surface Structure
52826 52826 SRR9211500 SRX5982367 SRS4887872 SRP200656 PRJNA547573 Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos GSE132304 Transcriptome Analysis We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.   pubmed:31431477   72 hpf nonskin2 replicate B GSM3855908   source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin2|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed;krt5:GFP 72 hpf nonskin2 replicate B Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication. FACS isolated nonskin cells from whole embryos Transgenic embryos without xxx treatment Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle. strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin2|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed;krt5:GFP GSM3855908 GSM3855908: 72 hpf nonskin2 replicate B; Danio rerio; RNA Seq GSM3855908   1 Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. GEO Accession:GSM3855908 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP200656     ZFishSkin_Reads_c22_72hpf-nonskin2_repB_i02.CGATGTA.pf1_LB010L6.fastq.gz fastq 1625988936.0 31882136.0 GSM3855908 r1 0:51 A:429321517;C:384417974;G:385248218;T:426975311;N:25916 51       429321517 384417974 385248218 426975311 25916 SRX5982367 SRS4887872 SRA894819 GEO UCLA 1 0.92588   0.10534   0.69252   0.47138   51   B   usable mapping rate illumina hiseq_era unknown poly_a trueseq bulk unknown unknown   United States 2019-06-06 Larval Larval Skin Surface Structure
52827 52827 SRR9211499 SRX5982366 SRS4887871 SRP200656 PRJNA547573 Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos GSE132304 Transcriptome Analysis We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.   pubmed:31431477   72 hpf nonskin2 replicate A GSM3855907   source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin2|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed;krt5:GFP 72 hpf nonskin2 replicate A Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication. FACS isolated nonskin cells from whole embryos Transgenic embryos without xxx treatment Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle. strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin2|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed;krt5:GFP GSM3855907 GSM3855907: 72 hpf nonskin2 replicate A; Danio rerio; RNA Seq GSM3855907   1 Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. GEO Accession:GSM3855907 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP200656     ZFishSkin_Reads_c21_72hpf-nonskin2_repA_i02.CGATGTA.pf1_VA061L6.fastq.gz fastq 1389960069.0 27254119.0 GSM3855907 r1 0:51 A:367360698;C:329372505;G:329231934;T:363977069;N:17863 51       367360698 329372505 329231934 363977069 17863 SRX5982366 SRS4887871 SRA894819 GEO UCLA 1 0.92962   0.10905   0.68357   0.47722   51   B   usable mapping rate illumina hiseq_era unknown poly_a trueseq bulk unknown unknown   United States 2019-06-06 Larval Larval Skin Surface Structure
52828 52828 SRR9211498 SRX5982365 SRS4887870 SRP200656 PRJNA547573 Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos GSE132304 Transcriptome Analysis We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.   pubmed:31431477   72 hpf all skin replicate B GSM3855906   source name:FACS isolated all skin cells from whole embryos|strain:AB+TU|developmental stage:72 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed 72 hpf all skin replicate B Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication. FACS isolated all skin cells from whole embryos Transgenic embryos without xxx treatment Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle. strain:AB+TU|developmental stage:72 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed GSM3855906 GSM3855906: 72 hpf all skin replicate B; Danio rerio; RNA Seq GSM3855906   1 Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit. GEO Accession:GSM3855906 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP200656     ZFishSkin_Reads_c20_72hpf-allSkin-_repB_i07.CAGATCA.pf1_XA027L8.fastq.gz fastq 1297550200.0 25951004.0 GSM3855906 r1 0:50 A:336310605;C:318264536;G:308821981;T:334116972;N:36106 50       336310605 318264536 308821981 334116972 36106 SRX5982365 SRS4887870 SRA894819 GEO UCLA 1 0.93422   0.06011   0.76345   0.40589   50   B   usable mapping rate illumina hiseq_era unknown poly_a trueseq bulk unknown unknown   United States 2019-06-06 Larval Larval Skin Surface Structure
67681 67681 SRR17247014 SRX13426037 SRS11327031 SRP351072 PRJNA789095 Danio rerio Raw sequence reads PRJNA789095 Whole Genome Sequencing normal of RNA seq of danio rerio         A2   isolate:not collected|age:17dpf|sex:pooled male and female|tissue:scaly skin|replicate:replicate=biological replicate A2|BioSampleModel:Model organism or animal                 RNAseq of danio rerio S334 S334 normal RNA seq of danio rerio     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA Illumina HiSeq 4000   SRP351072     A2_S58_R1_001.fastq.gz A2_S58_R2_001.fastq.gz fastq fastq 5616555000.0 18721850.0 A2 S58 R1 001.fastq.gz 0:150 1:150 A:1448598133;C:1350283389;G:1368707125;T:1446502716;N:2463637 150 150     1448598133 1350283389 1368707125 1446502716 2463637 SRX13426037 SRS11327031 SRA1344321 shanghai ocean university|college of marine sciences shanghai ocean university 2 0.96958 0.97206 0.03246 0.03194 0.74659 0.74809 0.48122 0.48632 150 150 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   China 2021-12-16 Larval Larval Skin Surface Structure
67682 67682 SRR17247015 SRX13426036 SRS11327029 SRP351072 PRJNA789095 Danio rerio Raw sequence reads PRJNA789095 Whole Genome Sequencing normal of RNA seq of danio rerio         A1   isolate:not collected|age:17dpf|sex:pooled male and female|tissue:scaly skin|replicate:replicate=biological replicate A1|BioSampleModel:Model organism or animal                 RNAseq of danio rerio S333 S333 normal RNA seq of danio rerio     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA Illumina HiSeq 4000   SRP351072     A1_S57_R1_001.fastq.gz A1_S57_R2_001.fastq.gz fastq fastq 4007594400.0 13358648.0 A1 S57 R1 001.fastq.gz 0:150 1:150 A:1045509577;C:951632697;G:972694338;T:1035964441;N:1793347 150 150     1045509577 951632697 972694338 1035964441 1793347 SRX13426036 SRS11327029 SRA1344321 shanghai ocean university|college of marine sciences shanghai ocean university 2 0.96027 0.96204 0.03269 0.03149 0.76686 0.76749 0.44581 0.46233 150 150 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   China 2021-12-16 Larval Larval Skin Surface Structure
71771 71771 SRR22094615 SRX18074634 SRS15579669 SRP405171 PRJNA893397 RNA sequencing of the zebrafish superficial epithelial cells PRJNA893397 Other We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it "asynthetic fission". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.     replicate SEC 21dpf r SEC 21dpf r   strain:EK|age:21dpf|dev stage:21dpf|sex:NA|tissue:skin superficial epithelial cell|BioSampleModel:Model organism or animal                 RNA sequencing of zebrafish:superficial epithelial cells 21dpf replicate LTS21 YW06 LTS21 YW06 100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 2000   SRP405171     LTS21_YW06_S8_L001_R1_001.fastq.gz LTS21_YW06_S8_L001_R2_001.fastq.gz fastq fastq 18884108924.0 62530162.0 LTS21 YW06 S8 L001 R1 001.fastq.gz 0:151 1:151 A:4928408237;C:4582387963;G:4378535805;T:4978379185;N:16397734 151 151     4928408237 4582387963 4378535805 4978379185 16397734 SRX18074634 SRS15579669 SRA1530145 Academia Sinica|Institute of Cellular and Organismic Biology Academia Sinica 2 0.78046 0.77311 0.03967 0.03852 0.76834 0.76962 0.48776 0.49055 151 151 B B biological fallback assumption illumina nextseq_v2 unknown poly_a unknown bulk unknown unknown   Taiwan 2022-10-29 Larval Larval Skin Surface Structure
71772 71772 SRR22094620 SRX18074633 SRS15579668 SRP405171 PRJNA893397 RNA sequencing of the zebrafish superficial epithelial cells PRJNA893397 Other We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it "asynthetic fission". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.       SEC 21dpf Zebrafish SEC 21dpf   strain:EK|age:21dpf|dev stage:21dpf|sex:NA|tissue:Skin|BioSampleModel:Model organism or animal                 RNA sequencing of zebrafish:superficial epithelial cells 21dpf LTS21 YW05 LTS21 YW05 100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 2000   SRP405171     LTS21_YW05_S7_L001_R1_001.fastq.gz LTS21_YW05_S7_L001_R2_001.fastq.gz fastq fastq 19711202968.0 65268884.0 LTS21 YW05 S7 L001 R1 001.fastq.gz 0:151 1:151 A:5117592567;C:4797244360;G:4551347423;T:5228007671;N:17010947 151 151     5117592567 4797244360 4551347423 5228007671 17010947 SRX18074633 SRS15579668 SRA1530145 Academia Sinica|Institute of Cellular and Organismic Biology Academia Sinica 2 0.76712 0.76186 0.039 0.03769 0.76637 0.76692 0.45633 0.4647 151 151 B B biological fallback assumption illumina nextseq_v2 unknown poly_a unknown bulk unknown unknown   Taiwan 2022-10-29 Larval Larval Skin Surface Structure
71773 71773 SRR22094616 SRX18074632 SRS15579667 SRP405171 PRJNA893397 RNA sequencing of the zebrafish superficial epithelial cells PRJNA893397 Other We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it "asynthetic fission". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.     replicate SEC 14dpf r SEC 14dpf r   strain:EK|age:14dpf|dev stage:14dpf|sex:NA|tissue:skin superficial epithelial cell|BioSampleModel:Model organism or animal                 RNA sequencing of zebrafish:superficial epithelial cells 14dpf replicate LTS21 YW04 LTS21 YW04 100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 2000   SRP405171     LTS21_YW04_S6_L001_R1_001.fastq.gz LTS21_YW04_S6_L001_R2_001.fastq.gz fastq fastq 18505626216.0 61276908.0 LTS21 YW04 S6 L001 R1 001.fastq.gz 0:151 1:151 A:4873584588;C:4461374730;G:4234634486;T:4920008051;N:16024361 151 151     4873584588 4461374730 4234634486 4920008051 16024361 SRX18074632 SRS15579667 SRA1530145 Academia Sinica|Institute of Cellular and Organismic Biology Academia Sinica 2 0.76819 0.76283 0.05352 0.05251 0.76765 0.76838 0.50479 0.49192 151 151 B B biological fallback assumption illumina nextseq_v2 unknown poly_a unknown bulk unknown unknown   Taiwan 2022-10-29 Larval Larval Skin Surface Structure
71774 71774 SRR22094619 SRX18074631 SRS15579666 SRP405171 PRJNA893397 RNA sequencing of the zebrafish superficial epithelial cells PRJNA893397 Other We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it "asynthetic fission". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.       SEC 14dpf Zebrafish SEC 14dpf   strain:EK|age:14dpf|dev stage:14dpf|sex:NA|tissue:Skin|BioSampleModel:Model organism or animal                 RNA sequencing of zebrafish:superficial epithelial cells 14dpf LTS21 YW03 LTS21 YW03 100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 2000   SRP405171     LTS21_YW03_S5_L001_R1_001.fastq.gz LTS21_YW03_S5_L001_R2_001.fastq.gz fastq fastq 20010150956.0 66258778.0 LTS21 YW03 S5 L001 R1 001.fastq.gz 0:151 1:151 A:5185539519;C:4876294580;G:4677668447;T:5253656025;N:16992385 151 151     5185539519 4876294580 4677668447 5253656025 16992385 SRX18074631 SRS15579666 SRA1530145 Academia Sinica|Institute of Cellular and Organismic Biology Academia Sinica 2 0.78205 0.77596 0.04076 0.03939 0.78248 0.78293 0.4586 0.46807 151 151 B B biological fallback assumption illumina nextseq_v2 unknown poly_a unknown bulk unknown unknown   Taiwan 2022-10-29 Larval Larval Skin Surface Structure
71775 71775 SRR22094617 SRX18074630 SRS15579665 SRP405171 PRJNA893397 RNA sequencing of the zebrafish superficial epithelial cells PRJNA893397 Other We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it "asynthetic fission". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.     replicate SEC 6dpf r SEC 6dpf r   strain:EK|age:6dpf|dev stage:6dpf|sex:NA|tissue:skin superficial epithelial cell|BioSampleModel:Model organism or animal                 RNA sequencing of zebrafish:superficial epithelial cells 6dpf replicate LTS21 YW02 LTS21 YW02 100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 2000   SRP405171     LTS21_YW02_S4_L001_R1_001.fastq.gz LTS21_YW02_S4_L001_R2_001.fastq.gz fastq fastq 20220291918.0 66954609.0 LTS21 YW02 S4 L001 R1 001.fastq.gz 0:151 1:151 A:5407749316;C:4807063001;G:4510753168;T:5477213837;N:17512596 151 151     5407749316 4807063001 4510753168 5477213837 17512596 SRX18074630 SRS15579665 SRA1530145 Academia Sinica|Institute of Cellular and Organismic Biology Academia Sinica 2 0.74742 0.74156 0.05378 0.05283 0.75118 0.75183 0.49329 0.49679 151 151 B B biological fallback assumption illumina nextseq_v2 unknown poly_a unknown bulk unknown unknown   Taiwan 2022-10-29 Larval Larval Skin Surface Structure
71776 71776 SRR22094618 SRX18074629 SRS15579664 SRP405171 PRJNA893397 RNA sequencing of the zebrafish superficial epithelial cells PRJNA893397 Other We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it "asynthetic fission". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.       SEC 6dpf Zebrafish SEC 6dpf   strain:EK|age:6dpf|dev stage:6dpf|sex:NA|tissue:Skin|BioSampleModel:Model organism or animal                 RNA sequencing of zebrafish:superficial epithelial cells 6dpf LTS21 YG02 LTS21 YG02 100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA NextSeq 2000   SRP405171     LTS21_YG02_S2_L001_R1_001.fastq.gz LTS21_YG02_S2_L001_R2_001.fastq.gz fastq fastq 20584419962.0 68160331.0 LTS21 YG02 S2 L001 R1 001.fastq.gz 0:151 1:151 A:5411222042;C:4935924238;G:4703040707;T:5516534305;N:17698670 151 151     5411222042 4935924238 4703040707 5516534305 17698670 SRX18074629 SRS15579664 SRA1530145 Academia Sinica|Institute of Cellular and Organismic Biology Academia Sinica 2 0.76895 0.7633 0.03985 0.03893 0.76481 0.76607 0.46945 0.46388 151 151 B B biological fallback assumption illumina nextseq_v2 unknown poly_a unknown bulk unknown unknown   Taiwan 2022-10-29 Larval Larval Skin Surface Structure
74043 74043 SRR23360139 SRX19301395 SRS16701439 SRP421311 PRJNA932229 Transcriptomic profiling of tissue environments critical for post embryonic patterning and morphogenesis of zebrafish skin GSE224695 Other Pigment patterns and skin appendages are prominent features of vertebrate skin. In zebrafish regularly patterned pigment stripes and an array of calcified scales form simultaneously in the skin during post embryonic development. Understanding mechanisms that regulate stripe patterning and scale morphogenesis may lead to discovery of fundamental mechanisms that govern development of animal form. To learn about cell types and potential signaling interactions that govern skin patterning and morphogenesis we generated and analyzed single cell transcriptomes of skin with genetic or induced defects in pigmentation and squamation. These data reveal a previously undescribed population of epidermal cells that express transcripts encoding enamel matrix proteins suggest hormonal control of epithelial mesenchymal signaling clarify the signaling network that governs scale papillae development and identify a critical role for the hypodermis in supporting pigment cell development. Additionally this comprehensive single cell transcriptome data from biomedically relevant skin conditions provide a useful resource to accelerate discovery of mechanisms governing skin development. Overall design: Dissected skin tissue from post embryonic zebrafish 9.6 SSL from four genetic backgrounds wild type eda mutant bnc2 mutant and hypothyroid were profiled with with sci RNA seq2.   pubmed:37695017   Multi genotype zebrafish skin snRNAseq GSM7029635   tissue:Whole skin tissue|cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid|geo loc name:missing|collection date:missing Multi genotype zebrafish skin snRNAseq The demultiplexing barcoded processing gene counting and aggregation were performed using the processing pipeline from Cao et al. 2017 doi: 10.1126/science.aam8940. Count matrix was loaded into Monocle3 for further analysis Assembly: GRCz11 Supplementary files format and content: Count Matrix RDS file Cell Metadata comma separated values .csv Gene Metadata comma separated values .csv Supplementary files format and content: zskin wildtype cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin wildtype raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin wildtype cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin wildtype gene metadata.csv: gene metadata table comma separated Supplementary files format and content: zskin all genotypes cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin all genotypes raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin all genotypes cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin all genotypes gene metadata.csv: gene metadata table comma separated Whole skin tissue Hypothyroid zebrafish Tgtg:nVenus v2a nfnBwprt8Tg underwent a metronidazole treatment to ablate the thyroid gland at 5 dpf. Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico. Zebrafish were raised at 28.5℃ and selected for dissection based on staging landmarks Parichy et al. 2009. cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid GSM7029635 GSM7029635: Multi genotype zebrafish skin snRNAseq; Danio rerio; RNA Seq GSM7029635 r1 GSM7029635 1 Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 550   SRP421311   loader:fastq load.py zskin_sciRNA_seq1_R2_merge.fastq.gz zskin_sciRNA_seq1_R1_merge.fastq.gz fastq fastq 11447467220.0 163535246.0 GSM7029635 r1 0:18 1:52 A:3502484926;C:2381891741;G:2327139583;T:3234563798;N:1387172 18 52     3502484926 2381891741 2327139583 3234563798 1387172 SRX19301395 SRS16701439 SRA1657186 Genome Sciences, University of Washington Genome Sciences, University of Washington 2 0.0 0.82847 0.0 0.51633 1.0 0.82692   0.58473 18 52 T B sc-like readlen illumina nextseq 3prime random_priming unknown sc single_cell_plate scirnaseq   United States 2023-02-07 Larval Larval Skin Surface Structure
74044 74044 SRR23360140 SRX19301395 SRS16701439 SRP421311 PRJNA932229 Transcriptomic profiling of tissue environments critical for post embryonic patterning and morphogenesis of zebrafish skin GSE224695 Other Pigment patterns and skin appendages are prominent features of vertebrate skin. In zebrafish regularly patterned pigment stripes and an array of calcified scales form simultaneously in the skin during post embryonic development. Understanding mechanisms that regulate stripe patterning and scale morphogenesis may lead to discovery of fundamental mechanisms that govern development of animal form. To learn about cell types and potential signaling interactions that govern skin patterning and morphogenesis we generated and analyzed single cell transcriptomes of skin with genetic or induced defects in pigmentation and squamation. These data reveal a previously undescribed population of epidermal cells that express transcripts encoding enamel matrix proteins suggest hormonal control of epithelial mesenchymal signaling clarify the signaling network that governs scale papillae development and identify a critical role for the hypodermis in supporting pigment cell development. Additionally this comprehensive single cell transcriptome data from biomedically relevant skin conditions provide a useful resource to accelerate discovery of mechanisms governing skin development. Overall design: Dissected skin tissue from post embryonic zebrafish 9.6 SSL from four genetic backgrounds wild type eda mutant bnc2 mutant and hypothyroid were profiled with with sci RNA seq2.   pubmed:37695017   Multi genotype zebrafish skin snRNAseq GSM7029635   tissue:Whole skin tissue|cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid|geo loc name:missing|collection date:missing Multi genotype zebrafish skin snRNAseq The demultiplexing barcoded processing gene counting and aggregation were performed using the processing pipeline from Cao et al. 2017 doi: 10.1126/science.aam8940. Count matrix was loaded into Monocle3 for further analysis Assembly: GRCz11 Supplementary files format and content: Count Matrix RDS file Cell Metadata comma separated values .csv Gene Metadata comma separated values .csv Supplementary files format and content: zskin wildtype cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin wildtype raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin wildtype cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin wildtype gene metadata.csv: gene metadata table comma separated Supplementary files format and content: zskin all genotypes cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin all genotypes raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin all genotypes cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin all genotypes gene metadata.csv: gene metadata table comma separated Whole skin tissue Hypothyroid zebrafish Tgtg:nVenus v2a nfnBwprt8Tg underwent a metronidazole treatment to ablate the thyroid gland at 5 dpf. Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico. Zebrafish were raised at 28.5℃ and selected for dissection based on staging landmarks Parichy et al. 2009. cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid GSM7029635 GSM7029635: Multi genotype zebrafish skin snRNAseq; Danio rerio; RNA Seq GSM7029635 r1 GSM7029635 1 Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 550   SRP421311   loader:fastq load.py zskin_sciRNA_seq2_R1_merge.fastq.gz zskin_sciRNA_seq2_R2_merge.fastq.gz fastq fastq 36112843060.0 515897758.0 GSM7029635 r2 0:18 1:52 A:10807852102;C:7597254398;G:7380368668;T:10325233398;N:2134494 18 52     10807852102 7597254398 7380368668 10325233398 2134494 SRX19301395 SRS16701439 SRA1657186 Genome Sciences, University of Washington Genome Sciences, University of Washington 2 0.0 0.84202 0.0 0.54094 1.0 0.8411   0.58834 18 52 T B sc-like readlen illumina nextseq 3prime random_priming unknown sc single_cell_plate scirnaseq   United States 2023-02-07 Larval Larval Skin Surface Structure
74045 74045 SRR23360141 SRX19301395 SRS16701439 SRP421311 PRJNA932229 Transcriptomic profiling of tissue environments critical for post embryonic patterning and morphogenesis of zebrafish skin GSE224695 Other Pigment patterns and skin appendages are prominent features of vertebrate skin. In zebrafish regularly patterned pigment stripes and an array of calcified scales form simultaneously in the skin during post embryonic development. Understanding mechanisms that regulate stripe patterning and scale morphogenesis may lead to discovery of fundamental mechanisms that govern development of animal form. To learn about cell types and potential signaling interactions that govern skin patterning and morphogenesis we generated and analyzed single cell transcriptomes of skin with genetic or induced defects in pigmentation and squamation. These data reveal a previously undescribed population of epidermal cells that express transcripts encoding enamel matrix proteins suggest hormonal control of epithelial mesenchymal signaling clarify the signaling network that governs scale papillae development and identify a critical role for the hypodermis in supporting pigment cell development. Additionally this comprehensive single cell transcriptome data from biomedically relevant skin conditions provide a useful resource to accelerate discovery of mechanisms governing skin development. Overall design: Dissected skin tissue from post embryonic zebrafish 9.6 SSL from four genetic backgrounds wild type eda mutant bnc2 mutant and hypothyroid were profiled with with sci RNA seq2.   pubmed:37695017   Multi genotype zebrafish skin snRNAseq GSM7029635   tissue:Whole skin tissue|cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid|geo loc name:missing|collection date:missing Multi genotype zebrafish skin snRNAseq The demultiplexing barcoded processing gene counting and aggregation were performed using the processing pipeline from Cao et al. 2017 doi: 10.1126/science.aam8940. Count matrix was loaded into Monocle3 for further analysis Assembly: GRCz11 Supplementary files format and content: Count Matrix RDS file Cell Metadata comma separated values .csv Gene Metadata comma separated values .csv Supplementary files format and content: zskin wildtype cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin wildtype raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin wildtype cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin wildtype gene metadata.csv: gene metadata table comma separated Supplementary files format and content: zskin all genotypes cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin all genotypes raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin all genotypes cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin all genotypes gene metadata.csv: gene metadata table comma separated Whole skin tissue Hypothyroid zebrafish Tgtg:nVenus v2a nfnBwprt8Tg underwent a metronidazole treatment to ablate the thyroid gland at 5 dpf. Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico. Zebrafish were raised at 28.5℃ and selected for dissection based on staging landmarks Parichy et al. 2009. cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid GSM7029635 GSM7029635: Multi genotype zebrafish skin snRNAseq; Danio rerio; RNA Seq GSM7029635 r1 GSM7029635 1 Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 550   SRP421311   loader:fastq load.py zskin_sciRNA_seq3_R2_merge.fastq.gz zskin_sciRNA_seq3_R1_merge.fastq.gz fastq fastq 23819946500.0 340284950.0 GSM7029635 r3 0:18 1:52 A:7652488300;C:4862634258;G:4789709798;T:6501533014;N:13581130 18 52     7652488300 4862634258 4789709798 6501533014 13581130 SRX19301395 SRS16701439 SRA1657186 Genome Sciences, University of Washington Genome Sciences, University of Washington 2 0.0 0.83093 0.0 0.53155 1.0 0.82986   0.59518 18 52 T B sc-like readlen illumina nextseq 3prime random_priming unknown sc single_cell_plate scirnaseq   United States 2023-02-07 Larval Larval Skin Surface Structure
74046 74046 SRR23360142 SRX19301395 SRS16701439 SRP421311 PRJNA932229 Transcriptomic profiling of tissue environments critical for post embryonic patterning and morphogenesis of zebrafish skin GSE224695 Other Pigment patterns and skin appendages are prominent features of vertebrate skin. In zebrafish regularly patterned pigment stripes and an array of calcified scales form simultaneously in the skin during post embryonic development. Understanding mechanisms that regulate stripe patterning and scale morphogenesis may lead to discovery of fundamental mechanisms that govern development of animal form. To learn about cell types and potential signaling interactions that govern skin patterning and morphogenesis we generated and analyzed single cell transcriptomes of skin with genetic or induced defects in pigmentation and squamation. These data reveal a previously undescribed population of epidermal cells that express transcripts encoding enamel matrix proteins suggest hormonal control of epithelial mesenchymal signaling clarify the signaling network that governs scale papillae development and identify a critical role for the hypodermis in supporting pigment cell development. Additionally this comprehensive single cell transcriptome data from biomedically relevant skin conditions provide a useful resource to accelerate discovery of mechanisms governing skin development. Overall design: Dissected skin tissue from post embryonic zebrafish 9.6 SSL from four genetic backgrounds wild type eda mutant bnc2 mutant and hypothyroid were profiled with with sci RNA seq2.   pubmed:37695017   Multi genotype zebrafish skin snRNAseq GSM7029635   tissue:Whole skin tissue|cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid|geo loc name:missing|collection date:missing Multi genotype zebrafish skin snRNAseq The demultiplexing barcoded processing gene counting and aggregation were performed using the processing pipeline from Cao et al. 2017 doi: 10.1126/science.aam8940. Count matrix was loaded into Monocle3 for further analysis Assembly: GRCz11 Supplementary files format and content: Count Matrix RDS file Cell Metadata comma separated values .csv Gene Metadata comma separated values .csv Supplementary files format and content: zskin wildtype cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin wildtype raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin wildtype cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin wildtype gene metadata.csv: gene metadata table comma separated Supplementary files format and content: zskin all genotypes cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin all genotypes raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin all genotypes cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin all genotypes gene metadata.csv: gene metadata table comma separated Whole skin tissue Hypothyroid zebrafish Tgtg:nVenus v2a nfnBwprt8Tg underwent a metronidazole treatment to ablate the thyroid gland at 5 dpf. Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico. Zebrafish were raised at 28.5℃ and selected for dissection based on staging landmarks Parichy et al. 2009. cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid GSM7029635 GSM7029635: Multi genotype zebrafish skin snRNAseq; Danio rerio; RNA Seq GSM7029635 r1 GSM7029635 1 Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 550   SRP421311   loader:fastq load.py zskin_sciRNA_seq4_R1_merge.fastq.gz zskin_sciRNA_seq4_R2_merge.fastq.gz fastq fastq 33417347600.0 477390680.0 GSM7029635 r4 0:18 1:52 A:10992313767;C:6719060839;G:6813342549;T:8874815927;N:17814518 18 52     10992313767 6719060839 6813342549 8874815927 17814518 SRX19301395 SRS16701439 SRA1657186 Genome Sciences, University of Washington Genome Sciences, University of Washington 2 0.0 0.7972 0.0 0.51142 1.0 0.84435   0.56962 18 52 T B sc-like readlen illumina nextseq 3prime random_priming unknown sc single_cell_plate scirnaseq   United States 2023-02-07 Larval Larval Skin Surface Structure

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;