RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

332 rows where devstage_curation = "Larval" and tissue_curation = "Liver"

✎ View and edit SQL

This data as json, CSV (advanced)

technology 5

experiment.library_selection 4

experiment.platform 2

experiment.library_strategy 2

experiment.library_source 2

experiment.library_layout 2

tissue_curation_coarse 1

tissue_curation 1

  • Liver · 332 ✖

devstage_curation_coarse 1

devstage_curation 1

  • Larval · 332 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
171 171 DRR075399 DRX069313 DRS075494 DRP004473 PRJDB5226 Effects of local gut tumor on whole organismal gene expressions in zebrafish DRP004473 Other How tumors affects whole organismal physiology remains largely unknown. To address this we established the novel gut tumor model in zebrafish Danio rerio. This model develops tumor at an early stage of juvenile development when zebrafish larvae are small <4mm enabling us to perform whole organismal RNA seq experiments. Control or tumor bearing zebrafish were dissected into the three parts under microscope: the liver the gut/gut tumor and others. Tissues from >10 individuals were pooled and RNA extracted. Analyses on these RNA seq samples identified a set of host genes affected by the gut tumor contributing to discovering novel tumor organ interactions and their mediators in zebrafish.     The liver of control fish 7dpf Control liver SAMD00065413   sample name:3 control liver 150701 Hiseq3A l3 019|tissue type:Liver                 Illumina HiSeq 2500 sequencing of SAMD00065413 DRX069313 Control liver 1 Agilent SureSelect Strand Specific RNA Prep Kit   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP004473 Illumina HiSeq 2500 sequencing of SAMD00065413       951579036.0 26432751.0 DRR075399 0:36 A:231570583;C:228182815;G:227223430;T:264569214;N:32994 36       231570583 228182815 227223430 264569214 32994 DRX069313 DRS075494 DRA005199 ATR|The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International The Thomas N. Sato BioMEC-X Laboratories, Advanced Telecommunications Research Institute International 1 0.8903   0.08667   0.7236   0.51557   36   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   Japan 2018-09-19 Larval Larval Liver Liver and Biliary System
8104 8104 ERR2455366 ERX2474426 ERS2327331 ERP107743 PRJEB25789 RNA seq of zebrafish larvae fed with different diets E-MTAB-6636 Transcriptome Analysis We aim to establish NAFLD model of Zebrafish. Zebrafish larvae fed with high cholesterol diet high fructose diet and overfeed diet to induce liver steatosis. RNA seq was employed to analyze the effects of different diets on NAFLD development. ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 03 29   Protocols: Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. Sample 4 SAMEA104725948 Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College ENA FIRST PUBLIC:2018 12 01T17:02:09Z|ENA LAST UPDATE:2018 03 29T12:32:24Z|External Id:SAMEA104725948|INSDC center name:Institute of Medicinal Biotechnology Chinese Academy of Medical Sciences and Peking Union Medical College|INSDC first public:2018 12 01T17:02:09Z|INSDC last update:2018 03 29T12:32:24Z|INSDC status:public|Submitter Id:E MTAB 6636:Sample 4|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|diet:overfeeding|organism part:liver|sample name:E MTAB 6636:Sample 4|scientific name:Danio rerio                 Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets E MTAB 6636:Sample 4 s Sample 4 s RNA seq of zebrafish larvae fed with different diets Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. Experimental Factor: diet:overfeeding RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   ERP107743 Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 11 16 OF-4_H7MWNALXX_L6_1.fq.gz fastq 4961276550.0 33075177.0 E MTAB 6636:Sample 4 0:150 1:0 A:1349413168;C:1135314970;G:1137935563;T:1338034716;N:578133 150 0     1349413168 1135314970 1137935563 1338034716 578133 ERX2474426 ERS2327331 ERA1259907 Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive 1 0.90787   0.11999   0.66123   0.49072   150   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2018-03-29 Larval Larval Liver Liver and Biliary System
8105 8105 ERR2455365 ERX2474425 ERS2327330 ERP107743 PRJEB25789 RNA seq of zebrafish larvae fed with different diets E-MTAB-6636 Transcriptome Analysis We aim to establish NAFLD model of Zebrafish. Zebrafish larvae fed with high cholesterol diet high fructose diet and overfeed diet to induce liver steatosis. RNA seq was employed to analyze the effects of different diets on NAFLD development. ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 03 29   Protocols: Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. Sample 3 SAMEA104725947 Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College ENA FIRST PUBLIC:2018 12 01T17:02:09Z|ENA LAST UPDATE:2018 03 29T12:32:24Z|External Id:SAMEA104725947|INSDC center name:Institute of Medicinal Biotechnology Chinese Academy of Medical Sciences and Peking Union Medical College|INSDC first public:2018 12 01T17:02:09Z|INSDC last update:2018 03 29T12:32:24Z|INSDC status:public|Submitter Id:E MTAB 6636:Sample 3|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|diet:fructose|organism part:liver|sample name:E MTAB 6636:Sample 3|scientific name:Danio rerio                 Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets E MTAB 6636:Sample 3 s Sample 3 s RNA seq of zebrafish larvae fed with different diets Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. Experimental Factor: diet:fructose RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   ERP107743 Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 11 16 Fru-3_H7MWNALXX_L5_1.fq.gz fastq 5858273250.0 39055155.0 E MTAB 6636:Sample 3 0:150 1:0 A:1580150663;C:1353221682;G:1355865524;T:1568428138;N:607243 150 0     1580150663 1353221682 1355865524 1568428138 607243 ERX2474425 ERS2327330 ERA1259907 Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive 1 0.91505   0.11036   0.65985   0.48443   150   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2018-03-29 Larval Larval Liver Liver and Biliary System
8106 8106 ERR2455364 ERX2474424 ERS2327329 ERP107743 PRJEB25789 RNA seq of zebrafish larvae fed with different diets E-MTAB-6636 Transcriptome Analysis We aim to establish NAFLD model of Zebrafish. Zebrafish larvae fed with high cholesterol diet high fructose diet and overfeed diet to induce liver steatosis. RNA seq was employed to analyze the effects of different diets on NAFLD development. ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 03 29   Protocols: Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. Sample 2 SAMEA104725946 Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College ENA FIRST PUBLIC:2018 12 01T17:02:09Z|ENA LAST UPDATE:2018 03 29T12:32:24Z|External Id:SAMEA104725946|INSDC center name:Institute of Medicinal Biotechnology Chinese Academy of Medical Sciences and Peking Union Medical College|INSDC first public:2018 12 01T17:02:09Z|INSDC last update:2018 03 29T12:32:24Z|INSDC status:public|Submitter Id:E MTAB 6636:Sample 2|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|diet:cholesterol|organism part:liver|sample name:E MTAB 6636:Sample 2|scientific name:Danio rerio                 Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets E MTAB 6636:Sample 2 s Sample 2 s RNA seq of zebrafish larvae fed with different diets Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. Experimental Factor: diet:cholesterol RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   ERP107743 Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 11 16 Cho-2_H7MWNALXX_L5_1.fq.gz fastq 5636304900.0 37575366.0 E MTAB 6636:Sample 2 0:150 1:0 A:1526862069;C:1295343770;G:1298751994;T:1514766898;N:580169 150 0     1526862069 1295343770 1298751994 1514766898 580169 ERX2474424 ERS2327329 ERA1259907 Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive 1 0.91032   0.11644   0.66649   0.47766   150   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2018-03-29 Larval Larval Liver Liver and Biliary System
8107 8107 ERR2455363 ERX2474423 ERS2327328 ERP107743 PRJEB25789 RNA seq of zebrafish larvae fed with different diets E-MTAB-6636 Transcriptome Analysis We aim to establish NAFLD model of Zebrafish. Zebrafish larvae fed with high cholesterol diet high fructose diet and overfeed diet to induce liver steatosis. RNA seq was employed to analyze the effects of different diets on NAFLD development. ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 03 29   Protocols: Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. Sample 1 SAMEA104725945 Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College ENA FIRST PUBLIC:2018 12 01T17:02:09Z|ENA LAST UPDATE:2018 03 29T12:32:24Z|External Id:SAMEA104725945|INSDC center name:Institute of Medicinal Biotechnology Chinese Academy of Medical Sciences and Peking Union Medical College|INSDC first public:2018 12 01T17:02:09Z|INSDC last update:2018 03 29T12:32:24Z|INSDC status:public|Submitter Id:E MTAB 6636:Sample 1|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval stage|diet:control|organism part:liver|sample name:E MTAB 6636:Sample 1|scientific name:Danio rerio                 Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets E MTAB 6636:Sample 1 s Sample 1 s RNA seq of zebrafish larvae fed with different diets Total RNAs were extracted from liver tissues of zebrafish larvae. A total amount of 1.5μg RNA per sample was used as input material for the RNA sample preparations. Briefly mRNA was purified from total RNA using poly T oligo attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB. Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® NEB USA following manufacturer's recommendations and index codes were added to attribute sequences to each sample. Experimental Factor: diet:control RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 4000   ERP107743 Illumina HiSeq 4000 sequencing; RNA seq of zebrafish larvae fed with different diets ENA FIRST PUBLIC:2018 12 01|ENA LAST UPDATE:2018 11 16 ND-1_H7MWNALXX_L5_1.fq.gz fastq 5197165350.0 34647769.0 E MTAB 6636:Sample 1 0:150 1:0 A:1430911816;C:1174811274;G:1175616551;T:1415284019;N:541690 150 0     1430911816 1174811274 1175616551 1415284019 541690 ERX2474423 ERS2327328 ERA1259907 Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College|European Nucleotide Archive 1 0.89838   0.13883   0.66129   0.48467   150   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2018-03-29 Larval Larval Liver Liver and Biliary System
28955 28955 SRR26862014 SRX22556964 SRS19565505 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   atf4a / ;atf4b / ;sec31anju221 7dpf liver rep3 GSM7905882   source name:liver|tissue:liver|genotype:atf4a / ;atf4b / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing atf4a / ;atf4b / ;sec31anju221 7dpf liver rep3 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:atf4a / ;atf4b / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905882 GSM7905882: atf4a / ;atf4b / ;sec31anju221 7dpf liver rep3; Danio rerio; RNA Seq GSM7905882 r1 GSM7905882 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     atf4a_atf4b_sec31a_7dpf_liver_3_R1.fastq.gz atf4a_atf4b_sec31a_7dpf_liver_3_R2.fastq.gz fastq fastq 5909169300.0 19697231.0 GSM7905882 r1 0:150 1:150 A:1814217313;C:1062889607;G:1281434828;T:1750535462;N:92090 150 150     1814217313 1062889607 1281434828 1750535462 92090 SRX22556964 SRS19565505 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.76999 0.77426 0.42801 0.42392 0.8016 0.80275 0.54736 0.56955 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28956 28956 SRR26862015 SRX22556963 SRS19565504 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   atf4a / ;atf4b / ;sec31anju221 7dpf liver rep2 GSM7905881   source name:liver|tissue:liver|genotype:atf4a / ;atf4b / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing atf4a / ;atf4b / ;sec31anju221 7dpf liver rep2 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:atf4a / ;atf4b / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905881 GSM7905881: atf4a / ;atf4b / ;sec31anju221 7dpf liver rep2; Danio rerio; RNA Seq GSM7905881 r1 GSM7905881 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     atf4a_atf4b_sec31a_7dpf_liver_2_R2.fastq.gz atf4a_atf4b_sec31a_7dpf_liver_2_R1.fastq.gz fastq fastq 5909169300.0 19697231.0 GSM7905881 r1 0:150 1:150 A:1814304871;C:1062851267;G:1281344920;T:1750575670;N:92572 150 150     1814304871 1062851267 1281344920 1750575670 92572 SRX22556963 SRS19565504 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.77 0.77338 0.42787 0.42319 0.80137 0.80314 0.56997 0.57195 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28957 28957 SRR26862016 SRX22556962 SRS19565503 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   atf4a / ;atf4b / ;sec31anju221 7dpf liver rep1 GSM7905880   source name:liver|tissue:liver|genotype:atf4a / ;atf4b / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing atf4a / ;atf4b / ;sec31anju221 7dpf liver rep1 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:atf4a / ;atf4b / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905880 GSM7905880: atf4a / ;atf4b / ;sec31anju221 7dpf liver rep1; Danio rerio; RNA Seq GSM7905880 r1 GSM7905880 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     atf4a_atf4b_sec31a_7dpf_liver_1_R1.fastq.gz atf4a_atf4b_sec31a_7dpf_liver_1_R2.fastq.gz fastq fastq 5909169600.0 19697232.0 GSM7905880 r1 0:150 1:150 A:1814273460;C:1062781687;G:1281372048;T:1750650699;N:91706 150 150     1814273460 1062781687 1281372048 1750650699 91706 SRX22556962 SRS19565503 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.76973 0.77461 0.42583 0.42416 0.80154 0.80501 0.56619 0.57103 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28958 28958 SRR26862017 SRX22556961 SRS19565502 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   atf6 / ;sec31anju221 7dpf liver rep3 GSM7905879   source name:liver|tissue:liver|genotype:atf6 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing atf6 / ;sec31anju221 7dpf liver rep3 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:atf6 / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905879 GSM7905879: atf6 / ;sec31anju221 7dpf liver rep3; Danio rerio; RNA Seq GSM7905879 r1 GSM7905879 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     atf6_sec31a_7dpf_liver_3_R1.fastq.gz atf6_sec31a_7dpf_liver_3_R2.fastq.gz fastq fastq 5861267700.0 19537559.0 GSM7905879 r1 0:150 1:150 A:1784341701;C:1072473445;G:1285100764;T:1719260200;N:91590 150 150     1784341701 1072473445 1285100764 1719260200 91590 SRX22556961 SRS19565502 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.75325 0.76151 0.45725 0.45689 0.78798 0.78922 0.56218 0.56438 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28959 28959 SRR26862018 SRX22556960 SRS19565501 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   atf6 / ;sec31anju221 7dpf liver rep2 GSM7905878   source name:liver|tissue:liver|genotype:atf6 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing atf6 / ;sec31anju221 7dpf liver rep2 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:atf6 / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905878 GSM7905878: atf6 / ;sec31anju221 7dpf liver rep2; Danio rerio; RNA Seq GSM7905878 r1 GSM7905878 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     atf6_sec31a_7dpf_liver_2_R1.fastq.gz atf6_sec31a_7dpf_liver_2_R2.fastq.gz fastq fastq 5861267700.0 19537559.0 GSM7905878 r1 0:150 1:150 A:1784326758;C:1072428588;G:1285145147;T:1719275142;N:92065 150 150     1784326758 1072428588 1285145147 1719275142 92065 SRX22556960 SRS19565501 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.75399 0.76366 0.46023 0.46101 0.79153 0.79243 0.56082 0.56109 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28960 28960 SRR26862019 SRX22556959 SRS19565500 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   atf6 / ;sec31anju221 7dpf liver rep1 GSM7905877   source name:liver|tissue:liver|genotype:atf6 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing atf6 / ;sec31anju221 7dpf liver rep1 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:atf6 / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905877 GSM7905877: atf6 / ;sec31anju221 7dpf liver rep1; Danio rerio; RNA Seq GSM7905877 r1 GSM7905877 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     atf6_sec31a_7dpf_liver_1_R1.fastq.gz atf6_sec31a_7dpf_liver_1_R2.fastq.gz fastq fastq 5861267700.0 19537559.0 GSM7905877 r1 0:150 1:150 A:1784239507;C:1072424839;G:1285216751;T:1719294746;N:91857 150 150     1784239507 1072424839 1285216751 1719294746 91857 SRX22556959 SRS19565500 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.75279 0.76268 0.45792 0.46002 0.79251 0.79482 0.55778 0.55965 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28961 28961 SRR26862020 SRX22556958 SRS19565499 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   srebf2 / ;sec31anju221 7dpf liver rep3 GSM7905876   source name:liver|tissue:liver|genotype:srebf2 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing srebf2 / ;sec31anju221 7dpf liver rep3 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:srebf2 / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905876 GSM7905876: srebf2 / ;sec31anju221 7dpf liver rep3; Danio rerio; RNA Seq GSM7905876 r1 GSM7905876 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     srebf2_sec31a_7dpf_liver_3_R2.fastq.gz srebf2_sec31a_7dpf_liver_3_R1.fastq.gz fastq fastq 5510352000.0 18367840.0 GSM7905876 r1 0:150 1:150 A:1627756472;C:1023474678;G:1300851324;T:1558184587;N:84939 150 150     1627756472 1023474678 1300851324 1558184587 84939 SRX22556958 SRS19565499 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.80994 0.82412 0.13867 0.1397 0.84264 0.84228 0.58499 0.58509 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28962 28962 SRR26862021 SRX22556957 SRS19565498 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   srebf2 / ;sec31anju221 7dpf liver rep2 GSM7905875   source name:liver|tissue:liver|genotype:srebf2 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing srebf2 / ;sec31anju221 7dpf liver rep2 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:srebf2 / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905875 GSM7905875: srebf2 / ;sec31anju221 7dpf liver rep2; Danio rerio; RNA Seq GSM7905875 r1 GSM7905875 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     srebf2_sec31a_7dpf_liver_2_R1.fastq.gz srebf2_sec31a_7dpf_liver_2_R2.fastq.gz fastq fastq 5510352000.0 18367840.0 GSM7905875 r1 0:150 1:150 A:1627771682;C:1023494582;G:1300898781;T:1558101507;N:85448 150 150     1627771682 1023494582 1300898781 1558101507 85448 SRX22556957 SRS19565498 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.81036 0.82384 0.14055 0.13973 0.84151 0.84145 0.58974 0.57294 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28963 28963 SRR26862022 SRX22556956 SRS19565497 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   srebf2 / ;sec31anju221 7dpf liver rep1 GSM7905874   source name:liver|tissue:liver|genotype:srebf2 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing srebf2 / ;sec31anju221 7dpf liver rep1 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:srebf2 / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905874 GSM7905874: srebf2 / ;sec31anju221 7dpf liver rep1; Danio rerio; RNA Seq GSM7905874 r1 GSM7905874 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     srebf2_sec31a_7dpf_liver_1_R1.fastq.gz srebf2_sec31a_7dpf_liver_1_R2.fastq.gz fastq fastq 5510352300.0 18367841.0 GSM7905874 r1 0:150 1:150 A:1627704384;C:1023445689;G:1301022904;T:1558092507;N:86816 150 150     1627704384 1023445689 1301022904 1558092507 86816 SRX22556956 SRS19565497 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.81137 0.82447 0.13931 0.13977 0.84104 0.84129 0.58031 0.57864 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28964 28964 SRR26862023 SRX22556955 SRS19565496 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   srebf1 / ;sec31anju221 7dpf liver rep3 GSM7905873   source name:liver|tissue:liver|genotype:srebf1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing srebf1 / ;sec31anju221 7dpf liver rep3 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:srebf1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905873 GSM7905873: srebf1 / ;sec31anju221 7dpf liver rep3; Danio rerio; RNA Seq GSM7905873 r1 GSM7905873 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     srebf1_sec31a_7dpf_liver_3_R1.fastq.gz srebf1_sec31a_7dpf_liver_3_R2.fastq.gz fastq fastq 6400097700.0 21333659.0 GSM7905873 r1 0:150 1:150 A:1899190871;C:1190525037;G:1467138729;T:1843142069;N:100994 150 150     1899190871 1190525037 1467138729 1843142069 100994 SRX22556955 SRS19565496 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.81425 0.82461 0.21108 0.21197 0.82221 0.82323 0.56957 0.594 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28965 28965 SRR26862024 SRX22556954 SRS19565495 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   srebf1 / ;sec31anju221 7dpf liver rep2 GSM7905872   source name:liver|tissue:liver|genotype:srebf1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing srebf1 / ;sec31anju221 7dpf liver rep2 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:srebf1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905872 GSM7905872: srebf1 / ;sec31anju221 7dpf liver rep2; Danio rerio; RNA Seq GSM7905872 r1 GSM7905872 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     srebf1_sec31a_7dpf_liver_2_R1.fastq.gz srebf1_sec31a_7dpf_liver_2_R2.fastq.gz fastq fastq 6400098000.0 21333660.0 GSM7905872 r1 0:150 1:150 A:1898994954;C:1190735681;G:1467311615;T:1842955236;N:100514 150 150     1898994954 1190735681 1467311615 1842955236 100514 SRX22556954 SRS19565495 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.81439 0.82458 0.20976 0.20983 0.82252 0.82278 0.57027 0.58785 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28966 28966 SRR26862025 SRX22556953 SRS19565494 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   srebf1 / ;sec31anju221 7dpf liver rep1 GSM7905871   source name:liver|tissue:liver|genotype:srebf1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing srebf1 / ;sec31anju221 7dpf liver rep1 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:srebf1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905871 GSM7905871: srebf1 / ;sec31anju221 7dpf liver rep1; Danio rerio; RNA Seq GSM7905871 r1 GSM7905871 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     srebf1_sec31a_7dpf_liver_1_R1.fastq.gz srebf1_sec31a_7dpf_liver_1_R2.fastq.gz fastq fastq 6400098000.0 21333660.0 GSM7905871 r1 0:150 1:150 A:1899112598;C:1190526850;G:1467278074;T:1843080128;N:100350 150 150     1899112598 1190526850 1467278074 1843080128 100350 SRX22556953 SRS19565494 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.81419 0.82464 0.20997 0.21061 0.82317 0.82296 0.57794 0.57323 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28967 28967 SRR26862026 SRX22556952 SRS19565493 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   xbp1 / ;sec31anju221 7dpf liver rep3 GSM7905870   source name:liver|tissue:liver|genotype:xbp1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing xbp1 / ;sec31anju221 7dpf liver rep3 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:xbp1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905870 GSM7905870: xbp1 / ;sec31anju221 7dpf liver rep3; Danio rerio; RNA Seq GSM7905870 r1 GSM7905870 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     xbp1_sec31a_7dpf_liver_3_R1.fastq.gz xbp1_sec31a_7dpf_liver_3_R2.fastq.gz fastq fastq 6187152600.0 20623842.0 GSM7905870 r1 0:150 1:150 A:1877363692;C:1115080777;G:1381299595;T:1812977195;N:431341 150 150     1877363692 1115080777 1381299595 1812977195 431341 SRX22556952 SRS19565493 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.76954 0.76951 0.43867 0.43143 0.77993 0.78291 0.54133 0.5381 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28968 28968 SRR26862027 SRX22556951 SRS19565492 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   xbp1 / ;sec31anju221 7dpf liver rep2 GSM7905869   source name:liver|tissue:liver|genotype:xbp1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing xbp1 / ;sec31anju221 7dpf liver rep2 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:xbp1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905869 GSM7905869: xbp1 / ;sec31anju221 7dpf liver rep2; Danio rerio; RNA Seq GSM7905869 r1 GSM7905869 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     xbp1_sec31a_7dpf_liver_2_R1.fastq.gz xbp1_sec31a_7dpf_liver_2_R2.fastq.gz fastq fastq 6187152600.0 20623842.0 GSM7905869 r1 0:150 1:150 A:1877413505;C:1115113811;G:1381185230;T:1813009192;N:430862 150 150     1877413505 1115113811 1381185230 1813009192 430862 SRX22556951 SRS19565492 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.77052 0.77186 0.4375 0.43158 0.77857 0.78376 0.54778 0.54495 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28969 28969 SRR26862028 SRX22556950 SRS19565491 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   xbp1 / ;sec31anju221 7dpf liver rep1 GSM7905868   source name:liver|tissue:liver|genotype:xbp1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing xbp1 / ;sec31anju221 7dpf liver rep1 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:xbp1 / ;sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905868 GSM7905868: xbp1 / ;sec31anju221 7dpf liver rep1; Danio rerio; RNA Seq GSM7905868 r1 GSM7905868 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     xbp1_sec31a_7dpf_liver_1_R1.fastq.gz xbp1_sec31a_7dpf_liver_1_R2.fastq.gz fastq fastq 6187152900.0 20623843.0 GSM7905868 r1 0:150 1:150 A:1877304250;C:1115136591;G:1381366555;T:1812912124;N:433380 150 150     1877304250 1115136591 1381366555 1812912124 433380 SRX22556950 SRS19565491 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.77014 0.76961 0.43869 0.43265 0.77863 0.78293 0.54465 0.54127 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28970 28970 SRR26862029 SRX22556949 SRS19565490 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   sec31anju221 7dpf liver rep3 GSM7905867   source name:liver|tissue:liver|genotype:sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing sec31anju221 7dpf liver rep3 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905867 GSM7905867: sec31anju221 7dpf liver rep3; Danio rerio; RNA Seq GSM7905867 r1 GSM7905867 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     sec31a_7dpf_liver_3_R1.fastq.gz sec31a_7dpf_liver_3_R2.fastq.gz fastq fastq 7290483000.0 24301610.0 GSM7905867 r1 0:150 1:150 A:2201443580;C:1310250352;G:1667114316;T:2111120776;N:553976 150 150     2201443580 1310250352 1667114316 2111120776 553976 SRX22556949 SRS19565490 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.80458 0.80677 0.27528 0.27217 0.8228 0.82507 0.58018 0.57745 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28971 28971 SRR26862030 SRX22556948 SRS19565489 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   sec31anju221 7dpf liver rep2 GSM7905866   source name:liver|tissue:liver|genotype:sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing sec31anju221 7dpf liver rep2 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905866 GSM7905866: sec31anju221 7dpf liver rep2; Danio rerio; RNA Seq GSM7905866 r1 GSM7905866 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     sec31a_7dpf_liver_2_R1.fastq.gz sec31a_7dpf_liver_2_R2.fastq.gz fastq fastq 7290483300.0 24301611.0 GSM7905866 r1 0:150 1:150 A:2201546187;C:1310316929;G:1666786006;T:2111279666;N:554512 150 150     2201546187 1310316929 1666786006 2111279666 554512 SRX22556948 SRS19565489 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.80528 0.80845 0.27376 0.27196 0.82286 0.82451 0.58075 0.57876 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28972 28972 SRR26862031 SRX22556947 SRS19565488 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   sec31anju221 7dpf liver rep1 GSM7905865   source name:liver|tissue:liver|genotype:sec31anju221|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing sec31anju221 7dpf liver rep1 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:sec31anju221|treatment:Digested with 2.5percent trypsin GSM7905865 GSM7905865: sec31anju221 7dpf liver rep1; Danio rerio; RNA Seq GSM7905865 r1 GSM7905865 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     sec31a_7dpf_liver_1_R2.fastq.gz sec31a_7dpf_liver_1_R1.fastq.gz fastq fastq 7290483300.0 24301611.0 GSM7905865 r1 0:150 1:150 A:2201492232;C:1310255361;G:1666931918;T:2111261791;N:541998 150 150     2201492232 1310255361 1666931918 2111261791 541998 SRX22556947 SRS19565488 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.80672 0.80946 0.27449 0.27121 0.82026 0.82238 0.58542 0.58114 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28973 28973 SRR26862032 SRX22556946 SRS19565487 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   WT 7dpf liver rep3 GSM7905864   source name:liver|tissue:liver|genotype:wild type|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing WT 7dpf liver rep3 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:wild type|treatment:Digested with 2.5percent trypsin GSM7905864 GSM7905864: WT 7dpf liver rep3; Danio rerio; RNA Seq GSM7905864 r1 GSM7905864 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     ctrl_7dpf_liver_3_R1.fastq.gz ctrl_7dpf_liver_3_R2.fastq.gz fastq fastq 6492651600.0 21642172.0 GSM7905864 r1 0:150 1:150 A:1911454132;C:1210565181;G:1559325152;T:1810846037;N:461098 150 150     1911454132 1210565181 1559325152 1810846037 461098 SRX22556946 SRS19565487 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.83482 0.84576 0.18949 0.18912 0.84853 0.84914 0.67518 0.67721 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28974 28974 SRR26862033 SRX22556945 SRS19565486 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   WT 7dpf liver rep2 GSM7905863   source name:liver|tissue:liver|genotype:wild type|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing WT 7dpf liver rep2 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:wild type|treatment:Digested with 2.5percent trypsin GSM7905863 GSM7905863: WT 7dpf liver rep2; Danio rerio; RNA Seq GSM7905863 r1 GSM7905863 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     ctrl_7dpf_liver_2_R1.fastq.gz ctrl_7dpf_liver_2_R2.fastq.gz fastq fastq 6492651600.0 21642172.0 GSM7905863 r1 0:150 1:150 A:1911298884;C:1210698281;G:1559339763;T:1810859879;N:454793 150 150     1911298884 1210698281 1559339763 1810859879 454793 SRX22556945 SRS19565486 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.83478 0.84217 0.19106 0.18909 0.84642 0.84717 0.67888 0.67654 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
28975 28975 SRR26862034 SRX22556944 SRS19565485 SRP472550 PRJNA1041773 Transcriptome profiles of liver from 7dpf zebrafish larvae from control sec31anju221 and double mutation of sec31anju221 and UPR effectors by Next Generation Sequencing GSE248098 Transcriptome Analysis We found that zebrafish larvae bearing a homozygous hypomorphic mutation in the sec31a gene sec31anju221 exhibited hepatic steatosis accompanied with activation of unfolded protein response UPR. As systematic efforts to investigate how different branches of UPR impact on the hepatic metabolic maladaptation critical effectors of the UPR xbp1 atf4a/4b atf6 srebf1 and srebf2 were separately knock outed on sec31anju221 background. In order to access the changes on transcriptome landscape livers were dissected from the 7 dpf zebrafish larvae and low input RNA seq was applied. Overall design: Livers from 7dpf zebrafish larvae were dissected with forceps and dissociated cells with 0.25% trypsin treatment. The libraries were constructed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 and sequenced on Illumina Novaseq platform.   pubmed:39139065   WT 7dpf liver rep1 GSM7905862   source name:liver|tissue:liver|genotype:wild type|treatment:Digested with 2.5percent trypsin|geo loc name:missing|collection date:missing WT 7dpf liver rep1 Illumina bcl2fastq2 v 2.20.0.422 software was used for base calling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence. Read quality was checked for each sample by using FastQC v 0.11.9. High quality reads were alligned to GRCz11 whole genome using HISAT2 V2.1.0 with default parameters. Mapping results with MAPQ>15 were kept for further analysis by samtools 1.10. Raw counts of sequencing reads were generated by using FeatureCounts v1.6.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files include raw counts for each sample liver   At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   tissue:liver|genotype:wild type|treatment:Digested with 2.5percent trypsin GSM7905862 GSM7905862: WT 7dpf liver rep1; Danio rerio; RNA Seq GSM7905862 r1 GSM7905862 1 At 7dpf zebrafish larvea livers were dissected with forceps and dissociated into single cells with 0.25% trypsin treatment. NEBNext Single Cell Low Input RNA Library Prep Kit for Illumina NEB Cat No.6420 was used with all 7dpf liver cell for the construction of sequencing libraries.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP472550     ctrl_7dpf_liver_1_R1.fastq.gz ctrl_7dpf_liver_1_R2.fastq.gz fastq fastq 6492651600.0 21642172.0 GSM7905862 r1 0:150 1:150 A:1911338464;C:1210670533;G:1559401753;T:1810786876;N:453974 150 150     1911338464 1210670533 1559401753 1810786876 453974 SRX22556944 SRS19565485 SRA1753371 Xin Lou Lab, Medical School, Nanjing University Xin Lou Lab, Medical School, Nanjing University 2 0.83368 0.84388 0.18806 0.18877 0.84713 0.84932 0.67925 0.67975 150 150 B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   China 2023-11-17 Larval Larval Liver Liver and Biliary System
29816 29816 SRR27496346 SRX23167489 SRS20117077 SRP483191 PRJNA1063616 Protection from starvation induced liver atrophy. GSE252997 Transcriptome Analysis Starvation causes the accumulation of lipid droplets in the liver a somewhat counterintuitive phenomenon that is nevertheless conserved from flies to humans. Much like fatty liver resulting from overfeeding hepatic lipid accumulation steatosis during undernourishment can lead to lipotoxicity and atrophy of the liver. Here we found that while surface populations of Astyanax mexicanus undergo this evolutionarily conserved response to starvation the starvation resistant cavefish larvae of the same species do not display an accumulation of lipid droplets upon starvation. Moreover cavefish are resistant to liver atrophy during starvation providing a unique system to explore strategies for liver protection. Using comparative transcriptomics between zebrafish surface fish and cavefish we identified the fatty acid transporter slc27a2a/fatp2 to be correlated with the development of fatty liver. Pharmacological inhibition of slc27a2a in zebrafish rescues steatosis and atrophy of the liver upon starvation. Further down regulation of FATP2 in drosophila larvae inhibits the development of starvation induced steatosis suggesting the evolutionary conserved importance of the gene in regulating fatty liver upon nutrition deprivation. Overall our study identifies a conserved druggable target to protect the liver from atrophy during starvation. Overall design: Zebrafish larvae at 4 dpf were treated with Lipofermata 5 uM or vehicle DMSO for 48 hours. During treatment no exogenous food was added. At 6 dpf the livers were isolated for RNA Sequencing. Experiment was performed in duplicate.   pubmed:38467419   Liver 6dpf DMSO rep1 GSM8012203   source name:Liver|tissue:Liver|genotype:AB|treatment:DMSO|geo loc name:missing|collection date:missing Liver 6dpf DMSO rep1 Raw reads were mapped using HiSAT2 against the GRCz11 zebrafish genome and counted using FeatureCounts. For normalization differential gene expression analysis and GO analysis iDEP version 0.951 was utilized with default parameters. For differential gene expression a fold change of 2 and false discovery rate of 0.1 was used for cut off. Assembly: GRCz11 Supplementary files format and content: comma separate file csv with raw counts for all samples. Liver Lipofermata or DMSO treatment for 48 hours For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture’s instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode. Zebrafish larvae at 6 dpf. tissue:Liver|genotype:AB|treatment:DMSO GSM8012203 GSM8012203: Liver 6dpf DMSO rep1; Danio rerio; RNA Seq GSM8012203 r1 GSM8012203 1 For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture's instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP483191   loader:fastq load.py DMSO_1_R1.fastq.gz DMSO_1_R2.fastq.gz fastq fastq 3947938488.0 13072644.0 GSM8012203 r1 0:151 1:151 A:1068152483;C:899059502;G:921482728;T:1059209932;N:33843 151 151     1068152483 899059502 921482728 1059209932 33843 SRX23167489 SRS20117077 SRA1784007 Regeneration and Stress Biology, IRIBHM, ULB Regeneration and Stress Biology, IRIBHM, ULB                       B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   Belgium 2024-01-11 Larval Larval Liver Liver and Biliary System
29817 29817 SRR27496347 SRX23167488 SRS20117076 SRP483191 PRJNA1063616 Protection from starvation induced liver atrophy. GSE252997 Transcriptome Analysis Starvation causes the accumulation of lipid droplets in the liver a somewhat counterintuitive phenomenon that is nevertheless conserved from flies to humans. Much like fatty liver resulting from overfeeding hepatic lipid accumulation steatosis during undernourishment can lead to lipotoxicity and atrophy of the liver. Here we found that while surface populations of Astyanax mexicanus undergo this evolutionarily conserved response to starvation the starvation resistant cavefish larvae of the same species do not display an accumulation of lipid droplets upon starvation. Moreover cavefish are resistant to liver atrophy during starvation providing a unique system to explore strategies for liver protection. Using comparative transcriptomics between zebrafish surface fish and cavefish we identified the fatty acid transporter slc27a2a/fatp2 to be correlated with the development of fatty liver. Pharmacological inhibition of slc27a2a in zebrafish rescues steatosis and atrophy of the liver upon starvation. Further down regulation of FATP2 in drosophila larvae inhibits the development of starvation induced steatosis suggesting the evolutionary conserved importance of the gene in regulating fatty liver upon nutrition deprivation. Overall our study identifies a conserved druggable target to protect the liver from atrophy during starvation. Overall design: Zebrafish larvae at 4 dpf were treated with Lipofermata 5 uM or vehicle DMSO for 48 hours. During treatment no exogenous food was added. At 6 dpf the livers were isolated for RNA Sequencing. Experiment was performed in duplicate.   pubmed:38467419   Liver 6dpf Lipofermata rep2 GSM8012206   source name:Liver|tissue:Liver|genotype:AB|treatment:Lipofermata|geo loc name:missing|collection date:missing Liver 6dpf Lipofermata rep2 Raw reads were mapped using HiSAT2 against the GRCz11 zebrafish genome and counted using FeatureCounts. For normalization differential gene expression analysis and GO analysis iDEP version 0.951 was utilized with default parameters. For differential gene expression a fold change of 2 and false discovery rate of 0.1 was used for cut off. Assembly: GRCz11 Supplementary files format and content: comma separate file csv with raw counts for all samples. Liver Lipofermata or DMSO treatment for 48 hours For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture’s instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode. Zebrafish larvae at 6 dpf. tissue:Liver|genotype:AB|treatment:Lipofermata GSM8012206 GSM8012206: Liver 6dpf Lipofermata rep2; Danio rerio; RNA Seq GSM8012206 r1 GSM8012206 1 For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture's instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP483191   loader:fastq load.py Lipofermata_2_R1.fastq.gz Lipofermata_2_R2.fastq.gz fastq fastq 3365739868.0 11144834.0 GSM8012206 r1 0:151 1:151 A:904693218;C:775639535;G:792394997;T:892981123;N:30995 151 151     904693218 775639535 792394997 892981123 30995 SRX23167488 SRS20117076 SRA1784007 Regeneration and Stress Biology, IRIBHM, ULB Regeneration and Stress Biology, IRIBHM, ULB                       B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   Belgium 2024-01-11 Larval Larval Liver Liver and Biliary System
29818 29818 SRR27496348 SRX23167487 SRS20117075 SRP483191 PRJNA1063616 Protection from starvation induced liver atrophy. GSE252997 Transcriptome Analysis Starvation causes the accumulation of lipid droplets in the liver a somewhat counterintuitive phenomenon that is nevertheless conserved from flies to humans. Much like fatty liver resulting from overfeeding hepatic lipid accumulation steatosis during undernourishment can lead to lipotoxicity and atrophy of the liver. Here we found that while surface populations of Astyanax mexicanus undergo this evolutionarily conserved response to starvation the starvation resistant cavefish larvae of the same species do not display an accumulation of lipid droplets upon starvation. Moreover cavefish are resistant to liver atrophy during starvation providing a unique system to explore strategies for liver protection. Using comparative transcriptomics between zebrafish surface fish and cavefish we identified the fatty acid transporter slc27a2a/fatp2 to be correlated with the development of fatty liver. Pharmacological inhibition of slc27a2a in zebrafish rescues steatosis and atrophy of the liver upon starvation. Further down regulation of FATP2 in drosophila larvae inhibits the development of starvation induced steatosis suggesting the evolutionary conserved importance of the gene in regulating fatty liver upon nutrition deprivation. Overall our study identifies a conserved druggable target to protect the liver from atrophy during starvation. Overall design: Zebrafish larvae at 4 dpf were treated with Lipofermata 5 uM or vehicle DMSO for 48 hours. During treatment no exogenous food was added. At 6 dpf the livers were isolated for RNA Sequencing. Experiment was performed in duplicate.   pubmed:38467419   Liver 6dpf Lipofermata rep1 GSM8012205   source name:Liver|tissue:Liver|genotype:AB|treatment:Lipofermata|geo loc name:missing|collection date:missing Liver 6dpf Lipofermata rep1 Raw reads were mapped using HiSAT2 against the GRCz11 zebrafish genome and counted using FeatureCounts. For normalization differential gene expression analysis and GO analysis iDEP version 0.951 was utilized with default parameters. For differential gene expression a fold change of 2 and false discovery rate of 0.1 was used for cut off. Assembly: GRCz11 Supplementary files format and content: comma separate file csv with raw counts for all samples. Liver Lipofermata or DMSO treatment for 48 hours For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture’s instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode. Zebrafish larvae at 6 dpf. tissue:Liver|genotype:AB|treatment:Lipofermata GSM8012205 GSM8012205: Liver 6dpf Lipofermata rep1; Danio rerio; RNA Seq GSM8012205 r1 GSM8012205 1 For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture's instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP483191   loader:fastq load.py Lipofermata_1_R1.fastq.gz Lipofermata_1_R2.fastq.gz fastq fastq 3645146040.0 12070020.0 GSM8012205 r1 0:151 1:151 A:981366033;C:836975744;G:858564002;T:968208667;N:31594 151 151     981366033 836975744 858564002 968208667 31594 SRX23167487 SRS20117075 SRA1784007 Regeneration and Stress Biology, IRIBHM, ULB Regeneration and Stress Biology, IRIBHM, ULB                       B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   Belgium 2024-01-11 Larval Larval Liver Liver and Biliary System
29819 29819 SRR27496349 SRX23167486 SRS20117074 SRP483191 PRJNA1063616 Protection from starvation induced liver atrophy. GSE252997 Transcriptome Analysis Starvation causes the accumulation of lipid droplets in the liver a somewhat counterintuitive phenomenon that is nevertheless conserved from flies to humans. Much like fatty liver resulting from overfeeding hepatic lipid accumulation steatosis during undernourishment can lead to lipotoxicity and atrophy of the liver. Here we found that while surface populations of Astyanax mexicanus undergo this evolutionarily conserved response to starvation the starvation resistant cavefish larvae of the same species do not display an accumulation of lipid droplets upon starvation. Moreover cavefish are resistant to liver atrophy during starvation providing a unique system to explore strategies for liver protection. Using comparative transcriptomics between zebrafish surface fish and cavefish we identified the fatty acid transporter slc27a2a/fatp2 to be correlated with the development of fatty liver. Pharmacological inhibition of slc27a2a in zebrafish rescues steatosis and atrophy of the liver upon starvation. Further down regulation of FATP2 in drosophila larvae inhibits the development of starvation induced steatosis suggesting the evolutionary conserved importance of the gene in regulating fatty liver upon nutrition deprivation. Overall our study identifies a conserved druggable target to protect the liver from atrophy during starvation. Overall design: Zebrafish larvae at 4 dpf were treated with Lipofermata 5 uM or vehicle DMSO for 48 hours. During treatment no exogenous food was added. At 6 dpf the livers were isolated for RNA Sequencing. Experiment was performed in duplicate.   pubmed:38467419   Liver 6dpf DMSO rep2 GSM8012204   source name:Liver|tissue:Liver|genotype:AB|treatment:DMSO|geo loc name:missing|collection date:missing Liver 6dpf DMSO rep2 Raw reads were mapped using HiSAT2 against the GRCz11 zebrafish genome and counted using FeatureCounts. For normalization differential gene expression analysis and GO analysis iDEP version 0.951 was utilized with default parameters. For differential gene expression a fold change of 2 and false discovery rate of 0.1 was used for cut off. Assembly: GRCz11 Supplementary files format and content: comma separate file csv with raw counts for all samples. Liver Lipofermata or DMSO treatment for 48 hours For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture’s instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode. Zebrafish larvae at 6 dpf. tissue:Liver|genotype:AB|treatment:DMSO GSM8012204 GSM8012204: Liver 6dpf DMSO rep2; Danio rerio; RNA Seq GSM8012204 r1 GSM8012204 1 For RNA Seq mRNA was isolated from livers at 6 dpf. For this livers from 30 larvae / replicate were dissected and collected in the lysis buffer from ReliaPrepTM RNA Miniprep Systems Promega Z6110. mRNA was isolated from the lysed tissue by following the manufacture's instruction. cDNA synthesis library preparation and Illumina sequencing was performed by Eurofins Genomics Europe Sequencing GmbH. Integrity and quantity of the starting mRNA was determined by appropriate methods e.g. measurement of volume and quantity gel electrophoresis and/or fluorimeter measurements. Library preparation incorporated adaptor sequence adapters and indexing compatible for Illumina sequencing technology using proprietary methods of Eurofins Genomics Europe Sequencing GmbH. The protocol for RNA library preparation was based on NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. For cDNA library preparation post first strand synthesis the second strand synthesis was performed using dUPT. The ends of the double stranded cDNA fragments were repaired and dATP ligated to the blunt ended fragments. Next the sequencing adapters were ligated to the DNA fragments and the dUTP containing second strand was removed. Sequencing was performed on the Illumina NovaSeq 6000 platform using 2x150 Sequence mode.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP483191   loader:fastq load.py DMSO_2_R1.fastq.gz DMSO_2_R2.fastq.gz fastq fastq 3062768334.0 10141617.0 GSM8012204 r1 0:151 1:151 A:815902447;C:711030547;G:726159250;T:809648102;N:27988 151 151     815902447 711030547 726159250 809648102 27988 SRX23167486 SRS20117074 SRA1784007 Regeneration and Stress Biology, IRIBHM, ULB Regeneration and Stress Biology, IRIBHM, ULB                       B B biological fallback assumption illumina novaseq_era unknown cdna_unspecified nebnext bulk unknown unknown   Belgium 2024-01-11 Larval Larval Liver Liver and Biliary System
30605 30605 SRR27885298 SRX23547062 SRS20394839 SRP488393 PRJNA1073712 Danio rerio Raw sequence reads PRJNA1073712 Whole Genome Sequencing normal RNAseq of Danio rerio         Treat3   breed:AB|dev stage:7 dpf|collection date:2022 01 06|geo loc name:China: Wuhan|sex:not determined|tissue:liver|replicate:replicate=treat biolobical replicate 3|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio t3 t3 normal RNA seq of Danio rerio     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA Illumina NovaSeq 6000   SRP488393     treat3_1.fq.gz treat3_2.fq.gz fastq fastq 11227897200.0 37426324.0 treat3 1.fq.gz 0:150 1:150 A:2841991870;C:2760705502;G:2843113319;T:2781984816;N:101693 150 150     2841991870 2760705502 2843113319 2781984816 101693 SRX23547062 SRS20394839 SRA1798310 Wuhan University|School of Basic Medical Sciences Wuhan University 2 0.9395 0.93765 0.03042 0.02991 0.75943 0.76282 0.52931 0.52802 150 150 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   China 2024-02-06 Larval Larval Liver Liver and Biliary System
30606 30606 SRR27885299 SRX23547061 SRS20394838 SRP488393 PRJNA1073712 Danio rerio Raw sequence reads PRJNA1073712 Whole Genome Sequencing normal RNAseq of Danio rerio         Control3   breed:AB|dev stage:7 dpf|collection date:2022 01 06|geo loc name:China: Wuhan|sex:not determined|tissue:liver|replicate:replicate=control biolobical replicate 3|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio c3 c3 normal RNA seq of Danio rerio     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA Illumina NovaSeq 6000   SRP488393     control3_1.fq.gz control3_2.fq.gz fastq fastq 13204860600.0 44016202.0 control3 1.fq.gz 0:150 1:150 A:3362002161;C:3237033953;G:3340888463;T:3264815850;N:120173 150 150     3362002161 3237033953 3340888463 3264815850 120173 SRX23547061 SRS20394838 SRA1798310 Wuhan University|School of Basic Medical Sciences Wuhan University 2 0.94114 0.94099 0.03313 0.0336 0.7611 0.76562 0.52598 0.54255 150 150 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   China 2024-02-06 Larval Larval Liver Liver and Biliary System
30607 30607 SRR27885300 SRX23547060 SRS20394837 SRP488393 PRJNA1073712 Danio rerio Raw sequence reads PRJNA1073712 Whole Genome Sequencing normal RNAseq of Danio rerio         Treat2   breed:AB|dev stage:7 dpf|collection date:2022 01 02|geo loc name:China: Wuhan|sex:not determined|tissue:liver|replicate:replicate=treat biolobical replicate 2|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio t2 t2 normal RNA seq of Danio rerio     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA Illumina NovaSeq 6000   SRP488393     treat2_1.fq.gz treat2_2.fq.gz fastq fastq 13686972300.0 45623241.0 treat2 1.fq.gz 0:150 1:150 A:3497540140;C:3330959709;G:3473656510;T:3384780397;N:35544 150 150     3497540140 3330959709 3473656510 3384780397 35544 SRX23547060 SRS20394837 SRA1798310 Wuhan University|School of Basic Medical Sciences Wuhan University 2 0.94978 0.9476 0.02247 0.02209 0.77508 0.78104 0.5376 0.54975 150 150 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   China 2024-02-06 Larval Larval Liver Liver and Biliary System
30608 30608 SRR27885301 SRX23547059 SRS20394836 SRP488393 PRJNA1073712 Danio rerio Raw sequence reads PRJNA1073712 Whole Genome Sequencing normal RNAseq of Danio rerio         Control2   breed:AB|dev stage:7 dpf|collection date:2022 01 02|geo loc name:China: Wuhan|sex:not determined|tissue:liver|replicate:replicate=control biolobical replicate 2|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio c2 c2 normal RNA seq of Danio rerio     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA Illumina NovaSeq 6000   SRP488393     control2_1.fq.gz control2_2.fq.gz fastq fastq 13075274400.0 43584248.0 control2 1.fq.gz 0:150 1:150 A:3297304643;C:3196925316;G:3364735785;T:3216273784;N:34872 150 150     3297304643 3196925316 3364735785 3216273784 34872 SRX23547059 SRS20394836 SRA1798310 Wuhan University|School of Basic Medical Sciences Wuhan University 2 0.94539 0.94301 0.02162 0.02151 0.78358 0.78886 0.53728 0.52362 150 150 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   China 2024-02-06 Larval Larval Liver Liver and Biliary System
30609 30609 SRR27885302 SRX23547058 SRS20394835 SRP488393 PRJNA1073712 Danio rerio Raw sequence reads PRJNA1073712 Whole Genome Sequencing normal RNAseq of Danio rerio         Treat1   breed:AB|dev stage:7 dpf|collection date:2021 12 22|geo loc name:China: Wuhan|sex:not determined|tissue:liver|replicate:replicate=treat biolobical replicate 1|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio t1 t1 normal RNA seq of Danio rerio     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA Illumina NovaSeq 6000   SRP488393     treat1_1.fq.gz treat1_2.fq.gz fastq fastq 14810228700.0 49367429.0 treat1 1.fq.gz 0:150 1:150 A:3737682638;C:3643663419;G:3815975423;T:3612867530;N:39690 150 150     3737682638 3643663419 3815975423 3612867530 39690 SRX23547058 SRS20394835 SRA1798310 Wuhan University|School of Basic Medical Sciences Wuhan University 2 0.94911 0.94637 0.0196 0.0194 0.76928 0.77406 0.52665 0.53607 150 150 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   China 2024-02-06 Larval Larval Liver Liver and Biliary System
30610 30610 SRR27885303 SRX23547057 SRS20394834 SRP488393 PRJNA1073712 Danio rerio Raw sequence reads PRJNA1073712 Whole Genome Sequencing normal RNAseq of Danio rerio         Control1   breed:AB|dev stage:7 dpf|collection date:2021 12 22|geo loc name:China: Wuhan|sex:not determined|tissue:liver|replicate:replicate=control biolobical replicate 1|BioSampleModel:Model organism or animal                 RNA seq of Danio rerio c1 c1 normal RNA seq of Danio rerio     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA Illumina NovaSeq 6000   SRP488393     control1_1.fq.gz control1_2.fq.gz fastq fastq 13024707900.0 43415693.0 control1 1.fq.gz 0:150 1:150 A:3266649802;C:3212798200;G:3383472165;T:3161753039;N:34694 150 150     3266649802 3212798200 3383472165 3161753039 34694 SRX23547057 SRS20394834 SRA1798310 Wuhan University|School of Basic Medical Sciences Wuhan University 2 0.93586 0.9333 0.02078 0.02096 0.77197 0.77729 0.53822 0.52512 150 150 B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk unknown unknown   China 2024-02-06 Larval Larval Liver Liver and Biliary System
35821 35821 SRR33048251 SRX28313562 SRS24652529 SRP577496 PRJNA1248508 Transcriptome sequencing of hepatocytes with or without xxx during liver development in zebrafish PRJNA1248508 Other The hepatocytes and non hepatocytes within the livers of 3dpf 7 dpf and adult transgenic Tgfabp10:GFP zebrafish were utilized for experimentation. Upon cessation of opercular movements animals were euthanized via immersion in ice cold water for ten minutes. In this transgenic line hepatocytes in the liver express GFP. Subsequently liver tissues were subjected to enzymatic digestion using 1 mg Collagenase IV dissolved in 1 ml L 15 medium incubated at room temperature for 20 minutes. Liver tissues were then transferred to Leibovitz L 15 medium with an osmolarity of 300 mOsm and pH adjusted to 7.35. Hepatocytes and non hepatocytes were isolated through gentle trituration. The chamber was mounted onto the stage of an Olympus inverted microscope equipped with fluorescence capabilities perfused with fresh L 15 medium for 5 minutes to rinse off debris. Calibrate flow cytometer Moflo XDP Beckman ensuring that the instrument settings such as voltage thresholds and compensation matrices are properly configured for GFP detection. Use beads calibrated for green fluorescent protein to adjust the photomultiplier tube voltages and other parameters. Prepare sterile sorting tubes filled with a suitable buffer to collect sorted cells. Pre chill if necessary. Use an argon laser typically at 488 nm for GFP excitation. Set appropriate filters to detect GFP emission usually centred around 530 nm. Discriminate intact cells from cell fragments based on size and internal complexity. Balance purity and yield by adjusting sort speed and stringency of gating parameters. Follow strict cleaning protocols post sorting to avoid contamination. Isolated cells were collected utilizing flow cytometry enabling precise sorting of GFP positive hepatocytes from GFP negative non hepatocytes. Approximately 400 hepatocytes and non hepatocytes were harvested from around 12 zebrafish with 3 replicates per sample. The careful isolation procedures and subsequent sorting by flow cytometry facilitated acquisition of pure populations of hepatocytes …       D7 GFP The hepatocytes within the liver of 7 dpf transgenic Tgfabp10:GFP zebrafish   strain:not applicable|isolate:not applicable|breed:hepatocytes|cultivar:transgenic Tgfabp10:GFP zebrafish|ecotype:not applicable|age:not collected|dev stage:7 dpf date:2019 06 19|geo loc name:China: Sichuan|sex:not determined|tissue:liver|BioSampleModel:Model organism or animal                 D7 GFP ED19155408 ED19155408 library preparations were sequenced on an Illumina Novaseq platform and 150bp paired end reads were generated     RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP577496     D7_GFP_R1.fq.gz D7_GFP_R2.fq.gz fastq fastq 7981076700.0 26603589.0 D7 GFP R1.fq.gz 0:150 1:150 A:2179536437;C:1804626545;G:1832481252;T:2164370673;N:61793 150 150     2179536437 1804626545 1832481252 2164370673 61793 SRX28313562 SRS24652529 SRA2109063 Chengdu Medical College|School of Basic Medicine Chengdu Medical College                       B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   China 2025-04-09 Larval Larval Liver Liver and Biliary System
35822 35822 SRR33048252 SRX28313561 SRS24652526 SRP577496 PRJNA1248508 Transcriptome sequencing of hepatocytes with or without xxx during liver development in zebrafish PRJNA1248508 Other The hepatocytes and non hepatocytes within the livers of 3dpf 7 dpf and adult transgenic Tgfabp10:GFP zebrafish were utilized for experimentation. Upon cessation of opercular movements animals were euthanized via immersion in ice cold water for ten minutes. In this transgenic line hepatocytes in the liver express GFP. Subsequently liver tissues were subjected to enzymatic digestion using 1 mg Collagenase IV dissolved in 1 ml L 15 medium incubated at room temperature for 20 minutes. Liver tissues were then transferred to Leibovitz L 15 medium with an osmolarity of 300 mOsm and pH adjusted to 7.35. Hepatocytes and non hepatocytes were isolated through gentle trituration. The chamber was mounted onto the stage of an Olympus inverted microscope equipped with fluorescence capabilities perfused with fresh L 15 medium for 5 minutes to rinse off debris. Calibrate flow cytometer Moflo XDP Beckman ensuring that the instrument settings such as voltage thresholds and compensation matrices are properly configured for GFP detection. Use beads calibrated for green fluorescent protein to adjust the photomultiplier tube voltages and other parameters. Prepare sterile sorting tubes filled with a suitable buffer to collect sorted cells. Pre chill if necessary. Use an argon laser typically at 488 nm for GFP excitation. Set appropriate filters to detect GFP emission usually centred around 530 nm. Discriminate intact cells from cell fragments based on size and internal complexity. Balance purity and yield by adjusting sort speed and stringency of gating parameters. Follow strict cleaning protocols post sorting to avoid contamination. Isolated cells were collected utilizing flow cytometry enabling precise sorting of GFP positive hepatocytes from GFP negative non hepatocytes. Approximately 400 hepatocytes and non hepatocytes were harvested from around 12 zebrafish with 3 replicates per sample. The careful isolation procedures and subsequent sorting by flow cytometry facilitated acquisition of pure populations of hepatocytes …       D3 GFP The hepatocytes within the liver of 3dpf transgenic Tgfabp10:GFP zebrafish   strain:not applicable|isolate:not applicable|breed:hepatocytes|cultivar:transgenic Tgfabp10:GFP zebrafish|ecotype:not applicable|age:not collected|dev stage:3 dpf date:2019 06 19|geo loc name:China: Sichuan|sex:not determined|tissue:liver|BioSampleModel:Model organism or animal                 D3 GFP ED19155403 ED19155403 library preparations were sequenced on an Illumina Novaseq platform and 150bp paired end reads were generated     RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP577496     D3_GFP_R1.fq.gz D3_GFP_R2.fq.gz fastq fastq 5675477100.0 18918257.0 D3 GFP R1.fq.gz 0:150 1:150 A:1686172751;C:1174770916;G:1187685676;T:1626795743;N:52014 150 150     1686172751 1174770916 1187685676 1626795743 52014 SRX28313561 SRS24652526 SRA2109063 Chengdu Medical College|School of Basic Medicine Chengdu Medical College                       B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   China 2025-04-09 Larval Larval Liver Liver and Biliary System
35823 35823 SRR33048253 SRX28313560 SRS24652527 SRP577496 PRJNA1248508 Transcriptome sequencing of hepatocytes with or without xxx during liver development in zebrafish PRJNA1248508 Other The hepatocytes and non hepatocytes within the livers of 3dpf 7 dpf and adult transgenic Tgfabp10:GFP zebrafish were utilized for experimentation. Upon cessation of opercular movements animals were euthanized via immersion in ice cold water for ten minutes. In this transgenic line hepatocytes in the liver express GFP. Subsequently liver tissues were subjected to enzymatic digestion using 1 mg Collagenase IV dissolved in 1 ml L 15 medium incubated at room temperature for 20 minutes. Liver tissues were then transferred to Leibovitz L 15 medium with an osmolarity of 300 mOsm and pH adjusted to 7.35. Hepatocytes and non hepatocytes were isolated through gentle trituration. The chamber was mounted onto the stage of an Olympus inverted microscope equipped with fluorescence capabilities perfused with fresh L 15 medium for 5 minutes to rinse off debris. Calibrate flow cytometer Moflo XDP Beckman ensuring that the instrument settings such as voltage thresholds and compensation matrices are properly configured for GFP detection. Use beads calibrated for green fluorescent protein to adjust the photomultiplier tube voltages and other parameters. Prepare sterile sorting tubes filled with a suitable buffer to collect sorted cells. Pre chill if necessary. Use an argon laser typically at 488 nm for GFP excitation. Set appropriate filters to detect GFP emission usually centred around 530 nm. Discriminate intact cells from cell fragments based on size and internal complexity. Balance purity and yield by adjusting sort speed and stringency of gating parameters. Follow strict cleaning protocols post sorting to avoid contamination. Isolated cells were collected utilizing flow cytometry enabling precise sorting of GFP positive hepatocytes from GFP negative non hepatocytes. Approximately 400 hepatocytes and non hepatocytes were harvested from around 12 zebrafish with 3 replicates per sample. The careful isolation procedures and subsequent sorting by flow cytometry facilitated acquisition of pure populations of hepatocytes …       D3 Cont The non hepatocytes within the liver of 3dp transgenic Tgfabp10:GFP zebrafish   strain:not applicable|isolate:not applicable|breed:non hepatocytes|cultivar:transgenic Tgfabp10:GFP zebrafish|ecotype:not applicable|age:not collected|dev stage:3 dpf date:2019 06 19|geo loc name:China: Sichuan|sex:not determined|tissue:liver|BioSampleModel:Model organism or animal                 D3 Cont ED19155405 ED19155405 library preparations were sequenced on an Illumina Novaseq platform and 150bp paired end reads were generated     RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP577496     D3_Cont_R1.fq.gz D3_Cont_R2.fq.gz fastq fastq 6351962700.0 21173209.0 D3 Cont R1.fq.gz 0:150 1:150 A:1820293872;C:1368447220;G:1385705833;T:1777459731;N:56044 150 150     1820293872 1368447220 1385705833 1777459731 56044 SRX28313560 SRS24652527 SRA2109063 Chengdu Medical College|School of Basic Medicine Chengdu Medical College                       B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   China 2025-04-09 Larval Larval Liver Liver and Biliary System
35953 35953 SRR33299171 SRX28544214 SRS24843394 SRP580984 PRJNA1255065 A Novel Transgenic Reporter to Study Vertebrate Epigenetics PRJNA1255065 Other Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates.         WT pos 3   strain:ppat|isolate:RNA wt pos 3|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal                 RNAseq of EpiTag Danio Rerio RNA wt pos 3 RNA wt pos 3 Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP580984     WT-pos-3_S10_R1_001.fastq.gz WT-pos-3_S10_R2_001.fastq.gz fastq fastq 15038194818.0 74446509.0 WT pos 3 S10 R1 001.fastq.gz 0:101 1:101 A:4616878123;C:2865206674;G:2927449871;T:4628427327;N:232823 101 101     4616878123 2865206674 2927449871 4628427327 232823 SRX28544214 SRS24843394 SRA2117853 NIH|NICHD NIH                       B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk bulk bulk   United States 2025-04-24 Larval Larval Liver Liver and Biliary System
35954 35954 SRR33299172 SRX28544213 SRS24843393 SRP580984 PRJNA1255065 A Novel Transgenic Reporter to Study Vertebrate Epigenetics PRJNA1255065 Other Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates.         WT pos 2   strain:ppat|isolate:RNA wt pos 2|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal                 RNAseq of EpiTag Danio Rerio RNA wt pos 2 RNA wt pos 2 Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP580984     WT-pos-2_S6_R1_001.fastq.gz WT-pos-2_S6_R2_001.fastq.gz fastq fastq 12522438742.0 61992271.0 WT pos 2 S6 R1 001.fastq.gz 0:101 1:101 A:3774656054;C:2451528285;G:2501043573;T:3795016419;N:194411 101 101     3774656054 2451528285 2501043573 3795016419 194411 SRX28544213 SRS24843393 SRA2117853 NIH|NICHD NIH                       B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk bulk bulk   United States 2025-04-24 Larval Larval Liver Liver and Biliary System
35955 35955 SRR33299173 SRX28544212 SRS24843392 SRP580984 PRJNA1255065 A Novel Transgenic Reporter to Study Vertebrate Epigenetics PRJNA1255065 Other Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates.         WT pos 1   strain:ppat|isolate:RNA wt pos 1|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal                 RNAseq of EpiTag Danio Rerio RNA wt pos 1 RNA wt pos 1 Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP580984     WT-pos-1_S2_R1_001.fastq.gz WT-pos-1_S2_R2_001.fastq.gz fastq fastq 13192760794.0 65310697.0 WT pos 1 S2 R1 001.fastq.gz 0:101 1:101 A:4175600031;C:2392141464;G:2448567492;T:4176248719;N:203088 101 101     4175600031 2392141464 2448567492 4176248719 203088 SRX28544212 SRS24843392 SRA2117853 NIH|NICHD NIH                       B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk bulk bulk   United States 2025-04-24 Larval Larval Liver Liver and Biliary System
35956 35956 SRR33299174 SRX28544211 SRS24843391 SRP580984 PRJNA1255065 A Novel Transgenic Reporter to Study Vertebrate Epigenetics PRJNA1255065 Other Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates.         WT neg 3   strain:ppat|isolate:RNA wt neg 3|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal                 RNAseq of EpiTag Danio Rerio RNA wt neg 3 RNA wt neg 3 Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP580984     WT-neg-3_S9_R1_001.fastq.gz WT-neg-3_S9_R2_001.fastq.gz fastq fastq 14228466708.0 70437954.0 WT neg 3 S9 R1 001.fastq.gz 0:101 1:101 A:4251988096;C:2825656049;G:2882063617;T:4268538044;N:220902 101 101     4251988096 2825656049 2882063617 4268538044 220902 SRX28544211 SRS24843391 SRA2117853 NIH|NICHD NIH                       B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk bulk bulk   United States 2025-04-24 Larval Larval Liver Liver and Biliary System
35957 35957 SRR33299176 SRX28544209 SRS24843389 SRP580984 PRJNA1255065 A Novel Transgenic Reporter to Study Vertebrate Epigenetics PRJNA1255065 Other Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates.         WT neg 2   strain:ppat|isolate:RNA wt neg 2|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal                 RNAseq of EpiTag Danio Rerio RNA wt neg 2 RNA wt neg 2 Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP580984     WT-neg-2_S5_R1_001.fastq.gz WT-neg-2_S5_R2_001.fastq.gz fastq fastq 29197644388.0 144542794.0 WT neg 2 S5 R1 001.fastq.gz 0:101 1:101 A:8825536643;C:5697075068;G:5851684325;T:8822896313;N:452039 101 101     8825536643 5697075068 5851684325 8822896313 452039 SRX28544209 SRS24843389 SRA2117853 NIH|NICHD NIH                       B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk bulk bulk   United States 2025-04-24 Larval Larval Liver Liver and Biliary System
35958 35958 SRR33299177 SRX28544208 SRS24843388 SRP580984 PRJNA1255065 A Novel Transgenic Reporter to Study Vertebrate Epigenetics PRJNA1255065 Other Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates.         WT neg 1   strain:ppat|isolate:RNA wt neg 1|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal                 RNAseq of EpiTag Danio Rerio RNA wt neg 1 RNA wt neg 1 Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP580984     WT-neg-1_S1_R1_001.fastq.gz WT-neg-1_S1_R2_001.fastq.gz fastq fastq 24310317816.0 120348108.0 WT neg 1 S1 R1 001.fastq.gz 0:101 1:101 A:7529245228;C:4579294064;G:4681930604;T:7519470895;N:377025 101 101     7529245228 4579294064 4681930604 7519470895 377025 SRX28544208 SRS24843388 SRA2117853 NIH|NICHD NIH                       B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk bulk bulk   United States 2025-04-24 Larval Larval Liver Liver and Biliary System
35959 35959 SRR33299178 SRX28544207 SRS24843387 SRP580984 PRJNA1255065 A Novel Transgenic Reporter to Study Vertebrate Epigenetics PRJNA1255065 Other Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates.         Mut pos 3   strain:ppat|isolate:RNA mut pos 3|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal                 RNAseq of EpiTag Danio Rerio RNA mut pos 3 RNA mut pos 3 Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP580984     Mutant-pos-3_S12_R1_001.fastq.gz Mutant-pos-3_S12_R2_001.fastq.gz fastq fastq 12331802050.0 61048525.0 Mutant pos 3 S12 R1 001.fastq.gz 0:101 1:101 A:3738975619;C:2387112788;G:2450941491;T:3754579907;N:192245 101 101     3738975619 2387112788 2450941491 3754579907 192245 SRX28544207 SRS24843387 SRA2117853 NIH|NICHD NIH                       B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk bulk bulk   United States 2025-04-24 Larval Larval Liver Liver and Biliary System
35960 35960 SRR33299179 SRX28544206 SRS24843386 SRP580984 PRJNA1255065 A Novel Transgenic Reporter to Study Vertebrate Epigenetics PRJNA1255065 Other Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates.         Mut pos 2   strain:ppat|isolate:RNA mut pos 2|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal                 RNAseq of EpiTag Danio Rerio RNA mut pos 2 RNA mut pos 2 Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP580984     Mutant-pos-2_S8_R1_001.fastq.gz Mutant-pos-2_S8_R2_001.fastq.gz fastq fastq 14310451034.0 70843817.0 Mutant pos 2 S8 R1 001.fastq.gz 0:101 1:101 A:4323214668;C:2795555578;G:2854780783;T:4336680703;N:219302 101 101     4323214668 2795555578 2854780783 4336680703 219302 SRX28544206 SRS24843386 SRA2117853 NIH|NICHD NIH                       B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk bulk bulk   United States 2025-04-24 Larval Larval Liver Liver and Biliary System
35961 35961 SRR33299180 SRX28544205 SRS24843385 SRP580984 PRJNA1255065 A Novel Transgenic Reporter to Study Vertebrate Epigenetics PRJNA1255065 Other Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates.         Mut pos 1   strain:ppat|isolate:RNA mut pos 1|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal                 RNAseq of EpiTag Danio Rerio RNA mut pos 1 RNA mut pos 1 Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP580984     Mutant-pos-1_S4_R1_001.fastq.gz Mutant-pos-1_S4_R2_001.fastq.gz fastq fastq 11742623802.0 58131801.0 Mutant pos 1 S4 R1 001.fastq.gz 0:101 1:101 A:3631609351;C:2213363935;G:2258388450;T:3639080712;N:181354 101 101     3631609351 2213363935 2258388450 3639080712 181354 SRX28544205 SRS24843385 SRA2117853 NIH|NICHD NIH                       B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk bulk bulk   United States 2025-04-24 Larval Larval Liver Liver and Biliary System
35962 35962 SRR33299181 SRX28544204 SRS24843384 SRP580984 PRJNA1255065 A Novel Transgenic Reporter to Study Vertebrate Epigenetics PRJNA1255065 Other Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates.         Mut neg 3   strain:ppat|isolate:RNA mut neg 3|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal                 RNAseq of EpiTag Danio Rerio RNA mut neg 3 RNA mut neg 3 Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP580984     Mutant-neg-3_S11_R1_001.fastq.gz Mutant-neg-3_S11_R2_001.fastq.gz fastq fastq 24089537270.0 119255135.0 Mutant neg 3 S11 R1 001.fastq.gz 0:101 1:101 A:7187277815;C:4790199860;G:4897671441;T:7214028116;N:360038 101 101     7187277815 4790199860 4897671441 7214028116 360038 SRX28544204 SRS24843384 SRA2117853 NIH|NICHD NIH                       B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk bulk bulk   United States 2025-04-24 Larval Larval Liver Liver and Biliary System
35963 35963 SRR33299182 SRX28544203 SRS24843383 SRP580984 PRJNA1255065 A Novel Transgenic Reporter to Study Vertebrate Epigenetics PRJNA1255065 Other Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates.         Mut neg 2   strain:ppat|isolate:RNA mut neg 2|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal                 RNAseq of EpiTag Danio Rerio RNA mut neg 2 RNA mut neg 2 Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP580984     Mutant-neg-2_S7_R1_001.fastq.gz Mutant-neg-2_S7_R2_001.fastq.gz fastq fastq 27776865470.0 137509235.0 Mutant neg 2 S7 R1 001.fastq.gz 0:101 1:101 A:8522694394;C:5302545250;G:5464259742;T:8486935677;N:430407 101 101     8522694394 5302545250 5464259742 8486935677 430407 SRX28544203 SRS24843383 SRA2117853 NIH|NICHD NIH                       B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk bulk bulk   United States 2025-04-24 Larval Larval Liver Liver and Biliary System
35964 35964 SRR33299183 SRX28544202 SRS24843382 SRP580984 PRJNA1255065 A Novel Transgenic Reporter to Study Vertebrate Epigenetics PRJNA1255065 Other Epigenetic reprogramming contributes to the generation of cellular diversity during vertebratedevelopment but the mechanisms directing this are still not well understood. Large scale genetic screens have been highly successful in identifying epigenetic regulatory genes in invertebrates such as worms and flies but similar large scale genetic screens to identify epigenetic regulators have not been carried out in vertebrates. Here we report a newly generated EpiTag zebrafish transgenic reporter line that permits easy cellular level visualization of epigenetic silencing or activation in living animals during development gametogenesis and regeneration. We use the EpiTag reporter to carry out an F3 ENU mutagenesis screen for epigenetic silencing or activating mutants identifying relevant vertebrate tissue specific epigenetic regulatory genes including a new epigenetic model for metabolic dysfunction associated fatty liver disease MAFLD. The EpiTag reporter line represents a powerful new tool for genetic and experimental analysis of tissue specific epigenetic gene regulation in vertebrates.         Mut neg 1   strain:ppat|isolate:RNA mut neg 1|age:6dpf|collection date:2024|geo loc name:USA|sex:unknown|tissue:liver & other|BioSampleModel:Model organism or animal                 RNAseq of EpiTag Danio Rerio RNA mut neg 1 RNA mut neg 1 Zymo Seq RiboFree Total RNA Library Kit Zymo Research; R3000     RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   SRP580984     Mutant-neg-1_S3_R1_001.fastq.gz Mutant-neg-1_S3_R2_001.fastq.gz fastq fastq 12942402802.0 64071301.0 Mutant neg 1 S3 R1 001.fastq.gz 0:101 1:101 A:3952970077;C:2483104981;G:2560604982;T:3945521897;N:200865 101 101     3952970077 2483104981 2560604982 3945521897 200865 SRX28544202 SRS24843382 SRA2117853 NIH|NICHD NIH                       B B biological fallback assumption illumina novaseq_era unknown poly_a unknown bulk bulk bulk   United States 2025-04-24 Larval Larval Liver Liver and Biliary System
36506 36506 SRR566696 SRX185761 SRS361914 SRP015680 PRJNA174800 Transcriptomic analyses of Myc induced zebrafish liver cancer GSE40745 Transcriptome Analysis To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system.   pubmed:23038063 source: liver tumor M+D+ GSM1000561: M+D+ 2 GSM1000561   genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:doxycycline M+D+ 2 The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. liver tumor M+D+ Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol.   genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:doxycycline GSM1000561 GSM1000561: M+D+ 2; Danio rerio; RNA Seq GSM1000561 1   1   GEO Accession:GSM1000561 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD 3 Plus System   SRP015680     M+D+_2_QV.qual M+D+_2.csfasta SOLiD_native SOLiD_native 1493416960.0 42669056.0 GSM1000561 r1 0:35 0:377247910;1:348861020;2:522134600;3:237405266;.:7768164 35                 SRX185761 SRS361914 SRA058618 GEO National University of Singapore 1 0.06244   0.00306   0.99567   0.34618   35   B   usable mapping rate legacy early unknown cdna_unspecified unknown bulk unknown unknown   Singapore 2012-09-10 Larval Larval Liver Liver and Biliary System
36507 36507 SRR566695 SRX185760 SRS361913 SRP015680 PRJNA174800 Transcriptomic analyses of Myc induced zebrafish liver cancer GSE40745 Transcriptome Analysis To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system.   pubmed:23038063 source: liver tumor M+D+ GSM1000560: M+D+ 1 GSM1000560   genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:doxycycline M+D+ 1 The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. liver tumor M+D+ Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol.   genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:doxycycline GSM1000560 GSM1000560: M+D+ 1; Danio rerio; RNA Seq GSM1000560 1   1   GEO Accession:GSM1000560 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD 3 Plus System   SRP015680         1291539515.0 36901129.0 GSM1000560 r1 0:35 0:266006021;1:328523841;2:440474617;3:254266912;.:2268124 35                 SRX185760 SRS361913 SRA058618 GEO National University of Singapore 1 0.10629   0.0044   0.99239   0.31953   35   B   usable mapping rate legacy early unknown cdna_unspecified unknown bulk unknown unknown   Singapore 2012-09-10 Larval Larval Liver Liver and Biliary System
36508 36508 SRR566694 SRX185759 SRS361912 SRP015680 PRJNA174800 Transcriptomic analyses of Myc induced zebrafish liver cancer GSE40745 Transcriptome Analysis To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system.   pubmed:23038063 source: control liver M D+ GSM1000559: M D+ 2 GSM1000559   genotype:wildtype|tissue:liver|treatment:doxycycline M D+ 2 The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. control liver M D+ Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol.   genotype:wildtype|tissue:liver|treatment:doxycycline GSM1000559 GSM1000559: M D+ 2; Danio rerio; RNA Seq GSM1000559 1   1   GEO Accession:GSM1000559 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD 3 Plus System   SRP015680     M-D+_2_QV.qual SOLiD_native 1438423910.0 41097826.0 GSM1000559 r1 0:35 0:353104627;1:349496969;2:433338629;3:275089557;.:27394128 35                 SRX185759 SRS361912 SRA058618 GEO National University of Singapore 1 0.04748   0.00442   0.99425   0.53794   35   B   usable mapping rate legacy early unknown cdna_unspecified unknown bulk unknown unknown   Singapore 2012-09-10 Larval Larval Liver Liver and Biliary System
36509 36509 SRR566693 SRX185758 SRS361911 SRP015680 PRJNA174800 Transcriptomic analyses of Myc induced zebrafish liver cancer GSE40745 Transcriptome Analysis To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system.   pubmed:23038063 source: control liver M D+ GSM1000558: M D+ 1 GSM1000558   genotype:wildtype|tissue:liver|treatment:doxycycline M D+ 1 The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. control liver M D+ Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol.   genotype:wildtype|tissue:liver|treatment:doxycycline GSM1000558 GSM1000558: M D+ 1; Danio rerio; RNA Seq GSM1000558 1   1   GEO Accession:GSM1000558 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD 3 Plus System   SRP015680     M-D+_1.csfasta SOLiD_native 1284638285.0 36703951.0 GSM1000558 r1 0:35 0:328871758;1:317693850;2:402981931;3:233637468;.:1453278 35                 SRX185758 SRS361911 SRA058618 GEO National University of Singapore 1 0.10539   0.00562   0.99141   0.37635   35   B   usable mapping rate legacy early unknown cdna_unspecified unknown bulk unknown unknown   Singapore 2012-09-10 Larval Larval Liver Liver and Biliary System
36510 36510 SRR566692 SRX185757 SRS361910 SRP015680 PRJNA174800 Transcriptomic analyses of Myc induced zebrafish liver cancer GSE40745 Transcriptome Analysis To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system.   pubmed:23038063 source: control liver M+D GSM1000557: M+D 2 GSM1000557   genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:n1 M+D 2 The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. control liver M+D Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol.   genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:n1 GSM1000557 GSM1000557: M+D 2; Danio rerio; RNA Seq GSM1000557 1   1   GEO Accession:GSM1000557 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD 3 Plus System   SRP015680     M+D-_2_QV.qual SOLiD_native 1404966080.0 40141888.0 GSM1000557 r1 0:35 0:371691603;1:354481639;2:405221861;3:271978812;.:1592165 35                 SRX185757 SRS361910 SRA058618 GEO National University of Singapore 1 0.07869   0.00455   0.99253   0.51508   35   B   usable mapping rate legacy early unknown cdna_unspecified unknown bulk unknown unknown   Singapore 2012-09-10 Larval Larval Liver Liver and Biliary System
36511 36511 SRR566691 SRX185756 SRS361909 SRP015680 PRJNA174800 Transcriptomic analyses of Myc induced zebrafish liver cancer GSE40745 Transcriptome Analysis To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system.   pubmed:23038063 source: control liver M+D GSM1000556: M+D 1 GSM1000556   genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:n1 M+D 1 The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. control liver M+D Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol.   genotype:Tgfabp10:TA; TRE:Myc; krt4:GFP|tissue:liver|treatment:n1 GSM1000556 GSM1000556: M+D 1; Danio rerio; RNA Seq GSM1000556 1   1   GEO Accession:GSM1000556 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD 3 Plus System   SRP015680     M+D-_1_QV.qual M+D-_1.csfasta SOLiD_native SOLiD_native 1286706820.0 36763052.0 GSM1000556 r1 0:35 0:252864341;1:338709089;2:436928155;3:256235022;.:1970213 35                 SRX185756 SRS361909 SRA058618 GEO National University of Singapore 1 0.12399   0.00617   0.98752   0.50351   35   B   usable mapping rate legacy early unknown cdna_unspecified unknown bulk unknown unknown   Singapore 2012-09-10 Larval Larval Liver Liver and Biliary System
36512 36512 SRR566690 SRX185755 SRS361908 SRP015680 PRJNA174800 Transcriptomic analyses of Myc induced zebrafish liver cancer GSE40745 Transcriptome Analysis To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system.   pubmed:23038063 source: control liver M D GSM1000555: M D 2 GSM1000555   genotype:wildtype|tissue:liver|treatment:n1 M D 2 The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. control liver M D Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol.   genotype:wildtype|tissue:liver|treatment:n1 GSM1000555 GSM1000555: M D 2; Danio rerio; RNA Seq GSM1000555 1   1   GEO Accession:GSM1000555 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD 3 Plus System   SRP015680     M-D-_2_QV.qual M-D-_2.csfasta SOLiD_native SOLiD_native 1337952770.0 38227222.0 GSM1000555 r1 0:35 0:391863829;1:347720340;2:312814682;3:283542736;.:2011183 35                 SRX185755 SRS361908 SRA058618 GEO National University of Singapore 1 0.04605   0.00365   0.99494   0.51825   35   B   usable mapping rate legacy early unknown cdna_unspecified unknown bulk unknown unknown   Singapore 2012-09-10 Larval Larval Liver Liver and Biliary System
36513 36513 SRR566689 SRX185754 SRS361907 SRP015680 PRJNA174800 Transcriptomic analyses of Myc induced zebrafish liver cancer GSE40745 Transcriptome Analysis To study the characteristics and mechanisms of Myc induced zebrafish liver tumor next generation sequencing based SAGE analyses were used to examine the transcriptomes of tumor and control samples. The results indicated that ribosome proteins were overwhelmingly up regulated in the Myc induced liver tumors. Cross species analyses showed that the zebrafish Myc model correlated well with Myc transgenic mouse models for liver cancers. The Myc induced zebrafish liver tumors also possessed molecular signatures highly similar to human hepatocellular carcinoma HCC. Thus our zebrafish model demonstrated the conserved role of Myc in promoting hepatocarcinogenesis in all vertebrate species. Overall design: Transcriptome profiling of tumor samples M+D+ and control samples M D M+D M D+ were generated by deep sequencing each in duplicates using three prime RNA SAGE on the SOLiD system.   pubmed:23038063 source: control liver M D GSM1000554: M D 1 GSM1000554   genotype:wildtype|tissue:liver|treatment:n1 M D 1 The SOLiD generated RNA Seq reads were 27 bp in length. An initial filtering process was performed to remove any non desirable contamination sequences. The reads were mapped to the zebrafish RefSeq mRNA database Release 39 allowing maxium mismatches using ABI pipeline BioScope v1.0.1. The expression levels of the mapped transcripts were normalized into transcript per million TPM to faciliate comparison among different samples. Genome build: RefSeq Release 39 Supplementary files format and content: The mapped transcripts were listed with GI and RefSeq ID together with expression levels in TPM. control liver M D Transgenic zebrafish and their wildtype siblings were treated starting from 21 dpf. Doxycycline treatment was conducted in 6 L tanks with around 25 adults and water was changed every other day. Total RNA was extracted using TRIzol Invitrogen. Library construction was conducted by Mission Biotech Taiwan following the standard ABI SOLiD protocol.   genotype:wildtype|tissue:liver|treatment:n1 GSM1000554 GSM1000554: M D 1; Danio rerio; RNA Seq GSM1000554 1   1   GEO Accession:GSM1000554 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD 3 Plus System   SRP015680     M-D-_1.csfasta SOLiD_native 1395143680.0 39861248.0 GSM1000554 r1 0:35 0:439852883;1:355203725;2:298639546;3:299770820;.:1676706 35                 SRX185754 SRS361907 SRA058618 GEO National University of Singapore 1 0.02094   0.00123   0.99784   0.58426   35   B   usable mapping rate legacy early unknown cdna_unspecified unknown bulk unknown unknown   Singapore 2012-09-10 Larval Larval Liver Liver and Biliary System
37217 37217 SRR1035240 SRX381137 SRS505529 SRP033231 PRJNA229468 Overexpression of UHRF1 drives DNA hypomethylation and hepatocellular carcinoma GSE52605 Transcriptome Analysis UHRF1 is an essential regulator of DNA methylation that is highly expressed in many cancers. Using transgenic zebrafish cultured cells and human tumors we demonstrate that UHRF1 is an oncogene. RNAseq was used to assess the variation in gene expression between control and experimental samples. Overall design: Total small RNA from 2 batches of Tgfabp10:has.UHRF1 GFPHigh and age matched Tgfabp10:nls mCherry control 5 dpf zebrafish livers was purified for preparation of high throughput sequencing libraries.   pubmed:24486181   mCherry cntr2 GSM1272461   source name:Zebrafish 5 dpf liver|genotype/variation:Tgfabp10:nls mCherry|tissue:liver|development stage:5 dpf mCherry cntr2 Illumina CASAVA version 1.7 used for basecalling Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes genes and their quantile normalized frequencies. Zebrafish 5 dpf liver   Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends.   genotype/variation:Tgfabp10:nls mCherry|tissue:liver|developmental stage:5 dpf GSM1272461 GSM1272461: mCherry cntr2; Danio rerio; RNA Seq GSM1272461   1 Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends. GEO Accession:GSM1272461 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP033231     mCherry_cntr2.fastq.gz fastq 2132003100.0 21320031.0 GSM1272461 r1 0:100 A:536532013;C:533562250;G:522685362;T:536641910;N:2581565 100       536532013 533562250 522685362 536641910 2581565 SRX381137 SRS505529 SRA111986 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.88347   0.04357   0.81964   0.52384   100   B   usable mapping rate illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United States 2013-11-21 Larval Larval Liver Liver and Biliary System
37218 37218 SRR1035239 SRX381136 SRS505528 SRP033231 PRJNA229468 Overexpression of UHRF1 drives DNA hypomethylation and hepatocellular carcinoma GSE52605 Transcriptome Analysis UHRF1 is an essential regulator of DNA methylation that is highly expressed in many cancers. Using transgenic zebrafish cultured cells and human tumors we demonstrate that UHRF1 is an oncogene. RNAseq was used to assess the variation in gene expression between control and experimental samples. Overall design: Total small RNA from 2 batches of Tgfabp10:has.UHRF1 GFPHigh and age matched Tgfabp10:nls mCherry control 5 dpf zebrafish livers was purified for preparation of high throughput sequencing libraries.   pubmed:24486181   mCherry cntr1 GSM1272460   source name:Zebrafish 5 dpf liver|genotype/variation:Tgfabp10:nls mCherry|tissue:liver|development stage:5 dpf mCherry cntr1 Illumina CASAVA version 1.7 used for basecalling Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes genes and their quantile normalized frequencies. Zebrafish 5 dpf liver   Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends.   genotype/variation:Tgfabp10:nls mCherry|tissue:liver|developmental stage:5 dpf GSM1272460 GSM1272460: mCherry cntr1; Danio rerio; RNA Seq GSM1272460   1 Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends. GEO Accession:GSM1272460 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP033231     mCherry_cntr1.fastq.gz fastq 2098395500.0 20983955.0 GSM1272460 r1 0:100 A:533756912;C:521877600;G:512200617;T:528020965;N:2539406 100       533756912 521877600 512200617 528020965 2539406 SRX381136 SRS505528 SRA111986 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.89445   0.02866   0.82426   0.50861   100   B   usable mapping rate illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United States 2013-11-21 Larval Larval Liver Liver and Biliary System
37219 37219 SRR1035238 SRX381135 SRS505527 SRP033231 PRJNA229468 Overexpression of UHRF1 drives DNA hypomethylation and hepatocellular carcinoma GSE52605 Transcriptome Analysis UHRF1 is an essential regulator of DNA methylation that is highly expressed in many cancers. Using transgenic zebrafish cultured cells and human tumors we demonstrate that UHRF1 is an oncogene. RNAseq was used to assess the variation in gene expression between control and experimental samples. Overall design: Total small RNA from 2 batches of Tgfabp10:has.UHRF1 GFPHigh and age matched Tgfabp10:nls mCherry control 5 dpf zebrafish livers was purified for preparation of high throughput sequencing libraries.   pubmed:24486181   UHRF1 hi B GSM1272459   source name:Zebrafish 5 dpf liver|genotype/variation:Tgfabp10:has.UHRF1 GFP|tissue:liver|development stage:5 dpf UHRF1 hi B Illumina CASAVA version 1.7 used for basecalling Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes genes and their quantile normalized frequencies. Zebrafish 5 dpf liver   Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends.   genotype/variation:Tgfabp10:has.UHRF1 GFP|tissue:liver|developmental stage:5 dpf GSM1272459 GSM1272459: UHRF1 hi B; Danio rerio; RNA Seq GSM1272459   1 Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends. GEO Accession:GSM1272459 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP033231     UHRF1_hi_B.fastq.gz fastq 2127061900.0 21270619.0 GSM1272459 r1 0:100 A:540147604;C:542900044;G:522760277;T:518703604;N:2550371 100       540147604 542900044 522760277 518703604 2550371 SRX381135 SRS505527 SRA111986 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.7609   0.0395   0.77788   0.51544   100   B   usable mapping rate illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United States 2013-11-21 Larval Larval Liver Liver and Biliary System
37220 37220 SRR1035237 SRX381134 SRS505526 SRP033231 PRJNA229468 Overexpression of UHRF1 drives DNA hypomethylation and hepatocellular carcinoma GSE52605 Transcriptome Analysis UHRF1 is an essential regulator of DNA methylation that is highly expressed in many cancers. Using transgenic zebrafish cultured cells and human tumors we demonstrate that UHRF1 is an oncogene. RNAseq was used to assess the variation in gene expression between control and experimental samples. Overall design: Total small RNA from 2 batches of Tgfabp10:has.UHRF1 GFPHigh and age matched Tgfabp10:nls mCherry control 5 dpf zebrafish livers was purified for preparation of high throughput sequencing libraries.   pubmed:24486181   UHRF1 hi A GSM1272458   source name:Zebrafish 5 dpf liver|genotype/variation:Tgfabp10:has.UHRF1 GFP|tissue:liver|development stage:5 dpf UHRF1 hi A Illumina CASAVA version 1.7 used for basecalling Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes genes and their quantile normalized frequencies. Zebrafish 5 dpf liver   Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends.   genotype/variation:Tgfabp10:has.UHRF1 GFP|tissue:liver|developmental stage:5 dpf GSM1272458 GSM1272458: UHRF1 hi A; Danio rerio; RNA Seq GSM1272458   1 Total RNA was extracted using Trizol and mRNA was purified using poly A beads The mRNA was chemically fragmented and Hi seq compatible bar coded adapters were ligated to both ends. GEO Accession:GSM1272458 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP033231     UHRF1_hi_A.fastq.gz fastq 2476218900.0 24762189.0 GSM1272458 r1 0:100 A:625575890;C:631605318;G:620422311;T:595617894;N:2997487 100       625575890 631605318 620422311 595617894 2997487 SRX381134 SRS505526 SRA111986 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.80154   0.04243   0.80409   0.50831   100   B   usable mapping rate illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United States 2013-11-21 Larval Larval Liver Liver and Biliary System
37985 37985 SRR1216351 SRX510531 SRS588958 SRP040940 PRJNA243510 Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish GSE56498 Transcriptome Analysis ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. parent bioproject:PRJNA541472 pubmed:24874946   nls Cherry Ethanol #2 GSM1362715   tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf nls Cherry Ethanol #2 Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. Zebrafish 5 dpf liver   Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.   tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf GSM1362715 GSM1362715: nls Cherry Ethanol #2; Danio rerio; ncRNA Seq GSM1362715   1 Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. GEO Accession:GSM1362715 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer IIx   SRP040940     Cherry2-ethanol_raw.txt.gz fastq 2547597500.0 25475975.0 GSM1362715 r1 0:100 A:667878423;C:617022069;G:603019059;T:656604341;N:3073608 100       667878423 617022069 603019059 656604341 3073608 SRX510531 SRS588958 SRA156310 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.903   0.06203   0.78173   0.47105   100   B   usable mapping rate illumina early_illumina unknown size_fractionation unknown bulk unknown unknown   United States 2014-04-03 Larval Larval Liver Liver and Biliary System
37986 37986 SRR1216350 SRX510530 SRS588959 SRP040940 PRJNA243510 Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish GSE56498 Transcriptome Analysis ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. parent bioproject:PRJNA541472 pubmed:24874946   nls Cherry Ethanol #1 GSM1362714   tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf nls Cherry Ethanol #1 Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. Zebrafish 5 dpf liver   Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.   tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf GSM1362714 GSM1362714: nls Cherry Ethanol #1; Danio rerio; ncRNA Seq GSM1362714   1 Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. GEO Accession:GSM1362714 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer IIx   SRP040940     Cherry1-ethanol_raw.txt.gz fastq 2848772300.0 28487723.0 GSM1362714 r1 0:100 A:754173668;C:673034180;G:669171787;T:748900638;N:3492027 100       754173668 673034180 669171787 748900638 3492027 SRX510530 SRS588959 SRA156310 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.93424   0.04344   0.80365   0.45184   100   B   usable mapping rate illumina early_illumina unknown size_fractionation unknown bulk unknown unknown   United States 2014-04-03 Larval Larval Liver Liver and Biliary System
37987 37987 SRR1216349 SRX510529 SRS588957 SRP040940 PRJNA243510 Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish GSE56498 Transcriptome Analysis ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. parent bioproject:PRJNA541472 pubmed:24874946   nAtf6 Cherry #1 GSM1362713   tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nAtf6 cherry; cmlc2:GFP|developmental stage:5 dpf nAtf6 Cherry #1 Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. Zebrafish 5 dpf liver   Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.   tissue type:liver|genotype:Tgfabp10:nAtf6 cherry; cmlc2:GFP|developmental stage:5 dpf GSM1362713 GSM1362713: nAtf6 Cherry #1; Danio rerio; ncRNA Seq GSM1362713   1 Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. GEO Accession:GSM1362713 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer IIx   SRP040940     nAtf61_raw.txt.gz fastq 2259581400.0 22595814.0 GSM1362713 r1 0:100 A:577752854;C:550694305;G:551105918;T:577235877;N:2792446 100       577752854 550694305 551105918 577235877 2792446 SRX510529 SRS588957 SRA156310 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.94581   0.04947   0.80375   0.52352   100   B   usable mapping rate illumina early_illumina unknown size_fractionation unknown bulk unknown unknown   United States 2014-04-03 Larval Larval Liver Liver and Biliary System
37988 37988 SRR1216348 SRX510528 SRS588956 SRP040940 PRJNA243510 Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish GSE56498 Transcriptome Analysis ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. parent bioproject:PRJNA541472 pubmed:24874946   nls Cherry #2 GSM1362712   tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf nls Cherry #2 Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. Zebrafish 5 dpf liver   Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.   tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf GSM1362712 GSM1362712: nls Cherry #2; Danio rerio; ncRNA Seq GSM1362712   1 Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. GEO Accession:GSM1362712 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer IIx   SRP040940     Cherry2_raw.txt.gz fastq 2132003100.0 21320031.0 GSM1362712 r1 0:100 A:536532013;C:533562250;G:522685362;T:536641910;N:2581565 100       536532013 533562250 522685362 536641910 2581565 SRX510528 SRS588956 SRA156310 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.88352   0.04379   0.81947   0.52367   100   B   usable mapping rate illumina early_illumina unknown size_fractionation unknown bulk unknown unknown   United States 2014-04-03 Larval Larval Liver Liver and Biliary System
37989 37989 SRR1216347 SRX510527 SRS588955 SRP040940 PRJNA243510 Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish GSE56498 Transcriptome Analysis ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. parent bioproject:PRJNA541472 pubmed:24874946   nls Cherry #1 GSM1362711   tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf nls Cherry #1 Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies. Zebrafish 5 dpf liver   Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.   tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf GSM1362711 GSM1362711: nls Cherry #1; Danio rerio; ncRNA Seq GSM1362711   1 Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries. GEO Accession:GSM1362711 ncRNA-Seq TRANSCRIPTOMIC size fractionation SINGLE ILLUMINA Illumina Genome Analyzer IIx   SRP040940     Cherry1_raw.txt.gz fastq 2098395500.0 20983955.0 GSM1362711 r1 0:100 A:533756912;C:521877600;G:512200617;T:528020965;N:2539406 100       533756912 521877600 512200617 528020965 2539406 SRX510527 SRS588955 SRA156310 GEO sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai 1 0.89447   0.02865   0.82436   0.50802   100   B   usable mapping rate illumina early_illumina unknown size_fractionation unknown bulk unknown unknown   United States 2014-04-03 Larval Larval Liver Liver and Biliary System
40352 40352 SRR3098582 SRX1528549 SRS1246175 SRP068364 PRJNA308582 Transcriptional profiling through RNA seq of zebrafish larval liver post exposure to biliatresone a biliary toxin. GSE76780 Transcriptome Analysis We sequenced liver mRNA isolated from biliatresone treated zebrafish larvae and DMSO treated controls in order to elucidate the molecular pathways induced by biliatresone a biliary toxin that is responsible for outbreaks of biliary atresia in Australian liverstock. Overall design: Liver mRNA profiles of biliatresone treated zebrafish larvae and DMSO treated controls were generated by deep sequencing in duplicates.   pubmed:27102575   Biliatres1 2 GSM2037741   source name:liver|tissue:liver|treatment:Biliatres1 Biliatres1 2 Hiseq control software HCS was used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to zv9 whole genome using STAR. Python Htseq script was used to count the number of reads. Genome build: zv9 Supplementary files format and content: tab delimited text files include htseq count output. liver Zebrafish larvae were treated with biliatresone 0.5 ug/ml for four hours. Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit.   tissue:liver|treatment:Biliatres1 GSM2037741 GSM2037741: Biliatres1 2; Danio rerio; RNA Seq GSM2037741   1 Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit. GEO Accession:GSM2037741 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP068364     Toxin_2-Pack_1.fq.gz Toxin_2-Pack_2.fq.gz fastq fastq 11821468800.0 59107344.0 GSM2037741 r1 0:100 1:100 A:2991132983;C:2918961261;G:2932581309;T:2978195946;N:597301 100 100     2991132983 2918961261 2932581309 2978195946 597301 SRX1528549 SRS1246175 SRA333195 GEO Michael Pack, Medicine/DIgestive Diseases, University of Pennsylvania 2 0.84122 0.83891 0.11156 0.10952 0.76073 0.76049 0.61886 0.62136 100 100 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion ribozero bulk bulk bulk   United States 2016-01-12 Larval Larval Liver Liver and Biliary System
40353 40353 SRR3098581 SRX1528548 SRS1246176 SRP068364 PRJNA308582 Transcriptional profiling through RNA seq of zebrafish larval liver post exposure to biliatresone a biliary toxin. GSE76780 Transcriptome Analysis We sequenced liver mRNA isolated from biliatresone treated zebrafish larvae and DMSO treated controls in order to elucidate the molecular pathways induced by biliatresone a biliary toxin that is responsible for outbreaks of biliary atresia in Australian liverstock. Overall design: Liver mRNA profiles of biliatresone treated zebrafish larvae and DMSO treated controls were generated by deep sequencing in duplicates.   pubmed:27102575   Biliatres1 1 GSM2037740   source name:liver|tissue:liver|treatment:Biliatres1 Biliatres1 1 Hiseq control software HCS was used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to zv9 whole genome using STAR. Python Htseq script was used to count the number of reads. Genome build: zv9 Supplementary files format and content: tab delimited text files include htseq count output. liver Zebrafish larvae were treated with biliatresone 0.5 ug/ml for four hours. Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit.   tissue:liver|treatment:Biliatres1 GSM2037740 GSM2037740: Biliatres1 1; Danio rerio; RNA Seq GSM2037740   1 Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit. GEO Accession:GSM2037740 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP068364     Toxin_1-Pack_1.fq.gz Toxin_1-Pack_2.fq.gz fastq fastq 11256964600.0 56284823.0 GSM2037740 r1 0:100 1:100 A:2904557741;C:2723715275;G:2731673206;T:2896488406;N:529972 100 100     2904557741 2723715275 2731673206 2896488406 529972 SRX1528548 SRS1246176 SRA333195 GEO Michael Pack, Medicine/DIgestive Diseases, University of Pennsylvania 2 0.88354 0.88079 0.10204 0.10016 0.76088 0.76142 0.61543 0.61859 100 100 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion ribozero bulk bulk bulk   United States 2016-01-12 Larval Larval Liver Liver and Biliary System
40354 40354 SRR3098580 SRX1528547 SRS1246177 SRP068364 PRJNA308582 Transcriptional profiling through RNA seq of zebrafish larval liver post exposure to biliatresone a biliary toxin. GSE76780 Transcriptome Analysis We sequenced liver mRNA isolated from biliatresone treated zebrafish larvae and DMSO treated controls in order to elucidate the molecular pathways induced by biliatresone a biliary toxin that is responsible for outbreaks of biliary atresia in Australian liverstock. Overall design: Liver mRNA profiles of biliatresone treated zebrafish larvae and DMSO treated controls were generated by deep sequencing in duplicates.   pubmed:27102575   Control 2 GSM2037739   source name:liver|tissue:liver|treatment:DMSO Control 2 Hiseq control software HCS was used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to zv9 whole genome using STAR. Python Htseq script was used to count the number of reads. Genome build: zv9 Supplementary files format and content: tab delimited text files include htseq count output. liver Zebrafish larvae were treated with biliatresone 0.5 ug/ml for four hours. Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit.   tissue:liver|treatment:DMSO GSM2037739 GSM2037739: Control 2; Danio rerio; RNA Seq GSM2037739   1 Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit. GEO Accession:GSM2037739 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP068364     Control_2-Pack_1.fq.gz Control_2-Pack_2.fq.gz fastq fastq 11100792600.0 55503963.0 GSM2037739 r1 0:100 1:100 A:2815807606;C:2731691384;G:2743610074;T:2809211211;N:472325 100 100     2815807606 2731691384 2743610074 2809211211 472325 SRX1528547 SRS1246177 SRA333195 GEO Michael Pack, Medicine/DIgestive Diseases, University of Pennsylvania 2 0.85048 0.84831 0.10818 0.10631 0.76025 0.76041 0.6032 0.60884 100 100 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion ribozero bulk bulk bulk   United States 2016-01-12 Larval Larval Liver Liver and Biliary System
40355 40355 SRR3098579 SRX1528546 SRS1246178 SRP068364 PRJNA308582 Transcriptional profiling through RNA seq of zebrafish larval liver post exposure to biliatresone a biliary toxin. GSE76780 Transcriptome Analysis We sequenced liver mRNA isolated from biliatresone treated zebrafish larvae and DMSO treated controls in order to elucidate the molecular pathways induced by biliatresone a biliary toxin that is responsible for outbreaks of biliary atresia in Australian liverstock. Overall design: Liver mRNA profiles of biliatresone treated zebrafish larvae and DMSO treated controls were generated by deep sequencing in duplicates.   pubmed:27102575   Control 1 GSM2037738   source name:liver|tissue:liver|treatment:DMSO Control 1 Hiseq control software HCS was used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to zv9 whole genome using STAR. Python Htseq script was used to count the number of reads. Genome build: zv9 Supplementary files format and content: tab delimited text files include htseq count output. liver Zebrafish larvae were treated with biliatresone 0.5 ug/ml for four hours. Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit.   tissue:liver|treatment:DMSO GSM2037738 GSM2037738: Control 1; Danio rerio; RNA Seq GSM2037738   1 Livers were dissected directly in to the lysis buffer RLT and RNA was harvested using the standard Qiagen protocol RNeasy Mini Kit. 1 ug of total RNA was used for sequecning library construction and the libraries were prepared using the Truseq Stranded Ribo Zero Library Prep Kit. GEO Accession:GSM2037738 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP068364     Control_1-Pack_2.fq.gz Control_1-Pack_1.fq.gz fastq fastq 11315242000.0 56576210.0 GSM2037738 r1 0:100 1:100 A:2768862811;C:2888735322;G:2893616488;T:2763590339;N:437040 100 100     2768862811 2888735322 2893616488 2763590339 437040 SRX1528546 SRS1246178 SRA333195 GEO Michael Pack, Medicine/DIgestive Diseases, University of Pennsylvania 2 0.7716 0.76823 0.09579 0.09326 0.78447 0.78472 0.62953 0.62992 100 100 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion ribozero bulk bulk bulk   United States 2016-01-12 Larval Larval Liver Liver and Biliary System
40743 40743 SRR3342393 SRX1684659 SRS1379870 SRP072957 PRJNA317597 FOXN3 regulates hepatic glucose utilization GSE80003 Transcriptome Analysis We sequenced mRNA from livers of 7 dpf transgenic zebrafish overexpressing foxn3 in the liver and non transgenic siblings Overall design: Examination of the changes in level of different mRNAs in foxn3 transgenic and wild type siblings   pubmed:27292639   Transgenic3 GSM2109873   source name:foxn3 overexpression liver|tissue:Liver|transgene:foxn3|developmental stage:7 dpf larvae Transgenic3 Reads were aligned to the genome using novoalign Annotated splice junctions generated by the MakeTranscriptome command in the USeq Splice junction reads were then converted to genomic coordinates using the SamTranscriptomeParser command in USeq Differential gene expression analysis was performed on the resulting count table using DESeq2 Genome build: Zv9 genome build Supplementary files format and content: excel file with read counts FPKM and statistical analysis foxn3 overexpression liver   Total RNA  extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine   tissue:Liver|transgene:foxn3|developmental stage:7 dpf larvae GSM2109873 GSM2109873: Transgenic3; Danio rerio; RNA Seq GSM2109873   1 Total RNA  extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine GEO Accession:GSM2109873 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP072957     11405X8_150225_D00294_0165_AC6BKMANXX_7.txt.gz fastq 1538486450.0 30769729.0 GSM2109873 r1 0:50 A:399631224;C:339577730;G:345815787;T:453436273;N:25436 50       399631224 339577730 345815787 453436273 25436 SRX1684659 SRS1379870 SRA405566 GEO Amnon Schlegel, Molecular Medicine Program, University of Utah School of Medicine 1 0.89036   0.28368   0.75461   0.63309   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-04-06 Larval Larval Liver Liver and Biliary System
40744 40744 SRR3342392 SRX1684658 SRS1379871 SRP072957 PRJNA317597 FOXN3 regulates hepatic glucose utilization GSE80003 Transcriptome Analysis We sequenced mRNA from livers of 7 dpf transgenic zebrafish overexpressing foxn3 in the liver and non transgenic siblings Overall design: Examination of the changes in level of different mRNAs in foxn3 transgenic and wild type siblings   pubmed:27292639   Transgenic2 GSM2109872   source name:foxn3 overexpression liver|tissue:Liver|transgene:foxn3|developmental stage:7 dpf larvae Transgenic2 Reads were aligned to the genome using novoalign Annotated splice junctions generated by the MakeTranscriptome command in the USeq Splice junction reads were then converted to genomic coordinates using the SamTranscriptomeParser command in USeq Differential gene expression analysis was performed on the resulting count table using DESeq2 Genome build: Zv9 genome build Supplementary files format and content: excel file with read counts FPKM and statistical analysis foxn3 overexpression liver   Total RNA  extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine   tissue:Liver|transgene:foxn3|developmental stage:7 dpf larvae GSM2109872 GSM2109872: Transgenic2; Danio rerio; RNA Seq GSM2109872   1 Total RNA  extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine GEO Accession:GSM2109872 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP072957     11405X7_150225_D00294_0165_AC6BKMANXX_7.txt.gz fastq 1500971700.0 30019434.0 GSM2109872 r1 0:50 A:389353802;C:331408746;G:327481397;T:452703447;N:24308 50       389353802 331408746 327481397 452703447 24308 SRX1684658 SRS1379871 SRA405566 GEO Amnon Schlegel, Molecular Medicine Program, University of Utah School of Medicine 1 0.9148   0.242   0.76784   0.44492   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-04-06 Larval Larval Liver Liver and Biliary System
40745 40745 SRR3342391 SRX1684657 SRS1379872 SRP072957 PRJNA317597 FOXN3 regulates hepatic glucose utilization GSE80003 Transcriptome Analysis We sequenced mRNA from livers of 7 dpf transgenic zebrafish overexpressing foxn3 in the liver and non transgenic siblings Overall design: Examination of the changes in level of different mRNAs in foxn3 transgenic and wild type siblings   pubmed:27292639   Transgenic1 GSM2109871   source name:foxn3 overexpression liver|tissue:Liver|transgene:foxn3|developmental stage:7 dpf larvae Transgenic1 Reads were aligned to the genome using novoalign Annotated splice junctions generated by the MakeTranscriptome command in the USeq Splice junction reads were then converted to genomic coordinates using the SamTranscriptomeParser command in USeq Differential gene expression analysis was performed on the resulting count table using DESeq2 Genome build: Zv9 genome build Supplementary files format and content: excel file with read counts FPKM and statistical analysis foxn3 overexpression liver   Total RNA  extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine   tissue:Liver|transgene:foxn3|developmental stage:7 dpf larvae GSM2109871 GSM2109871: Transgenic1; Danio rerio; RNA Seq GSM2109871   1 Total RNA  extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine GEO Accession:GSM2109871 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP072957     11405X6_150225_D00294_0165_AC6BKMANXX_7.txt.gz fastq 1672645200.0 33452904.0 GSM2109871 r1 0:50 A:446934700;C:363616773;G:354194568;T:507871249;N:27910 50       446934700 363616773 354194568 507871249 27910 SRX1684657 SRS1379872 SRA405566 GEO Amnon Schlegel, Molecular Medicine Program, University of Utah School of Medicine 1 0.90431   0.33357   0.75075   0.62394   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-04-06 Larval Larval Liver Liver and Biliary System
40746 40746 SRR3342390 SRX1684656 SRS1379873 SRP072957 PRJNA317597 FOXN3 regulates hepatic glucose utilization GSE80003 Transcriptome Analysis We sequenced mRNA from livers of 7 dpf transgenic zebrafish overexpressing foxn3 in the liver and non transgenic siblings Overall design: Examination of the changes in level of different mRNAs in foxn3 transgenic and wild type siblings   pubmed:27292639   WT3 GSM2109870   source name:wildtype liver|tissue:Liver|developmental stage:7 dpf larvae WT3 Reads were aligned to the genome using novoalign Annotated splice junctions generated by the MakeTranscriptome command in the USeq Splice junction reads were then converted to genomic coordinates using the SamTranscriptomeParser command in USeq Differential gene expression analysis was performed on the resulting count table using DESeq2 Genome build: Zv9 genome build Supplementary files format and content: excel file with read counts FPKM and statistical analysis wildtype liver   Total RNA  extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine   tissue:Liver|developmental stage:7 dpf larvae GSM2109870 GSM2109870: WT3; Danio rerio; RNA Seq GSM2109870   1 Total RNA  extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine GEO Accession:GSM2109870 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP072957     11405X4_150225_D00294_0165_AC6BKMANXX_7.txt.gz fastq 1621245550.0 32424911.0 GSM2109870 r1 0:50 A:387275594;C:392477306;G:410916447;T:430550072;N:26131 50       387275594 392477306 410916447 430550072 26131 SRX1684656 SRS1379873 SRA405566 GEO Amnon Schlegel, Molecular Medicine Program, University of Utah School of Medicine 1 0.75787   0.22112   0.80858   0.6379   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-04-06 Larval Larval Liver Liver and Biliary System
40747 40747 SRR3342389 SRX1684655 SRS1379874 SRP072957 PRJNA317597 FOXN3 regulates hepatic glucose utilization GSE80003 Transcriptome Analysis We sequenced mRNA from livers of 7 dpf transgenic zebrafish overexpressing foxn3 in the liver and non transgenic siblings Overall design: Examination of the changes in level of different mRNAs in foxn3 transgenic and wild type siblings   pubmed:27292639   WT2 GSM2109869   source name:wildtype liver|tissue:Liver|developmental stage:7 dpf larvae WT2 Reads were aligned to the genome using novoalign Annotated splice junctions generated by the MakeTranscriptome command in the USeq Splice junction reads were then converted to genomic coordinates using the SamTranscriptomeParser command in USeq Differential gene expression analysis was performed on the resulting count table using DESeq2 Genome build: Zv9 genome build Supplementary files format and content: excel file with read counts FPKM and statistical analysis wildtype liver   Total RNA  extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine   tissue:Liver|developmental stage:7 dpf larvae GSM2109869 GSM2109869: WT2; Danio rerio; RNA Seq GSM2109869   1 Total RNA  extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine GEO Accession:GSM2109869 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP072957     11405X3_150225_D00294_0165_AC6BKMANXX_7.txt.gz fastq 1660295850.0 33205917.0 GSM2109869 r1 0:50 A:441731711;C:362842137;G:351944677;T:503749546;N:27779 50       441731711 362842137 351944677 503749546 27779 SRX1684655 SRS1379874 SRA405566 GEO Amnon Schlegel, Molecular Medicine Program, University of Utah School of Medicine 1 0.90993   0.31148   0.74602   0.62587   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-04-06 Larval Larval Liver Liver and Biliary System
40748 40748 SRR3342388 SRX1684654 SRS1379875 SRP072957 PRJNA317597 FOXN3 regulates hepatic glucose utilization GSE80003 Transcriptome Analysis We sequenced mRNA from livers of 7 dpf transgenic zebrafish overexpressing foxn3 in the liver and non transgenic siblings Overall design: Examination of the changes in level of different mRNAs in foxn3 transgenic and wild type siblings   pubmed:27292639   WT1 GSM2109868   source name:wildtype liver|tissue:Liver|developmental stage:7 dpf larvae WT1 Reads were aligned to the genome using novoalign Annotated splice junctions generated by the MakeTranscriptome command in the USeq Splice junction reads were then converted to genomic coordinates using the SamTranscriptomeParser command in USeq Differential gene expression analysis was performed on the resulting count table using DESeq2 Genome build: Zv9 genome build Supplementary files format and content: excel file with read counts FPKM and statistical analysis wildtype liver   Total RNA  extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine   tissue:Liver|developmental stage:7 dpf larvae GSM2109868 GSM2109868: WT1; Danio rerio; RNA Seq GSM2109868   1 Total RNA  extracted using a DirectZol RNA miniprep kit Zymo Research Illumina TruSeq Stranded Total RNA Sample Prep Kit was used to prepare the library; Samples were barcoded as Transgenic versus wild type and single end 50 bp reads were generated on a Hiseq 2500 machine GEO Accession:GSM2109868 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   SRP072957     11405X2_150225_D00294_0165_AC6BKMANXX_7.txt.gz fastq 1588346650.0 31766933.0 GSM2109868 r1 0:50 A:427469407;C:345629775;G:329846628;T:485374945;N:25895 50       427469407 345629775 329846628 485374945 25895 SRX1684654 SRS1379875 SRA405566 GEO Amnon Schlegel, Molecular Medicine Program, University of Utah School of Medicine 1 0.89836   0.33182   0.75694   0.62202   50   B   usable mapping rate illumina hiseq_era unknown cdna_unspecified trueseq bulk unknown unknown   United States 2016-04-06 Larval Larval Liver Liver and Biliary System
43836 43836 SRR6170100 SRX3280949 SRS2591760 SRP119921 PRJNA414225 Differential gene expression in the liver of zebrafish larvae exposed to 1 mM inorganic arsenic from xxx 120 hpf GSE104953 Transcriptome Analysis The goal of this study is to compare gene expression levels in the livers of larval Tgfabp10:nls mcherry exposed to 1 mM inorganic arsenic from xxx 120 hpf to the unexposed siblings. Samples were collected from Tgfabp10:nls mcherry zebrafish larvae that were derived from incrossed parents of the same strain. The background of transgenic lines were typically from mixed outcrosses of the transgenics to AB TAB5 and TAB14 strains when regenerating the lines as the working stocks aged. All samples were collected at approximately 120 hpf natural spawning at 8:30 9:00AM EST on day zero samples were collected at 8 10AM EST on day 5. Overall design: Zebrafish larvae that were untreated control or those exposed to 1 mM inorganic arsenic from 4 hpf 120 hpf were anesthetized and the liver was microdissected from xxx 20 larvae and pooled per treatment group. The transgenic line Tgfabp10:nls mcherry was used to facilitate microdissection of the liver. RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment. Libraries were prepared according to Illumina Truseq RNA sample prep kit version 2 followed by Ribo Zero Gold treatment.   pubmed:29361514   C3 GSM2810893   source name:5dpf embryos liver control|genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:n1 control|tissue:liver C3 Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and low quality sequence p 4 e 100 y a m 10 best strata Trimmed read were mapped to GRCz10 whole genome using tophat2 v2.1.0 with parameters no novel juncs G Accepted bam files were used for counting read numbers of each gene with HTSeq s no t exon i gene id Test of differential expression of each genes was implemented by DESeq2 in Bioconductor genes with reads number less than 10 were filtered out Genome build: GRCz10 https://www.ncbi.nlm.nih.gov/grc/zebrafish Supplementary files format and content: .txt file. Reads count of genes 5dpf embryos liver control   10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol   genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:n1 control|tissue:liver GSM2810893 GSM2810893: C3; Danio rerio; RNA Seq GSM2810893   1 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol GEO Accession:GSM2810893 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP119921     Sample_C3-302_read1.fastq.gz Sample_C3-302_read2.fastq.gz fastq fastq 10027139610.0 49639305.0 GSM2810893 r1 0:101 1:101 A:2626098652;C:2366641673;G:2449308862;T:2460503397;N:124587026 101 101     2626098652 2366641673 2449308862 2460503397 124587026 SRX3280949 SRS2591760 SRA619573 GEO Biology, New York University Abu Dhabi 2 0.92114 0.91895 0.03472 0.03624 0.80815 0.8225 0.51053 0.44025 101 101 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion trueseq bulk unknown unknown   United Arab Emirates 2017-10-13 Larval Larval Liver Liver and Biliary System
43837 43837 SRR6170099 SRX3280948 SRS2591759 SRP119921 PRJNA414225 Differential gene expression in the liver of zebrafish larvae exposed to 1 mM inorganic arsenic from xxx 120 hpf GSE104953 Transcriptome Analysis The goal of this study is to compare gene expression levels in the livers of larval Tgfabp10:nls mcherry exposed to 1 mM inorganic arsenic from xxx 120 hpf to the unexposed siblings. Samples were collected from Tgfabp10:nls mcherry zebrafish larvae that were derived from incrossed parents of the same strain. The background of transgenic lines were typically from mixed outcrosses of the transgenics to AB TAB5 and TAB14 strains when regenerating the lines as the working stocks aged. All samples were collected at approximately 120 hpf natural spawning at 8:30 9:00AM EST on day zero samples were collected at 8 10AM EST on day 5. Overall design: Zebrafish larvae that were untreated control or those exposed to 1 mM inorganic arsenic from 4 hpf 120 hpf were anesthetized and the liver was microdissected from xxx 20 larvae and pooled per treatment group. The transgenic line Tgfabp10:nls mcherry was used to facilitate microdissection of the liver. RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment. Libraries were prepared according to Illumina Truseq RNA sample prep kit version 2 followed by Ribo Zero Gold treatment.   pubmed:29361514   C2 GSM2810892   source name:5dpf embryos liver control|genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:n1 control|tissue:liver C2 Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and low quality sequence p 4 e 100 y a m 10 best strata Trimmed read were mapped to GRCz10 whole genome using tophat2 v2.1.0 with parameters no novel juncs G Accepted bam files were used for counting read numbers of each gene with HTSeq s no t exon i gene id Test of differential expression of each genes was implemented by DESeq2 in Bioconductor genes with reads number less than 10 were filtered out Genome build: GRCz10 https://www.ncbi.nlm.nih.gov/grc/zebrafish Supplementary files format and content: .txt file. Reads count of genes 5dpf embryos liver control   10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol   genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:n1 control|tissue:liver GSM2810892 GSM2810892: C2; Danio rerio; RNA Seq GSM2810892   1 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol GEO Accession:GSM2810892 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP119921     Sample_C2-299_read1.fastq.gz Sample_C2-299_read2.fastq.gz fastq fastq 9926753488.0 49142344.0 GSM2810892 r1 0:101 1:101 A:2477603964;C:2430411156;G:2471233920;T:2424071855;N:123432593 101 101     2477603964 2430411156 2471233920 2424071855 123432593 SRX3280948 SRS2591759 SRA619573 GEO Biology, New York University Abu Dhabi 2 0.93846 0.93739 0.02418 0.02481 0.79918 0.81416 0.50574 0.50088 101 101 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion trueseq bulk unknown unknown   United Arab Emirates 2017-10-13 Larval Larval Liver Liver and Biliary System
43838 43838 SRR6170098 SRX3280947 SRS2591758 SRP119921 PRJNA414225 Differential gene expression in the liver of zebrafish larvae exposed to 1 mM inorganic arsenic from xxx 120 hpf GSE104953 Transcriptome Analysis The goal of this study is to compare gene expression levels in the livers of larval Tgfabp10:nls mcherry exposed to 1 mM inorganic arsenic from xxx 120 hpf to the unexposed siblings. Samples were collected from Tgfabp10:nls mcherry zebrafish larvae that were derived from incrossed parents of the same strain. The background of transgenic lines were typically from mixed outcrosses of the transgenics to AB TAB5 and TAB14 strains when regenerating the lines as the working stocks aged. All samples were collected at approximately 120 hpf natural spawning at 8:30 9:00AM EST on day zero samples were collected at 8 10AM EST on day 5. Overall design: Zebrafish larvae that were untreated control or those exposed to 1 mM inorganic arsenic from 4 hpf 120 hpf were anesthetized and the liver was microdissected from xxx 20 larvae and pooled per treatment group. The transgenic line Tgfabp10:nls mcherry was used to facilitate microdissection of the liver. RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment. Libraries were prepared according to Illumina Truseq RNA sample prep kit version 2 followed by Ribo Zero Gold treatment.   pubmed:29361514   C1 GSM2810891   source name:5dpf embryos liver control|genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:n1 control|tissue:liver C1 Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and low quality sequence p 4 e 100 y a m 10 best strata Trimmed read were mapped to GRCz10 whole genome using tophat2 v2.1.0 with parameters no novel juncs G Accepted bam files were used for counting read numbers of each gene with HTSeq s no t exon i gene id Test of differential expression of each genes was implemented by DESeq2 in Bioconductor genes with reads number less than 10 were filtered out Genome build: GRCz10 https://www.ncbi.nlm.nih.gov/grc/zebrafish Supplementary files format and content: .txt file. Reads count of genes 5dpf embryos liver control   10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol   genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:n1 control|tissue:liver GSM2810891 GSM2810891: C1; Danio rerio; RNA Seq GSM2810891   1 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol GEO Accession:GSM2810891 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP119921     Sample_C1-296_read1.fastq.gz Sample_C1-296_read2.fastq.gz fastq fastq 8822209206.0 43674303.0 GSM2810891 r1 0:101 1:101 A:2342189977;C:2066915142;G:2164189762;T:2139380119;N:109534206 101 101     2342189977 2066915142 2164189762 2139380119 109534206 SRX3280947 SRS2591758 SRA619573 GEO Biology, New York University Abu Dhabi 2 0.92169 0.91926 0.03524 0.03609 0.79786 0.81266 0.50354 0.51033 101 101 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion trueseq bulk unknown unknown   United Arab Emirates 2017-10-13 Larval Larval Liver Liver and Biliary System
43839 43839 SRR6170097 SRX3280946 SRS2591755 SRP119921 PRJNA414225 Differential gene expression in the liver of zebrafish larvae exposed to 1 mM inorganic arsenic from xxx 120 hpf GSE104953 Transcriptome Analysis The goal of this study is to compare gene expression levels in the livers of larval Tgfabp10:nls mcherry exposed to 1 mM inorganic arsenic from xxx 120 hpf to the unexposed siblings. Samples were collected from Tgfabp10:nls mcherry zebrafish larvae that were derived from incrossed parents of the same strain. The background of transgenic lines were typically from mixed outcrosses of the transgenics to AB TAB5 and TAB14 strains when regenerating the lines as the working stocks aged. All samples were collected at approximately 120 hpf natural spawning at 8:30 9:00AM EST on day zero samples were collected at 8 10AM EST on day 5. Overall design: Zebrafish larvae that were untreated control or those exposed to 1 mM inorganic arsenic from 4 hpf 120 hpf were anesthetized and the liver was microdissected from xxx 20 larvae and pooled per treatment group. The transgenic line Tgfabp10:nls mcherry was used to facilitate microdissection of the liver. RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment. Libraries were prepared according to Illumina Truseq RNA sample prep kit version 2 followed by Ribo Zero Gold treatment.   pubmed:29361514   A3 GSM2810890   source name:5dpf embryos liver arsenic|genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:1 mM inorganic arsenic|tissue:liver A3 Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and low quality sequence p 4 e 100 y a m 10 best strata Trimmed read were mapped to GRCz10 whole genome using tophat2 v2.1.0 with parameters no novel juncs G Accepted bam files were used for counting read numbers of each gene with HTSeq s no t exon i gene id Test of differential expression of each genes was implemented by DESeq2 in Bioconductor genes with reads number less than 10 were filtered out Genome build: GRCz10 https://www.ncbi.nlm.nih.gov/grc/zebrafish Supplementary files format and content: .txt file. Reads count of genes 5dpf embryos liver arsenic   10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol   genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:1 mM inorganic arsenic|tissue:liver GSM2810890 GSM2810890: A3; Danio rerio; RNA Seq GSM2810890   1 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol GEO Accession:GSM2810890 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP119921     Sample_A3-299_read1.fastq.gz Sample_A3-299_read2.fastq.gz fastq fastq 13287203066.0 65778233.0 GSM2810890 r1 0:101 1:101 A:3662325148;C:3087171770;G:3305939687;T:3067414232;N:164352229 101 101     3662325148 3087171770 3305939687 3067414232 164352229 SRX3280946 SRS2591755 SRA619573 GEO Biology, New York University Abu Dhabi 2 0.92398 0.92463 0.03399 0.03434 0.79547 0.81044 0.52707 0.53016 101 101 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion trueseq bulk unknown unknown   United Arab Emirates 2017-10-13 Larval Larval Liver Liver and Biliary System
43840 43840 SRR6170096 SRX3280945 SRS2591757 SRP119921 PRJNA414225 Differential gene expression in the liver of zebrafish larvae exposed to 1 mM inorganic arsenic from xxx 120 hpf GSE104953 Transcriptome Analysis The goal of this study is to compare gene expression levels in the livers of larval Tgfabp10:nls mcherry exposed to 1 mM inorganic arsenic from xxx 120 hpf to the unexposed siblings. Samples were collected from Tgfabp10:nls mcherry zebrafish larvae that were derived from incrossed parents of the same strain. The background of transgenic lines were typically from mixed outcrosses of the transgenics to AB TAB5 and TAB14 strains when regenerating the lines as the working stocks aged. All samples were collected at approximately 120 hpf natural spawning at 8:30 9:00AM EST on day zero samples were collected at 8 10AM EST on day 5. Overall design: Zebrafish larvae that were untreated control or those exposed to 1 mM inorganic arsenic from 4 hpf 120 hpf were anesthetized and the liver was microdissected from xxx 20 larvae and pooled per treatment group. The transgenic line Tgfabp10:nls mcherry was used to facilitate microdissection of the liver. RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment. Libraries were prepared according to Illumina Truseq RNA sample prep kit version 2 followed by Ribo Zero Gold treatment.   pubmed:29361514   A2 GSM2810889   source name:5dpf embryos liver arsenic|genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:1 mM inorganic arsenic|tissue:liver A2 Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and low quality sequence p 4 e 100 y a m 10 best strata Trimmed read were mapped to GRCz10 whole genome using tophat2 v2.1.0 with parameters no novel juncs G Accepted bam files were used for counting read numbers of each gene with HTSeq s no t exon i gene id Test of differential expression of each genes was implemented by DESeq2 in Bioconductor genes with reads number less than 10 were filtered out Genome build: GRCz10 https://www.ncbi.nlm.nih.gov/grc/zebrafish Supplementary files format and content: .txt file. Reads count of genes 5dpf embryos liver arsenic   10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol   genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:1 mM inorganic arsenic|tissue:liver GSM2810889 GSM2810889: A2; Danio rerio; RNA Seq GSM2810889   1 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol GEO Accession:GSM2810889 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP119921     Sample_A2-299_read1.fastq.gz Sample_A2-299_read2.fastq.gz fastq fastq 14280123360.0 70693680.0 GSM2810889 r1 0:101 1:101 A:3585176558;C:3480271791;G:3551853285;T:3484955380;N:177866346 101 101     3585176558 3480271791 3551853285 3484955380 177866346 SRX3280945 SRS2591757 SRA619573 GEO Biology, New York University Abu Dhabi 2 0.93368 0.93329 0.02628 0.02609 0.78871 0.80215 0.53969 0.54196 101 101 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion trueseq bulk unknown unknown   United Arab Emirates 2017-10-13 Larval Larval Liver Liver and Biliary System
43841 43841 SRR6170095 SRX3280944 SRS2591756 SRP119921 PRJNA414225 Differential gene expression in the liver of zebrafish larvae exposed to 1 mM inorganic arsenic from xxx 120 hpf GSE104953 Transcriptome Analysis The goal of this study is to compare gene expression levels in the livers of larval Tgfabp10:nls mcherry exposed to 1 mM inorganic arsenic from xxx 120 hpf to the unexposed siblings. Samples were collected from Tgfabp10:nls mcherry zebrafish larvae that were derived from incrossed parents of the same strain. The background of transgenic lines were typically from mixed outcrosses of the transgenics to AB TAB5 and TAB14 strains when regenerating the lines as the working stocks aged. All samples were collected at approximately 120 hpf natural spawning at 8:30 9:00AM EST on day zero samples were collected at 8 10AM EST on day 5. Overall design: Zebrafish larvae that were untreated control or those exposed to 1 mM inorganic arsenic from 4 hpf 120 hpf were anesthetized and the liver was microdissected from xxx 20 larvae and pooled per treatment group. The transgenic line Tgfabp10:nls mcherry was used to facilitate microdissection of the liver. RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment. Libraries were prepared according to Illumina Truseq RNA sample prep kit version 2 followed by Ribo Zero Gold treatment.   pubmed:29361514   A1 GSM2810888   source name:5dpf embryos liver arsenic|genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:1 mM inorganic arsenic|tissue:liver A1 Illumina Casava1.8 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and low quality sequence p 4 e 100 y a m 10 best strata Trimmed read were mapped to GRCz10 whole genome using tophat2 v2.1.0 with parameters no novel juncs G Accepted bam files were used for counting read numbers of each gene with HTSeq s no t exon i gene id Test of differential expression of each genes was implemented by DESeq2 in Bioconductor genes with reads number less than 10 were filtered out Genome build: GRCz10 https://www.ncbi.nlm.nih.gov/grc/zebrafish Supplementary files format and content: .txt file. Reads count of genes 5dpf embryos liver arsenic   10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol   genotype/variation:Tgfabp10:nls mcherry|developmental stage:5 dpf|exposed to:1 mM inorganic arsenic|tissue:liver GSM2810888 GSM2810888: A1; Danio rerio; RNA Seq GSM2810888   1 10 20 livers from 5dpf embryos were pooled per sample and RNA was extracted using the Zymo Quick RNA Micro Kit with on column DNase treatment per manufacturer's instructions. RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol GEO Accession:GSM2810888 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP119921     Sample_A1-296_read1.fastq.gz Sample_A1-296_read2.fastq.gz fastq fastq 7384848108.0 36558654.0 GSM2810888 r1 0:101 1:101 A:1929553962;C:1740175990;G:1822053733;T:1801314520;N:91749903 101 101     1929553962 1740175990 1822053733 1801314520 91749903 SRX3280944 SRS2591756 SRA619573 GEO Biology, New York University Abu Dhabi 2 0.91907 0.91541 0.03673 0.03751 0.77962 0.79444 0.52016 0.51802 101 101 B B biological fallback assumption illumina hiseq_era unknown rrna_depletion trueseq bulk unknown unknown   United Arab Emirates 2017-10-13 Larval Larval Liver Liver and Biliary System
44922 44922 SRR6297670 SRX3398649 SRS2692829 SRP125098 PRJNA418729 The CCCH type zinc finger transcription factor Zc3h8 protects hepatocytes from degeneration by repressing the inflammatory response in zebrafish. GSE106985 Transcriptome Analysis Transcriptional profile of hepatocytes during the cq5 mutant liver degeneration middle stage 5.5 dpf and later stage 7.5 dpf. Overall design: Examination of gene expression at two different stages for mutant sample group and wild type control group.       D7.5MUT GSM2858890   source name:Hepatocytes|strain:ABGO|tissue:liver|developmental stage:7.5 dpf D7.5MUT Raw data were filtered to obtain clean data using Perl scripts. Reference genome and annotations were downloaded from the ENSEMBL website http://www.ensembl.org/index.html. Reference genome library was built using the Bowtie2 v2.2.3 software and clean data was aligned to the library using the TopHat v2.0.12 software. Gene expression levels were calculated by the RPKM method using the HTSeq v0.6.0 software. Genes with P value<0.05 and |log2 ratio|≥1 were identified as differentially expressed genes using the DESeq v1.16.0 software These data were then subject to GO gene ontology http://geneontology.org/ analyses and aligned to KEGG Kyoto Encyclopedia of Genes and Genomes http://www.kegg.jp/ database to build pathway maps. Genome build: zv9 Supplementary files format and content: [rpkm.xls] tab delimited text file includes RPKMs for each Sample. [Table s1.xls] foldChange between developmental stages in each genotype cells. Hepatocytes Choose two different stages 5.5 and 7.5 dpf of zc3h8 / mutant and wild type group larves which hepatocytes were markerd by Tglfabp:Dendra2 NTR transgenic line and the zebrafish livers samples were respectively dissected collected and homogenized in 1 ml 0.5% trypsin at 4 °C. The homogenized cell suspension was centrifuged at 1000x g at 4 °C for 5 minutes. Then the supernatant was removed and the cell pellet was resuspended in PBS followed by cell sorting by flow cytometry Moflo XDP Beckman. Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol.   strain:ABGO|tissue:liver|developmental stage:7.5 dpf GSM2858890 GSM2858890: D7.5MUT; Danio rerio; RNA Seq GSM2858890   1 Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol. GEO Accession:GSM2858890 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP125098     D7_5MUT1_R1.fq.gz D7_5MUT1_R2.fq.gz fastq fastq 6317511200.0 31587556.0 GSM2858890 r1 0:100 1:100 A:1754225166;C:1427299863;G:1424315769;T:1697747107;N:13923295 100 100     1754225166 1427299863 1424315769 1697747107 13923295 SRX3398649 SRS2692829 SRA631311 GEO Southwest university 2 0.85186 0.83894 0.11172 0.10823 0.82731 0.82852 0.60784 0.60651 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown sc single_cell_plate smartseq   China 2017-11-16 Larval Larval Liver Liver and Biliary System
44923 44923 SRR6297669 SRX3398648 SRS2692828 SRP125098 PRJNA418729 The CCCH type zinc finger transcription factor Zc3h8 protects hepatocytes from degeneration by repressing the inflammatory response in zebrafish. GSE106985 Transcriptome Analysis Transcriptional profile of hepatocytes during the cq5 mutant liver degeneration middle stage 5.5 dpf and later stage 7.5 dpf. Overall design: Examination of gene expression at two different stages for mutant sample group and wild type control group.       D7.5WT GSM2858889   source name:Hepatocytes|strain:ABGO|tissue:liver|developmental stage:7.5 dpf D7.5WT Raw data were filtered to obtain clean data using Perl scripts. Reference genome and annotations were downloaded from the ENSEMBL website http://www.ensembl.org/index.html. Reference genome library was built using the Bowtie2 v2.2.3 software and clean data was aligned to the library using the TopHat v2.0.12 software. Gene expression levels were calculated by the RPKM method using the HTSeq v0.6.0 software. Genes with P value<0.05 and |log2 ratio|≥1 were identified as differentially expressed genes using the DESeq v1.16.0 software These data were then subject to GO gene ontology http://geneontology.org/ analyses and aligned to KEGG Kyoto Encyclopedia of Genes and Genomes http://www.kegg.jp/ database to build pathway maps. Genome build: zv9 Supplementary files format and content: [rpkm.xls] tab delimited text file includes RPKMs for each Sample. [Table s1.xls] foldChange between developmental stages in each genotype cells. Hepatocytes Choose two different stages 5.5 and 7.5 dpf of zc3h8 / mutant and wild type group larves which hepatocytes were markerd by Tglfabp:Dendra2 NTR transgenic line and the zebrafish livers samples were respectively dissected collected and homogenized in 1 ml 0.5% trypsin at 4 °C. The homogenized cell suspension was centrifuged at 1000x g at 4 °C for 5 minutes. Then the supernatant was removed and the cell pellet was resuspended in PBS followed by cell sorting by flow cytometry Moflo XDP Beckman. Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol.   strain:ABGO|tissue:liver|developmental stage:7.5 dpf GSM2858889 GSM2858889: D7.5WT; Danio rerio; RNA Seq GSM2858889   1 Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol. GEO Accession:GSM2858889 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP125098     D7_5WT1_R1.fq.gz D7_5WT1_R2.fq.gz fastq fastq 6300586000.0 31502930.0 GSM2858889 r1                       SRX3398648 SRS2692828 SRA631311 GEO Southwest university 2 0.86687 0.85977 0.07521 0.07369 0.85871 0.85888 0.5932 0.59571 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown sc single_cell_plate smartseq   China 2017-11-16 Larval Larval Liver Liver and Biliary System
44924 44924 SRR6297668 SRX3398647 SRS2692827 SRP125098 PRJNA418729 The CCCH type zinc finger transcription factor Zc3h8 protects hepatocytes from degeneration by repressing the inflammatory response in zebrafish. GSE106985 Transcriptome Analysis Transcriptional profile of hepatocytes during the cq5 mutant liver degeneration middle stage 5.5 dpf and later stage 7.5 dpf. Overall design: Examination of gene expression at two different stages for mutant sample group and wild type control group.       D5.5MUT GSM2858888   source name:Hepatocytes|strain:ABGO|tissue:liver|developmental stage:5.5 dpf D5.5MUT Raw data were filtered to obtain clean data using Perl scripts. Reference genome and annotations were downloaded from the ENSEMBL website http://www.ensembl.org/index.html. Reference genome library was built using the Bowtie2 v2.2.3 software and clean data was aligned to the library using the TopHat v2.0.12 software. Gene expression levels were calculated by the RPKM method using the HTSeq v0.6.0 software. Genes with P value<0.05 and |log2 ratio|≥1 were identified as differentially expressed genes using the DESeq v1.16.0 software These data were then subject to GO gene ontology http://geneontology.org/ analyses and aligned to KEGG Kyoto Encyclopedia of Genes and Genomes http://www.kegg.jp/ database to build pathway maps. Genome build: zv9 Supplementary files format and content: [rpkm.xls] tab delimited text file includes RPKMs for each Sample. [Table s1.xls] foldChange between developmental stages in each genotype cells. Hepatocytes Choose two different stages 5.5 and 7.5 dpf of zc3h8 / mutant and wild type group larves which hepatocytes were markerd by Tglfabp:Dendra2 NTR transgenic line and the zebrafish livers samples were respectively dissected collected and homogenized in 1 ml 0.5% trypsin at 4 °C. The homogenized cell suspension was centrifuged at 1000x g at 4 °C for 5 minutes. Then the supernatant was removed and the cell pellet was resuspended in PBS followed by cell sorting by flow cytometry Moflo XDP Beckman. Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol.   strain:ABGO|tissue:liver|developmental stage:5.5 dpf GSM2858888 GSM2858888: D5.5MUT; Danio rerio; RNA Seq GSM2858888   1 Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol. GEO Accession:GSM2858888 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP125098     D5_5MUT1_R1.fq.gz D5_5MUT1_R2.fq.gz fastq fastq 6393315400.0 31966577.0 GSM2858888 r1 0:100 1:100 A:1762470726;C:1454470731;G:1456571327;T:1712530332;N:7272284 100 100     1762470726 1454470731 1456571327 1712530332 7272284 SRX3398647 SRS2692827 SRA631311 GEO Southwest university 2 0.86434 0.86515 0.06559 0.06514 0.84315 0.84275 0.57299 0.44229 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown sc single_cell_plate smartseq   China 2017-11-16 Larval Larval Liver Liver and Biliary System
44925 44925 SRR6297667 SRX3398646 SRS2692826 SRP125098 PRJNA418729 The CCCH type zinc finger transcription factor Zc3h8 protects hepatocytes from degeneration by repressing the inflammatory response in zebrafish. GSE106985 Transcriptome Analysis Transcriptional profile of hepatocytes during the cq5 mutant liver degeneration middle stage 5.5 dpf and later stage 7.5 dpf. Overall design: Examination of gene expression at two different stages for mutant sample group and wild type control group.       D5.5WT GSM2858887   source name:Hepatocytes|strain:ABGO|tissue:liver|developmental stage:5.5 dpf D5.5WT Raw data were filtered to obtain clean data using Perl scripts. Reference genome and annotations were downloaded from the ENSEMBL website http://www.ensembl.org/index.html. Reference genome library was built using the Bowtie2 v2.2.3 software and clean data was aligned to the library using the TopHat v2.0.12 software. Gene expression levels were calculated by the RPKM method using the HTSeq v0.6.0 software. Genes with P value<0.05 and |log2 ratio|≥1 were identified as differentially expressed genes using the DESeq v1.16.0 software These data were then subject to GO gene ontology http://geneontology.org/ analyses and aligned to KEGG Kyoto Encyclopedia of Genes and Genomes http://www.kegg.jp/ database to build pathway maps. Genome build: zv9 Supplementary files format and content: [rpkm.xls] tab delimited text file includes RPKMs for each Sample. [Table s1.xls] foldChange between developmental stages in each genotype cells. Hepatocytes Choose two different stages 5.5 and 7.5 dpf of zc3h8 / mutant and wild type group larves which hepatocytes were markerd by Tglfabp:Dendra2 NTR transgenic line and the zebrafish livers samples were respectively dissected collected and homogenized in 1 ml 0.5% trypsin at 4 °C. The homogenized cell suspension was centrifuged at 1000x g at 4 °C for 5 minutes. Then the supernatant was removed and the cell pellet was resuspended in PBS followed by cell sorting by flow cytometry Moflo XDP Beckman. Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol.   strain:ABGO|tissue:liver|developmental stage:5.5 dpf GSM2858887 GSM2858887: D5.5WT; Danio rerio; RNA Seq GSM2858887   1 Total RNA was harvested using Trizol reagent. cDNA libraries were generated from these sorted cells using the Smart seq2 protocol. GEO Accession:GSM2858887 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP125098     D5_5WT1_R1.fq.gz D5_5WT1_R2.fq.gz fastq fastq 8603691600.0 43018458.0 GSM2858887 r1 0:100 1:100 A:2356107531;C:1974663463;G:1971836234;T:2292265726;N:8818646 100 100     2356107531 1974663463 1971836234 2292265726 8818646 SRX3398646 SRS2692826 SRA631311 GEO Southwest university 2 0.92814 0.92445 0.06252 0.06384 0.82873 0.82911 0.57879 0.57933 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown sc single_cell_plate smartseq   China 2017-11-16 Larval Larval Liver Liver and Biliary System
52231 52231 SRR13912630 SRX10292187 SRS8427102 SRP195753 PRJNA541476 Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf GSE130800 Transcriptome Analysis Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina parent bioproject:PRJNA541472     78 hpf liver from sibling of transgenics overexpressing nAtf6 Clutch 1 GSM5145706   tissue:Liver|genotype:Tgfabp10a:CAAX EGFP; Tgfabp10:nAtf6 mcherry; cmlc2:EGFP C|pool:20 78 hpf liver from sibling of transgenics overexpressing nAtf6 Clutch 1 Illumina Casava software used for basecalling. Sequencing quality was assessed by using MultiQC v1.7 Alignment by HISTA2 with default parameters only paired reads are aligned and multiple alignments are kept Gene expression is counted in the exon of ensemble gene annotation with HTseq in union mode Test of differential expression of Genes or transposonis was implemented by DESeq2 in Bioconductor V4.0.2 Genome build: GRCz10 Supplementary files format and content: csv files for raw reads count of genes Liver   20 livers were microdissected and immediately placed into 500 uL of TRIzol Thermo Fisher 15596026. RNA from pooled livers was then extracted per standard TRIzol/Chloroform method and concentrated through isopronanol and resuspended in 20 uL of DNase/RNase free water Thermo Fisher Scientifc.RNA was quantified by Qubit flurometer.Thermo Scientific. The 120 hpf samples were DNAseI treated for 30 minutes at 37°C followed by RNA purification RapidOut DNA Removal Kit–Thermo Fisher Scientific. Zebrafish larvae were kept in petri dish at a density of 60 larvae/plate in a 10:14 light/dark cycle. genotype:Tgfabp10a:CAAX EGFP; Tgfabp10:nAtf6 mcherry; cmlc2:EGFP C|pool:20|rna qbit concentrationng/ul:20 GSM5145706 GSM5145706: LIV Sibs 1; Danio rerio; RNA Seq GSM5145706   1 TRIzol/Choloform RNA seq libraries treated with polyA were prepared by Mehar GEO Accession:GSM5145706 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 550   SRP195753     Liv_Natf6_1_S4_read1.fastq.gz Liv_Natf6_1_S4_read2.fastq.gz fastq fastq 2582704927.0 8953945.0 GSM5145706 r1 0:144.03 1:144.41 A:676590553;C:621558282;G:621024501;T:663061630;N:469961 144 144     676590553 621558282 621024501 663061630 469961 SRX10292187 SRS8427102 SRA883585 GEO Biology, New York University Abu Dhabi 2 0.932 0.938 0.0482 0.04905 0.75099 0.75808 0.55706 0.54258 151 150 B B biological fallback assumption illumina nextseq unknown poly_a ribozero bulk unknown unknown   United Arab Emirates 2021-03-09 Larval Larval Liver Liver and Biliary System
52232 52232 SRR9022958 SRX5800872 SRS4730904 SRP195753 PRJNA541476 Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf GSE130800 Transcriptome Analysis Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina parent bioproject:PRJNA541472     sibslivr2: 5 dpf Livers non transgenic siblings 2 GSM3754094   source name:liver/pooled|tissue:pooled liver|genotype/variation:WT sibslivr2: 5 dpf Livers non transgenic siblings 2 Illumina Casava1.8 software used for basecalling. The raw reads were quality assessed using FastQC v0.11.5. The raw reads were then quality trimmed using Trimmomatic trimmomatic adapter.fa:2:30:10 TRAILING:3 LEADING:3 SLIDINGWINDOW:4:15 MINLEN:36 Alignments of trimmed reads were performed using tophat2 v2.1.0 with the parameters “–no novel junctions” and “–G” Accepted bam files were used for counting gene read numbers with HTSeq a 10 s no Test of differential expression of each transposonis was implemented by DESeq2 in Bioconductor Genome build: GRCz10 Supplementary files format and content: .txt Reads count of genes liver/pooled   Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501   tissue:pooled liver|genotype/variation:WT GSM3754094 GSM3754094: sibslivr2: 5 dpf Livers non transgenic siblings 2; Danio rerio; RNA Seq GSM3754094   1 Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 GEO Accession:GSM3754094 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP195753     Sample_sibslivr2_read2.fastq.gz Sample_sibslivr2_read1.fastq.gz fastq fastq 6668700740.0 33013370.0 GSM3754094 r1 0:101 1:101 A:1776745925;C:1552207841;G:1534346043;T:1799762965;N:5637966 101 101     1776745925 1552207841 1534346043 1799762965 5637966 SRX5800872 SRS4730904 SRA883585 GEO Biology, New York University Abu Dhabi 2 0.9218 0.91989 0.21964 0.21932 0.80424 0.80641 0.60361 0.60234 101 101 B B biological fallback assumption illumina hiseq_era unknown poly_a ribozero bulk unknown unknown   United Arab Emirates 2019-05-07 Larval Larval Liver Liver and Biliary System
52233 52233 SRR9022957 SRX5800871 SRS4730903 SRP195753 PRJNA541476 Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf GSE130800 Transcriptome Analysis Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina parent bioproject:PRJNA541472     sibslivr1: 5 dpf Livers non transgenic siblings 1 GSM3754093   source name:liver/pooled|tissue:pooled liver|genotype/variation:WT sibslivr1: 5 dpf Livers non transgenic siblings 1 Illumina Casava1.8 software used for basecalling. The raw reads were quality assessed using FastQC v0.11.5. The raw reads were then quality trimmed using Trimmomatic trimmomatic adapter.fa:2:30:10 TRAILING:3 LEADING:3 SLIDINGWINDOW:4:15 MINLEN:36 Alignments of trimmed reads were performed using tophat2 v2.1.0 with the parameters “–no novel junctions” and “–G” Accepted bam files were used for counting gene read numbers with HTSeq a 10 s no Test of differential expression of each transposonis was implemented by DESeq2 in Bioconductor Genome build: GRCz10 Supplementary files format and content: .txt Reads count of genes liver/pooled   Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501   tissue:pooled liver|genotype/variation:WT GSM3754093 GSM3754093: sibslivr1: 5 dpf Livers non transgenic siblings 1; Danio rerio; RNA Seq GSM3754093   1 Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 GEO Accession:GSM3754093 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP195753     Sample_sibslivr1_read1.fastq.gz Sample_sibslivr1_read2.fastq.gz fastq fastq 6725147216.0 33292808.0 GSM3754093 r1 0:101 1:101 A:1807945249;C:1550856849;G:1534573991;T:1826050327;N:5720800 101 101     1807945249 1550856849 1534573991 1826050327 5720800 SRX5800871 SRS4730903 SRA883585 GEO Biology, New York University Abu Dhabi 2 0.90678 0.9037 0.2571 0.25652 0.76278 0.76577 0.58002 0.58511 101 101 B B biological fallback assumption illumina hiseq_era unknown poly_a ribozero bulk unknown unknown   United Arab Emirates 2019-05-07 Larval Larval Liver Liver and Biliary System
52234 52234 SRR9022962 SRX5800870 SRS4730902 SRP195753 PRJNA541476 Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf GSE130800 Transcriptome Analysis Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina parent bioproject:PRJNA541472     nATF63: 5 dpf Livers of ATF6 transgenic zebrafish 3 GSM3754098   source name:liver/pooled|tissue:pooled liver|genotype/variation:ATF6 transgenic nATF63: 5 dpf Livers of ATF6 transgenic zebrafish 3 Illumina Casava1.8 software used for basecalling. The raw reads were quality assessed using FastQC v0.11.5. The raw reads were then quality trimmed using Trimmomatic trimmomatic adapter.fa:2:30:10 TRAILING:3 LEADING:3 SLIDINGWINDOW:4:15 MINLEN:36 Alignments of trimmed reads were performed using tophat2 v2.1.0 with the parameters “–no novel junctions” and “–G” Accepted bam files were used for counting gene read numbers with HTSeq a 10 s no Test of differential expression of each transposonis was implemented by DESeq2 in Bioconductor Genome build: GRCz10 Supplementary files format and content: .txt Reads count of genes liver/pooled   Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501   tissue:pooled liver|genotype/variation:ATF6 transgenic GSM3754098 GSM3754098: nATF63: 5 dpf Livers of ATF6 transgenic zebrafish 3; Danio rerio; RNA Seq GSM3754098   1 Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 GEO Accession:GSM3754098 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP195753     Sample_nATf6livr3_read1.fastq.gz Sample_nATf6livr3_read2.fastq.gz fastq fastq 7130808262.0 35301031.0 GSM3754098 r1 0:101 1:101 A:1932123103;C:1630530590;G:1610405576;T:1951735071;N:6013922 101 101     1932123103 1630530590 1610405576 1951735071 6013922 SRX5800870 SRS4730902 SRA883585 GEO Biology, New York University Abu Dhabi 2 0.92219 0.92075 0.23152 0.23034 0.76921 0.77082 0.57948 0.56906 101 101 B B biological fallback assumption illumina hiseq_era unknown poly_a ribozero bulk unknown unknown   United Arab Emirates 2019-05-07 Larval Larval Liver Liver and Biliary System
52235 52235 SRR9022961 SRX5800869 SRS4730901 SRP195753 PRJNA541476 Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf GSE130800 Transcriptome Analysis Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina parent bioproject:PRJNA541472     nATF62: 5 dpf Livers of ATF6 transgenic zebrafish 2 GSM3754097   source name:liver/pooled|tissue:pooled liver|genotype/variation:ATF6 transgenic nATF62: 5 dpf Livers of ATF6 transgenic zebrafish 2 Illumina Casava1.8 software used for basecalling. The raw reads were quality assessed using FastQC v0.11.5. The raw reads were then quality trimmed using Trimmomatic trimmomatic adapter.fa:2:30:10 TRAILING:3 LEADING:3 SLIDINGWINDOW:4:15 MINLEN:36 Alignments of trimmed reads were performed using tophat2 v2.1.0 with the parameters “–no novel junctions” and “–G” Accepted bam files were used for counting gene read numbers with HTSeq a 10 s no Test of differential expression of each transposonis was implemented by DESeq2 in Bioconductor Genome build: GRCz10 Supplementary files format and content: .txt Reads count of genes liver/pooled   Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501   tissue:pooled liver|genotype/variation:ATF6 transgenic GSM3754097 GSM3754097: nATF62: 5 dpf Livers of ATF6 transgenic zebrafish 2; Danio rerio; RNA Seq GSM3754097   1 Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 GEO Accession:GSM3754097 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP195753     Sample_nATf6livr2_read2.fastq.gz Sample_nATf6livr2_read1.fastq.gz fastq fastq 5486331312.0 27160056.0 GSM3754097 r1 0:101 1:101 A:1493169496;C:1246316651;G:1231427098;T:1510719043;N:4699024 101 101     1493169496 1246316651 1231427098 1510719043 4699024 SRX5800869 SRS4730901 SRA883585 GEO Biology, New York University Abu Dhabi 2 0.92507 0.92307 0.23526 0.23571 0.77037 0.77309 0.57584 0.57036 101 101 B B biological fallback assumption illumina hiseq_era unknown poly_a ribozero bulk unknown unknown   United Arab Emirates 2019-05-07 Larval Larval Liver Liver and Biliary System
52236 52236 SRR9022960 SRX5800868 SRS4730900 SRP195753 PRJNA541476 Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf GSE130800 Transcriptome Analysis Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina parent bioproject:PRJNA541472     nATF61: 5 dpf Livers of ATF6 transgenic zebrafish 1 GSM3754096   source name:liver/pooled|tissue:pooled liver|genotype/variation:ATF6 transgenic nATF61: 5 dpf Livers of ATF6 transgenic zebrafish 1 Illumina Casava1.8 software used for basecalling. The raw reads were quality assessed using FastQC v0.11.5. The raw reads were then quality trimmed using Trimmomatic trimmomatic adapter.fa:2:30:10 TRAILING:3 LEADING:3 SLIDINGWINDOW:4:15 MINLEN:36 Alignments of trimmed reads were performed using tophat2 v2.1.0 with the parameters “–no novel junctions” and “–G” Accepted bam files were used for counting gene read numbers with HTSeq a 10 s no Test of differential expression of each transposonis was implemented by DESeq2 in Bioconductor Genome build: GRCz10 Supplementary files format and content: .txt Reads count of genes liver/pooled   Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501   tissue:pooled liver|genotype/variation:ATF6 transgenic GSM3754096 GSM3754096: nATF61: 5 dpf Livers of ATF6 transgenic zebrafish 1; Danio rerio; RNA Seq GSM3754096   1 Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 GEO Accession:GSM3754096 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP195753     Sample_nATf6lvr1_read1.fastq.gz Sample_nATf6lvr1_read2.fastq.gz fastq fastq 5630223992.0 27872396.0 GSM3754096 r1 0:101 1:101 A:1522612856;C:1288278884;G:1272888351;T:1541688412;N:4755489 101 101     1522612856 1288278884 1272888351 1541688412 4755489 SRX5800868 SRS4730900 SRA883585 GEO Biology, New York University Abu Dhabi 2 0.92611 0.92447 0.2306 0.23075 0.77197 0.77327 0.59605 0.58935 101 101 B B biological fallback assumption illumina hiseq_era unknown poly_a ribozero bulk unknown unknown   United Arab Emirates 2019-05-07 Larval Larval Liver Liver and Biliary System
52237 52237 SRR9022959 SRX5800867 SRS4730899 SRP195753 PRJNA541476 Transcriptomic profiling of zebrafish livers with nAtf6 overexpression at collected at 78 hpf and 120 hpf GSE130800 Transcriptome Analysis Activting transcription factor 6 Atf6 is one of three main mediators of the Unfolded Protein Response and it gets cleaved cleaved in the Golgi and its N terminal consisting of the bZip domain translocates into the nucleus to generate a transcriptional response nAtf6. This study carries out RNAseq on an established transgenic overexpression of nAtf6 in zebrafish hepatocytes tgfabp10:nAtf6 cherry; cmlc2:GFP C allele. Samples were collected at 78 hpf and 120 hpf to detect gene expression changes at early and late time points post nAtf6 is overexpressed. Overall design: We used two transgenic lines: Tgfabp10a: CAAX EGFP to use as a marker of the liver for dissction and tgfabp10:nAtf6 cherry; cmlc2:GFP C allele to overexpress nAtf6 specifically in hepatocytes.This experiment was conducted by natural spawnings between tg:fabp10:nAtf6 cherry; cmlc2:GFP C and tgfabp10a:CAAX EGFP . Using GFP to guide microdissscion of 20 25 livers at 78 hpf and 120 hpf . Total RNA isolated using TRIZOL and treated by DNAse I. Libraries were prepared using RiboZero for 120 hpf samples or polyA selection for 78 hpf samples. Samples from 2 clutches collected at 78 hpf and 3 clutches at 120 hpf. Samples were sequenced on NextSeq550 Illumina parent bioproject:PRJNA541472     sibslivr3: 5 dpf Livers non transgenic siblings 3 GSM3754095   source name:liver/pooled|tissue:pooled liver|genotype/variation:WT sibslivr3: 5 dpf Livers non transgenic siblings 3 Illumina Casava1.8 software used for basecalling. The raw reads were quality assessed using FastQC v0.11.5. The raw reads were then quality trimmed using Trimmomatic trimmomatic adapter.fa:2:30:10 TRAILING:3 LEADING:3 SLIDINGWINDOW:4:15 MINLEN:36 Alignments of trimmed reads were performed using tophat2 v2.1.0 with the parameters “–no novel junctions” and “–G” Accepted bam files were used for counting gene read numbers with HTSeq a 10 s no Test of differential expression of each transposonis was implemented by DESeq2 in Bioconductor Genome build: GRCz10 Supplementary files format and content: .txt Reads count of genes liver/pooled   Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501   tissue:pooled liver|genotype/variation:WT GSM3754095 GSM3754095: sibslivr3: 5 dpf Livers non transgenic siblings 3; Danio rerio; RNA Seq GSM3754095   1 Tgfabp10:nAtf6 cherry; cmlc2:GFPC+/ were outcrossed to WT TAB 14 and the embryos were sorted and segregated basing on the expression of Cmlc2:GFP. The three different clutches of embryos were collected and dissected over three different days. The embryos were collected inbetween 10 11 AM. The Liver dissection was also performed on the 5dpf larvae before noon. 25 livers from 5dpf embryos were pooled per sample Transgenic and WT siblings in two different tubes and RNA extracted with Trizol as per manufacturer's instructions.The RNA was later treated with DNAse to remove any DNA. They RNA concentration was taken on the Q bit and then analysed on the Bioanalyser for the integrety and quality of RNA. The RIN score for the samples was above 8.5 RNA seq libraries were prepared according to Illumina TruSeq RNA sample preparation version 2 protocol with Ribo Zero Gold Catalog #: RS 122 2501 GEO Accession:GSM3754095 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   SRP195753     Sample_sibsliver3_read1.fastq.gz Sample_sibsliver3_read2.fastq.gz fastq fastq 6850257532.0 33912166.0 GSM3754095 r1 0:101 1:101 A:1828622009;C:1589528833;G:1578789352;T:1847472374;N:5844964 101 101     1828622009 1589528833 1578789352 1847472374 5844964 SRX5800867 SRS4730899 SRA883585 GEO Biology, New York University Abu Dhabi 2 0.90629 0.9034 0.25074 0.24972 0.76266 0.7657 0.56281 0.56537 101 101 B B biological fallback assumption illumina hiseq_era unknown poly_a ribozero bulk unknown unknown   United Arab Emirates 2019-05-07 Larval Larval Liver Liver and Biliary System
55264 55264 SRR10210692 SRX6930433 SRS5460728 SRP223875 PRJNA575225 Biliary Atresia associated Mannosidase 1 alpha 2 gene regulates biliary and ciliary morphogenesis and laterality zebrafish GSE138251 Transcriptome Analysis The effect of MAN1A2 on biliary morphogenesis left right patterning and ciliogenesis was evaluated with knockdown in zebrafish and subsequent RNAseq experiment/analysis. Overall design: Total RNA sequencing protocol was performed on pooled liver tissue from all three batches one from controls and one from man1a2 morphant zebrafish. Each pool consisted of 100 livers from three batches of zebrafish larvae at 5 dpf   pubmed:33192543   Pooled MAN1A2 RNA seq GSM4103428   source name:liver tissue|tissue:liver|condition:MAN1A2 knockdown|developmental stage:Larvae at 5 dpf Pooled MAN1A2 RNA seq The quality of the sequencing reads was verified using FastQC. Omicsoft Sequence Aligner 2 was used to align the sequencing reads to Zebrafish genome. DEseq2 R package for RNAseq data was used for differential analysis. Genome build: GRCz10 Supplementary files format and content: For each processed data file there are 2 columns: the first column being Ensembl gene ID and the second column being raw read counts. liver tissue arf6 ATG MO 5’ GATCTTGGAAAGCATCTTCCCCATG 3’ man1a2 ATG MO 5’ CCGGCGTGGTCATATTTTGATGATC 3’ and man1a2 splicing MO 5’ AAGAATGTAAACTCACCTCTCTGAT 3’ were purchased from Gene Tools LLC. Embryos were injected at the one cell stage with man1a2 ATG MO 1.5 or 4.5 ng man1a2 splicing MO 5 or 7.5 ng or arf6 ATG MO 0.5 ng. Total RNA was extracted from three different batches of 100 livers of uninjected control and man1a2 MO injected larvae at xxx dpf by using RNeasy Mini Kit. The pooled RNA was used to generate mRNA sequencing libraries using Illumina TruSeq Stranded mRNA sample preparation kit. Poly A containing mRNA molecules were purified using poly T oligo attached magnetic beads mRNA fragmented into small pieces using divalent cations and copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by using dUTP in the Second Strand Marking Mix followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. These cDNA fragments were ligated to single 'A' base and adapter then purified and enriched with PCR to create the final cDNA libraries. Embryos and adult fish were raised and maintained under standard laboratory conditions. We used the following transgenic lines: Tgdusp6:d2EGFPpt6 10 Tgkrt18:EGFPp314 11 TgEPV.Tp1 Mmu.Hbb:EGFPum14 12 TgEPV.Tp1 Mmu.Hbb:hist2h2l mCherrys939 13 and Tgfabp10a:DsRed ela3l:EGFPgz15 14 [the last three referred to here as TgTp1:GFP TgTp1:H2B mCherry and Tgfabp10a:DsRed respectively]. tissue:liver|condition:MAN1A2 knockdown|developmental stage:Larvae at 5 dpf GSM4103428 GSM4103428: Pooled MAN1A2 RNA seq; Danio rerio; RNA Seq GSM4103428   1 Total RNA was extracted from three different batches of 100 livers of uninjected control and man1a2 MO injected larvae at xxx dpf by using RNeasy Mini Kit. The pooled RNA was used to generate mRNA sequencing libraries using Illumina TruSeq Stranded mRNA sample preparation kit. Poly A containing mRNA molecules were purified using poly T oligo attached magnetic beads mRNA fragmented into small pieces using divalent cations and copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by using dUTP in the Second Strand Marking Mix followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. These cDNA fragments were ligated to single 'A' base and adapter then purified and enriched with PCR to create the final cDNA libraries. GEO Accession:GSM4103428 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP223875     dr_man1a2_m_S16_all_R1_001.fastq.gz dr_man1a2_m_S16_all_R2_001.fastq.gz fastq fastq 5936191400.0 29680957.0 GSM4103428 r1 0:100 1:100 A:1578413598;C:1390775252;G:1427068571;T:1535244145;N:4689834 100 100     1578413598 1390775252 1427068571 1535244145 4689834 SRX6930433 SRS5460728 SRA970723 GEO Systems Biology, Bioengineering, UCSD 2 0.95924 0.8982 0.03926 0.03468 0.79622 0.80925 0.49947 0.48222 100 100 B B biological fallback assumption illumina nextseq unknown poly_a trueseq bulk unknown unknown   United States 2019-10-01 Larval Larval Liver Liver and Biliary System
55265 55265 SRR10210691 SRX6930432 SRS5460727 SRP223875 PRJNA575225 Biliary Atresia associated Mannosidase 1 alpha 2 gene regulates biliary and ciliary morphogenesis and laterality zebrafish GSE138251 Transcriptome Analysis The effect of MAN1A2 on biliary morphogenesis left right patterning and ciliogenesis was evaluated with knockdown in zebrafish and subsequent RNAseq experiment/analysis. Overall design: Total RNA sequencing protocol was performed on pooled liver tissue from all three batches one from controls and one from man1a2 morphant zebrafish. Each pool consisted of 100 livers from three batches of zebrafish larvae at 5 dpf   pubmed:33192543   Pooled control RNA seq GSM4103427   source name:liver tissue|tissue:liver|condition:Normal|developmental stage:Larvae at 5 dpf Pooled control RNA seq The quality of the sequencing reads was verified using FastQC. Omicsoft Sequence Aligner 2 was used to align the sequencing reads to Zebrafish genome. DEseq2 R package for RNAseq data was used for differential analysis. Genome build: GRCz10 Supplementary files format and content: For each processed data file there are 2 columns: the first column being Ensembl gene ID and the second column being raw read counts. liver tissue arf6 ATG MO 5’ GATCTTGGAAAGCATCTTCCCCATG 3’ man1a2 ATG MO 5’ CCGGCGTGGTCATATTTTGATGATC 3’ and man1a2 splicing MO 5’ AAGAATGTAAACTCACCTCTCTGAT 3’ were purchased from Gene Tools LLC. Embryos were injected at the one cell stage with man1a2 ATG MO 1.5 or 4.5 ng man1a2 splicing MO 5 or 7.5 ng or arf6 ATG MO 0.5 ng. Total RNA was extracted from three different batches of 100 livers of uninjected control and man1a2 MO injected larvae at xxx dpf by using RNeasy Mini Kit. The pooled RNA was used to generate mRNA sequencing libraries using Illumina TruSeq Stranded mRNA sample preparation kit. Poly A containing mRNA molecules were purified using poly T oligo attached magnetic beads mRNA fragmented into small pieces using divalent cations and copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by using dUTP in the Second Strand Marking Mix followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. These cDNA fragments were ligated to single 'A' base and adapter then purified and enriched with PCR to create the final cDNA libraries. Embryos and adult fish were raised and maintained under standard laboratory conditions. We used the following transgenic lines: Tgdusp6:d2EGFPpt6 10 Tgkrt18:EGFPp314 11 TgEPV.Tp1 Mmu.Hbb:EGFPum14 12 TgEPV.Tp1 Mmu.Hbb:hist2h2l mCherrys939 13 and Tgfabp10a:DsRed ela3l:EGFPgz15 14 [the last three referred to here as TgTp1:GFP TgTp1:H2B mCherry and Tgfabp10a:DsRed respectively]. tissue:liver|condition:Normal|developmental stage:Larvae at 5 dpf GSM4103427 GSM4103427: Pooled control RNA seq; Danio rerio; RNA Seq GSM4103427   1 Total RNA was extracted from three different batches of 100 livers of uninjected control and man1a2 MO injected larvae at xxx dpf by using RNeasy Mini Kit. The pooled RNA was used to generate mRNA sequencing libraries using Illumina TruSeq Stranded mRNA sample preparation kit. Poly A containing mRNA molecules were purified using poly T oligo attached magnetic beads mRNA fragmented into small pieces using divalent cations and copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by using dUTP in the Second Strand Marking Mix followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. These cDNA fragments were ligated to single 'A' base and adapter then purified and enriched with PCR to create the final cDNA libraries. GEO Accession:GSM4103427 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP223875     dr_control_S15_all_R2_001.fastq.gz dr_control_S15_all_R1_001.fastq.gz fastq fastq 6246641800.0 31233209.0 GSM4103427 r1 0:100 1:100 A:1630491563;C:1497737062;G:1532797800;T:1580737839;N:4877536 100 100     1630491563 1497737062 1532797800 1580737839 4877536 SRX6930432 SRS5460727 SRA970723 GEO Systems Biology, Bioengineering, UCSD 2 0.96082 0.96474 0.05307 0.05238 0.80164 0.80846 0.50767 0.5068 100 100 B B biological fallback assumption illumina nextseq unknown poly_a trueseq bulk unknown unknown   United States 2019-10-01 Larval Larval Liver Liver and Biliary System
56826 56826 SRR11114801 SRX7751804 SRS6171095 SRP250035 PRJNA607563 Transcriptomic profile of zebrafish liver cells in thioacetamide TAA model GSE145564 Transcriptome Analysis Zebrafish transgenic lines Tgfabp10a:dsRed Tghand2:EGFP and Tgkdrl:ras mCherry in AB wild type background were anesthetized with MS 222 and adult females were injected intraperitoneally with 500 mg/kg thioacetamide TAA or sterile water as a control 6 times over the course of 2 weeks. We have characterized transcriptomic profiles of FACS isolated hepatocytes dsRed+ stellate cells EGFP+ and liver endothelial cells mCherry+ from fishes treated with TAA or sterile water. Cells negative for the fluorescence were used as a control. Overall design: Examination of transcriptomic profile of zebrafish hepatocytes stellate cells and liver enothelial cells treated with thioacetamide TAA and control sterile water cell specific reporters: fabp = hep hepatocytes hand = hsc hepatic stellate cells kdlr = ec endothelial cells parent bioproject:PRJNA607562 pubmed:34920711   RNA kdlr pos 3 TAA GSM4321576   tissue:FACS sorted liver cells|treatment:TAA|genetic background:AB|genotype:Tgkdrl:ras mCherry|fluorescence:mCherry positive|Sex:female|cell type:FACS sorted liver cells RNA kdlr pos 3 TAA Raw RNA seq and ATAC seq reads were quality checked using Fastqc 0.11.8 Adapters were removed using Cutadapt 1.18 Reads quality filtering was performed using SAMtools 1.9 RNA seq reads were aligned to the zebrafish reference genome GRCz11 using STAR 2.6 Gene counts were calculated by using R GenomicRanges Bioconductor package and tranformed to regularized logarithm DESeq2 Bioconductor package Genome build: GRCz11 Supplementary files format and content: comma separated file containing normalized read counts rlog of Ensembl annotated genes organized in columns for each sample separately FACS sorted liver cells Adult females were anesthetized with MS 222 Sigma Aldrich Germany as previously described and injected intraperitoneally with 500 mg/kg thioacetamide TAA or sterile water as a control 6 times over the course of 2 weeks. For RNA sequencing 100 000 of fluorescent liver cells were sorted directly to TRIzol LS Thermo Fisher Scientific USA. post ethanol precipitation RNA was depleted of DNA by using DNase I treatment and purified on columns by using RNA Clean & Concentrator™ 5 Zymo Research USA Sequencing libraries were performed from total RNA by using SMARTer low input RNA Kit Clontech according to manufacturer protocol. Zebrafish transgenic lines Tgfabp10a:dsRed Tghand2:EGFP and Tgkdrl:ras mCherry in AB wild type background were maintained in the IIMCB zebrafish facility License no. PL14656251 according to standard procedures. treatment:TAA|genetic background:AB|genotype:Tgkdrl:ras mCherry|fluorescence:mCherry positive|Sex:female|cell type:FACS sorted liver cells GSM4321576 GSM4321576: RNA kdlr pos 3 TAA; Danio rerio; RNA Seq GSM4321576   1 For RNA sequencing 100 000 of fluorescent liver cells were sorted directly to TRIzol LS Thermo Fisher Scientific USA. post ethanol precipitation RNA was depleted of DNA by using DNase I treatment and purified on columns by using RNA Clean & Concentrator™ 5 Zymo Research USA Sequencing libraries were performed from total RNA by using SMARTer low input RNA Kit Clontech according to manufacturer protocol. GEO Accession:GSM4321576 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP250035     RNA_kdlr_pos_3_TAA_R2.fastq.gz RNA_kdlr_pos_3_TAA_R1.fastq.gz fastq fastq 6811611264.0 44813232.0 GSM4321576 r1 0:76 1:76 A:1225138550;C:2147122785;G:2282464539;T:1155950193;N:935197 76 76     1225138550 2147122785 2282464539 1155950193 935197 SRX7751804 SRS6171095 SRA1044822 GEO Zebrafish Developmental Genomics Lab, International Institute of Molecular and Cell Biology 2 0.9507 0.95579 0.08932 0.08493 0.94371 0.96053 0.57322 0.60678 76 76 B B biological fallback assumption illumina nextseq full_length cdna_unspecified smarter bulk unknown unknown   Poland 2020-02-19 Larval Larval Liver Liver and Biliary System
56827 56827 SRR11114800 SRX7751803 SRS6171094 SRP250035 PRJNA607563 Transcriptomic profile of zebrafish liver cells in thioacetamide TAA model GSE145564 Transcriptome Analysis Zebrafish transgenic lines Tgfabp10a:dsRed Tghand2:EGFP and Tgkdrl:ras mCherry in AB wild type background were anesthetized with MS 222 and adult females were injected intraperitoneally with 500 mg/kg thioacetamide TAA or sterile water as a control 6 times over the course of 2 weeks. We have characterized transcriptomic profiles of FACS isolated hepatocytes dsRed+ stellate cells EGFP+ and liver endothelial cells mCherry+ from fishes treated with TAA or sterile water. Cells negative for the fluorescence were used as a control. Overall design: Examination of transcriptomic profile of zebrafish hepatocytes stellate cells and liver enothelial cells treated with thioacetamide TAA and control sterile water cell specific reporters: fabp = hep hepatocytes hand = hsc hepatic stellate cells kdlr = ec endothelial cells parent bioproject:PRJNA607562 pubmed:34920711   RNA kdlr pos 3 ctrl GSM4321575   tissue:FACS sorted liver cells|treatment:sterile water|genetic background:AB|genotype:Tgkdrl:ras mCherry|fluorescence:mCherry positive|Sex:female|cell type:FACS sorted liver cells RNA kdlr pos 3 ctrl Raw RNA seq and ATAC seq reads were quality checked using Fastqc 0.11.8 Adapters were removed using Cutadapt 1.18 Reads quality filtering was performed using SAMtools 1.9 RNA seq reads were aligned to the zebrafish reference genome GRCz11 using STAR 2.6 Gene counts were calculated by using R GenomicRanges Bioconductor package and tranformed to regularized logarithm DESeq2 Bioconductor package Genome build: GRCz11 Supplementary files format and content: comma separated file containing normalized read counts rlog of Ensembl annotated genes organized in columns for each sample separately FACS sorted liver cells Adult females were anesthetized with MS 222 Sigma Aldrich Germany as previously described and injected intraperitoneally with 500 mg/kg thioacetamide TAA or sterile water as a control 6 times over the course of 2 weeks. For RNA sequencing 100 000 of fluorescent liver cells were sorted directly to TRIzol LS Thermo Fisher Scientific USA. post ethanol precipitation RNA was depleted of DNA by using DNase I treatment and purified on columns by using RNA Clean & Concentrator™ 5 Zymo Research USA Sequencing libraries were performed from total RNA by using SMARTer low input RNA Kit Clontech according to manufacturer protocol. Zebrafish transgenic lines Tgfabp10a:dsRed Tghand2:EGFP and Tgkdrl:ras mCherry in AB wild type background were maintained in the IIMCB zebrafish facility License no. PL14656251 according to standard procedures. treatment:sterile water|genetic background:AB|genotype:Tgkdrl:ras mCherry|fluorescence:mCherry positive|Sex:female|cell type:FACS sorted liver cells GSM4321575 GSM4321575: RNA kdlr pos 3 ctrl; Danio rerio; RNA Seq GSM4321575   1 For RNA sequencing 100 000 of fluorescent liver cells were sorted directly to TRIzol LS Thermo Fisher Scientific USA. post ethanol precipitation RNA was depleted of DNA by using DNase I treatment and purified on columns by using RNA Clean & Concentrator™ 5 Zymo Research USA Sequencing libraries were performed from total RNA by using SMARTer low input RNA Kit Clontech according to manufacturer protocol. GEO Accession:GSM4321575 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP250035     RNA_kdlr_pos_3_ctrl_R2.fastq.gz RNA_kdlr_pos_3_ctrl_R1.fastq.gz fastq fastq 4676256819.0 31322059.0 GSM4321575 r1 0:74.66 1:74.64 A:847890577;C:1438938414;G:1559940415;T:829247648;N:239765 74 74     847890577 1438938414 1559940415 829247648 239765 SRX7751803 SRS6171094 SRA1044822 GEO Zebrafish Developmental Genomics Lab, International Institute of Molecular and Cell Biology 2 0.95001 0.96334 0.12275 0.12123 0.86393 0.8704 0.75026 0.75617 75 73 B B biological fallback assumption illumina nextseq full_length cdna_unspecified smarter bulk unknown unknown   Poland 2020-02-19 Larval Larval Liver Liver and Biliary System
56828 56828 SRR11114799 SRX7751802 SRS6171093 SRP250035 PRJNA607563 Transcriptomic profile of zebrafish liver cells in thioacetamide TAA model GSE145564 Transcriptome Analysis Zebrafish transgenic lines Tgfabp10a:dsRed Tghand2:EGFP and Tgkdrl:ras mCherry in AB wild type background were anesthetized with MS 222 and adult females were injected intraperitoneally with 500 mg/kg thioacetamide TAA or sterile water as a control 6 times over the course of 2 weeks. We have characterized transcriptomic profiles of FACS isolated hepatocytes dsRed+ stellate cells EGFP+ and liver endothelial cells mCherry+ from fishes treated with TAA or sterile water. Cells negative for the fluorescence were used as a control. Overall design: Examination of transcriptomic profile of zebrafish hepatocytes stellate cells and liver enothelial cells treated with thioacetamide TAA and control sterile water cell specific reporters: fabp = hep hepatocytes hand = hsc hepatic stellate cells kdlr = ec endothelial cells parent bioproject:PRJNA607562 pubmed:34920711   RNA kdlr pos 2 TAA GSM4321574   tissue:FACS sorted liver cells|treatment:TAA|genetic background:AB|genotype:Tgkdrl:ras mCherry|fluorescence:mCherry positive|Sex:female|cell type:FACS sorted liver cells RNA kdlr pos 2 TAA Raw RNA seq and ATAC seq reads were quality checked using Fastqc 0.11.8 Adapters were removed using Cutadapt 1.18 Reads quality filtering was performed using SAMtools 1.9 RNA seq reads were aligned to the zebrafish reference genome GRCz11 using STAR 2.6 Gene counts were calculated by using R GenomicRanges Bioconductor package and tranformed to regularized logarithm DESeq2 Bioconductor package Genome build: GRCz11 Supplementary files format and content: comma separated file containing normalized read counts rlog of Ensembl annotated genes organized in columns for each sample separately FACS sorted liver cells Adult females were anesthetized with MS 222 Sigma Aldrich Germany as previously described and injected intraperitoneally with 500 mg/kg thioacetamide TAA or sterile water as a control 6 times over the course of 2 weeks. For RNA sequencing 100 000 of fluorescent liver cells were sorted directly to TRIzol LS Thermo Fisher Scientific USA. post ethanol precipitation RNA was depleted of DNA by using DNase I treatment and purified on columns by using RNA Clean & Concentrator™ 5 Zymo Research USA Sequencing libraries were performed from total RNA by using SMARTer low input RNA Kit Clontech according to manufacturer protocol. Zebrafish transgenic lines Tgfabp10a:dsRed Tghand2:EGFP and Tgkdrl:ras mCherry in AB wild type background were maintained in the IIMCB zebrafish facility License no. PL14656251 according to standard procedures. treatment:TAA|genetic background:AB|genotype:Tgkdrl:ras mCherry|fluorescence:mCherry positive|Sex:female|cell type:FACS sorted liver cells GSM4321574 GSM4321574: RNA kdlr pos 2 TAA; Danio rerio; RNA Seq GSM4321574   1 For RNA sequencing 100 000 of fluorescent liver cells were sorted directly to TRIzol LS Thermo Fisher Scientific USA. post ethanol precipitation RNA was depleted of DNA by using DNase I treatment and purified on columns by using RNA Clean & Concentrator™ 5 Zymo Research USA Sequencing libraries were performed from total RNA by using SMARTer low input RNA Kit Clontech according to manufacturer protocol. GEO Accession:GSM4321574 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP250035     RNA_kdlr_pos_2_TAA_R1.fastq.gz RNA_kdlr_pos_2_TAA_R2.fastq.gz fastq fastq 5569241392.0 36639746.0 GSM4321574 r1 0:76 1:76 A:1021150275;C:1717497658;G:1851818735;T:978010673;N:764051 76 76     1021150275 1717497658 1851818735 978010673 764051 SRX7751802 SRS6171093 SRA1044822 GEO Zebrafish Developmental Genomics Lab, International Institute of Molecular and Cell Biology 2 0.94843 0.95051 0.07004 0.06371 0.92732 0.94838 0.62057 0.63854 76 76 B B biological fallback assumption illumina nextseq full_length cdna_unspecified smarter bulk unknown unknown   Poland 2020-02-19 Larval Larval Liver Liver and Biliary System

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;