RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

1,151 rows where devstage_curation = "Larval" and tissue_curation = "Embryo Imprecise"

✎ View and edit SQL

This data as json, CSV (advanced)

experiment.library_selection 10

technology 7

experiment.platform 7

experiment.library_strategy 7

experiment.library_source 2

experiment.library_layout 2

tissue_curation_coarse 1

tissue_curation 1

  • Embryo Imprecise · 1,151 ✖

devstage_curation_coarse 1

devstage_curation 1

  • Larval · 1,151 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
3015 3015 ERR1396841 ERX1468100 ERS1051448 ERP013615 PRJEB12173 Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011 Transcriptome Analysis Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos. ArrayExpress:E ERAD 449     zmp ph230 dgcr8 C7 SAMEA3864314 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 sequencing SC EXP 18732 2#24 15616955 Illumina sequencing of library 15616955 constructed from sample accession ERS1051448 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence ATTCCT. Small RNA miRNA   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   ERP013615 Illumina HiSeq 2500 sequencing ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16 18732_2#24.cram cram 252742350.0 5054847.0 SC RUN 18732 2#24 0:50 A:72444190;C:64568625;G:62796637;T:52911792;N:21106 50       72444190 64568625 62796637 52911792 21106 ERX1468100 ERS1051448 ERA612385 European Nucleotide Archive Wellcome Sanger Institute 1 0.61824   0.09608   0.8842   0.56978   50   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United Kingdom 2016-02-03 Larval Larval Embryo Imprecise All anatomical structures
3039 3039 ERR1396817 ERX1468076 ERS1051448 ERP013615 PRJEB12173 Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011 Transcriptome Analysis Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos. ArrayExpress:E ERAD 449     zmp ph230 dgcr8 C7 SAMEA3864314 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 sequencing SC EXP 18732 1#24 15616955 Illumina sequencing of library 15616955 constructed from sample accession ERS1051448 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence ATTCCT. Small RNA miRNA   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2500   ERP013615 Illumina HiSeq 2500 sequencing ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16 18732_1#24.cram cram 258624300.0 5172486.0 SC RUN 18732 1#24 0:50 A:74123846;C:66047722;G:64286422;T:54141623;N:24687 50       74123846 66047722 64286422 54141623 24687 ERX1468076 ERS1051448 ERA612385 European Nucleotide Archive Wellcome Sanger Institute 1 0.62009   0.09612   0.88434   0.55718   50   B   usable mapping rate illumina hiseq_era unknown small_rna unknown bulk unknown unknown   United Kingdom 2016-02-03 Larval Larval Embryo Imprecise All anatomical structures
9361 9361 ERR3011947 ERX3014407 ERS2994081 ERP112907 PRJEB30451 Effects of anti androgenic compounds on zebrafish insulin mutants E-MTAB-7283 Transcriptome Analysis Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants. ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18   Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina Flutamide 2 SAMEA5186582 Max Planck Institute for Heart and Lung Research ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186582|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 2|scientific name:Danio rerio|strain:ins bns102                 NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants E MTAB 7283:Flutamide 2 s Flutamide 2 s Effects of anti androgenic compounds on zebrafish insulin mutants insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina Experimental Factor: compound:flutamide|Experimental Factor: dose:10 RNA-Seq TRANSCRIPTOMIC Oligo-dT SINGLE ILLUMINA NextSeq 500   ERP112907 NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 Teja_Flutamide_2_R1.fastq.gz fastq 1754963940.0 23552243.0 E MTAB 7283:Flutamide 2 0:74.51 1:0 A:455444321;C:410713896;G:385640226;T:503155736;N:9761 74 0     455444321 410713896 385640226 503155736 9761 ERX3014407 ERS2994081 ERA1697296 European Nucleotide Archive European Nucleotide Archive 1 0.94351   0.11595   0.67483   0.48762   73   B   usable mapping rate illumina nextseq unknown poly_a trueseq bulk unknown unknown   Unknown 2018-12-18 Larval Larval Embryo Imprecise All anatomical structures
9362 9362 ERR3011946 ERX3014406 ERS2994080 ERP112907 PRJEB30451 Effects of anti androgenic compounds on zebrafish insulin mutants E-MTAB-7283 Transcriptome Analysis Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants. ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18   Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina Flutamide 1 SAMEA5186581 Max Planck Institute for Heart and Lung Research ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186581|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 1|scientific name:Danio rerio|strain:ins bns102                 NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants E MTAB 7283:Flutamide 1 s Flutamide 1 s Effects of anti androgenic compounds on zebrafish insulin mutants insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina Experimental Factor: compound:flutamide|Experimental Factor: dose:10 RNA-Seq TRANSCRIPTOMIC Oligo-dT SINGLE ILLUMINA NextSeq 500   ERP112907 NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 Teja_Flutamide_1_R1.fastq.gz fastq 1631102863.0 21898245.0 E MTAB 7283:Flutamide 1 0:74.49 1:0 A:424378341;C:380806325;G:358128992;T:467779945;N:9260 74 0     424378341 380806325 358128992 467779945 9260 ERX3014406 ERS2994080 ERA1697296 European Nucleotide Archive European Nucleotide Archive 1 0.94332   0.11797   0.67596   0.48847   75   B   usable mapping rate illumina nextseq unknown poly_a trueseq bulk unknown unknown   Unknown 2018-12-18 Larval Larval Embryo Imprecise All anatomical structures
9363 9363 ERR3011945 ERX3014405 ERS2994079 ERP112907 PRJEB30451 Effects of anti androgenic compounds on zebrafish insulin mutants E-MTAB-7283 Transcriptome Analysis Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants. ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18   Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina DMSO 2 SAMEA5186580 Max Planck Institute for Heart and Lung Research ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186580|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 2|scientific name:Danio rerio|strain:ins bns102                 NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants E MTAB 7283:DMSO 2 s DMSO 2 s Effects of anti androgenic compounds on zebrafish insulin mutants insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1 RNA-Seq TRANSCRIPTOMIC Oligo-dT SINGLE ILLUMINA NextSeq 500   ERP112907 NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 Teja_DMSO_2_R1.fastq.gz fastq 1811573293.0 24316929.0 E MTAB 7283:DMSO 2 0:74.50 1:0 A:470888315;C:423635861;G:396796840;T:520242179;N:10098 74 0     470888315 423635861 396796840 520242179 10098 ERX3014405 ERS2994079 ERA1697296 European Nucleotide Archive European Nucleotide Archive 1 0.94219   0.12305   0.67184   0.47704   75   B   usable mapping rate illumina nextseq unknown poly_a trueseq bulk unknown unknown   Unknown 2018-12-18 Larval Larval Embryo Imprecise All anatomical structures
9364 9364 ERR3011944 ERX3014404 ERS2994078 ERP112907 PRJEB30451 Effects of anti androgenic compounds on zebrafish insulin mutants E-MTAB-7283 Transcriptome Analysis Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants. ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18   Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina DMSO 1 SAMEA5186579 Max Planck Institute for Heart and Lung Research ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186579|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 1|scientific name:Danio rerio|strain:ins bns102                 NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants E MTAB 7283:DMSO 1 s DMSO 1 s Effects of anti androgenic compounds on zebrafish insulin mutants insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1 RNA-Seq TRANSCRIPTOMIC Oligo-dT SINGLE ILLUMINA NextSeq 500   ERP112907 NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 Teja_DMSO_1_R1.fastq.gz fastq 1609807409.0 21611475.0 E MTAB 7283:DMSO 1 0:74.49 1:0 A:420253680;C:374436301;G:352526427;T:462581933;N:9068 74 0     420253680 374436301 352526427 462581933 9068 ERX3014404 ERS2994078 ERA1697296 European Nucleotide Archive European Nucleotide Archive 1 0.94094   0.12292   0.67006   0.48442   75   B   usable mapping rate illumina nextseq unknown poly_a trueseq bulk unknown unknown   Unknown 2018-12-18 Larval Larval Embryo Imprecise All anatomical structures
9365 9365 ERR3011943 ERX3014403 ERS2994077 ERP112907 PRJEB30451 Effects of anti androgenic compounds on zebrafish insulin mutants E-MTAB-7283 Transcriptome Analysis Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants. ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18   Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina Cyproter1 2 SAMEA5186578 Max Planck Institute for Heart and Lung Research ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186578|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 2|scientific name:Danio rerio|strain:ins bns102                 NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants E MTAB 7283:Cyproterone 2 s Cyproterone 2 s Effects of anti androgenic compounds on zebrafish insulin mutants insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina Experimental Factor: compound:cyproter1|Experimental Factor: dose:10 RNA-Seq TRANSCRIPTOMIC Oligo-dT SINGLE ILLUMINA NextSeq 500   ERP112907 NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 Teja_Cyproterone_2_R1.fastq.gz fastq 1823142918.0 24468337.0 E MTAB 7283:Cyproterone 2 0:74.51 1:0 A:469387174;C:428783310;G:403791044;T:521171021;N:10369 74 0     469387174 428783310 403791044 521171021 10369 ERX3014403 ERS2994077 ERA1697296 European Nucleotide Archive European Nucleotide Archive 1 0.9432   0.11718   0.67389   0.4768   74   B   usable mapping rate illumina nextseq unknown poly_a trueseq bulk unknown unknown   Unknown 2018-12-18 Larval Larval Embryo Imprecise All anatomical structures
9366 9366 ERR3011942 ERX3014402 ERS2994076 ERP112907 PRJEB30451 Effects of anti androgenic compounds on zebrafish insulin mutants E-MTAB-7283 Transcriptome Analysis Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants. ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18   Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina Cyproter1 1 SAMEA5186577 Max Planck Institute for Heart and Lung Research ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186577|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 1|scientific name:Danio rerio|strain:ins bns102                 NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants E MTAB 7283:Cyproterone 1 s Cyproterone 1 s Effects of anti androgenic compounds on zebrafish insulin mutants insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina Experimental Factor: compound:cyproter1|Experimental Factor: dose:10 RNA-Seq TRANSCRIPTOMIC Oligo-dT SINGLE ILLUMINA NextSeq 500   ERP112907 NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18 Teja_Cyproterone_1_R1.fastq.gz fastq 1901027130.0 25512731.0 E MTAB 7283:Cyproterone 1 0:74.51 1:0 A:487302419;C:449208827;G:422183780;T:542321577;N:10527 74 0     487302419 449208827 422183780 542321577 10527 ERX3014402 ERS2994076 ERA1697296 European Nucleotide Archive European Nucleotide Archive 1 0.94427   0.11318   0.67294   0.47183   75   B   usable mapping rate illumina nextseq unknown poly_a trueseq bulk unknown unknown   Unknown 2018-12-18 Larval Larval Embryo Imprecise All anatomical structures
9651 9651 ERR3266392 ERX3293003 ERS3358386 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep2 SAMEA5556346 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep2 s sponge tdr gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9pos_S2_L001_R1_001.fastq.gz fastq 603238067.0 8014716.0 E MTAB 7846:sponge tdr gfp positive rep2 lane1 0:75.27 1:0 A:164797697;C:136552121;G:141138007;T:160737152;N:13090 75 0     164797697 136552121 141138007 160737152 13090 ERX3293003 ERS3358386 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95083   0.06432   0.71532   0.50098   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9652 9652 ERR3266393 ERX3293003 ERS3358386 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep2 SAMEA5556346 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep2 s sponge tdr gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9pos_S2_L002_R1_001.fastq.gz fastq 603749720.0 8021069.0 E MTAB 7846:sponge tdr gfp positive rep2 lane2 0:75.27 1:0 A:164972969;C:136661417;G:141205792;T:160896264;N:13278 75 0     164972969 136661417 141205792 160896264 13278 ERX3293003 ERS3358386 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.951   0.06542   0.71768   0.50051   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9653 9653 ERR3266394 ERX3293003 ERS3358386 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep2 SAMEA5556346 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep2 s sponge tdr gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9pos_S2_L003_R1_001.fastq.gz fastq 608154053.0 8079704.0 E MTAB 7846:sponge tdr gfp positive rep2 lane3 0:75.27 1:0 A:166117918;C:137731172;G:142320339;T:161970092;N:14532 75 0     166117918 137731172 142320339 161970092 14532 ERX3293003 ERS3358386 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95155   0.0657   0.71634   0.49493   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9654 9654 ERR3266395 ERX3293003 ERS3358386 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep2 SAMEA5556346 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep2 s sponge tdr gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9pos_S2_L004_R1_001.fastq.gz fastq 599143392.0 7959897.0 E MTAB 7846:sponge tdr gfp positive rep2 lane4 0:75.27 1:0 A:163706904;C:135622453;G:140192351;T:159605249;N:16435 75 0     163706904 135622453 140192351 159605249 16435 ERX3293003 ERS3358386 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95061   0.06431   0.71764   0.50166   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9655 9655 ERR3266388 ERX3293002 ERS3358385 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep1 SAMEA5556345 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep1 s sponge tdr gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6pos_S4_L001_R1_001.fastq.gz fastq 616761505.0 8202480.0 E MTAB 7846:sponge tdr gfp positive rep1 lane1 0:75.19 1:0 A:168679238;C:139548565;G:143969797;T:164545362;N:18543 75 0     168679238 139548565 143969797 164545362 18543 ERX3293002 ERS3358385 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95019   0.06806   0.7097   0.50337   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9656 9656 ERR3266389 ERX3293002 ERS3358385 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep1 SAMEA5556345 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep1 s sponge tdr gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6pos_S4_L002_R1_001.fastq.gz fastq 617529482.0 8212485.0 E MTAB 7846:sponge tdr gfp positive rep1 lane2 0:75.19 1:0 A:168925757;C:139655387;G:144096837;T:164831236;N:20265 75 0     168925757 139655387 144096837 164831236 20265 ERX3293002 ERS3358385 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.9492   0.06753   0.712   0.49881   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9657 9657 ERR3266390 ERX3293002 ERS3358385 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep1 SAMEA5556345 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep1 s sponge tdr gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6pos_S4_L003_R1_001.fastq.gz fastq 624156883.0 8300861.0 E MTAB 7846:sponge tdr gfp positive rep1 lane3 0:75.19 1:0 A:170696950;C:141302376;G:145759286;T:166377781;N:20490 75 0     170696950 141302376 145759286 166377781 20490 ERX3293002 ERS3358385 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94917   0.06724   0.71291   0.50783   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9658 9658 ERR3266391 ERX3293002 ERS3358385 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep1 SAMEA5556345 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep1 s sponge tdr gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6pos_S4_L004_R1_001.fastq.gz fastq 615013615.0 8179180.0 E MTAB 7846:sponge tdr gfp positive rep1 lane4 0:75.19 1:0 A:168237742;C:139106952;G:143535658;T:164110735;N:22528 75 0     168237742 139106952 143535658 164110735 22528 ERX3293002 ERS3358385 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94892   0.06723   0.71206   0.50775   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9659 9659 ERR3266384 ERX3293001 ERS3358384 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep2 SAMEA5556344 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep2 s sponge tdr gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9neg_S1_L001_R1_001.fastq.gz fastq 659562366.0 8762947.0 E MTAB 7846:sponge tdr gfp negative rep2 lane1 0:75.27 1:0 A:178744772;C:150091912;G:155092318;T:175619332;N:14032 75 0     178744772 150091912 155092318 175619332 14032 ERX3293001 ERS3358384 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.9517   0.06908   0.70822   0.48025   73   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9660 9660 ERR3266385 ERX3293001 ERS3358384 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep2 SAMEA5556344 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep2 s sponge tdr gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9neg_S1_L002_R1_001.fastq.gz fastq 658688825.0 8751176.0 E MTAB 7846:sponge tdr gfp negative rep2 lane2 0:75.27 1:0 A:178540155;C:149844100;G:154850294;T:175438757;N:15519 75 0     178540155 149844100 154850294 175438757 15519 ERX3293001 ERS3358384 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95059   0.06748   0.70806   0.48177   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9661 9661 ERR3266386 ERX3293001 ERS3358384 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep2 SAMEA5556344 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep2 s sponge tdr gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9neg_S1_L003_R1_001.fastq.gz fastq 665901310.0 8846927.0 E MTAB 7846:sponge tdr gfp negative rep2 lane3 0:75.27 1:0 A:180412445;C:151589489;G:156677030;T:177206192;N:16154 75 0     180412445 151589489 156677030 177206192 16154 ERX3293001 ERS3358384 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95095   0.06855   0.7082   0.4787   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9662 9662 ERR3266387 ERX3293001 ERS3358384 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep2 SAMEA5556344 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep2 s sponge tdr gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9neg_S1_L004_R1_001.fastq.gz fastq 655674573.0 8711278.0 E MTAB 7846:sponge tdr gfp negative rep2 lane4 0:75.27 1:0 A:177658097;C:149188009;G:154201531;T:174609176;N:17760 75 0     177658097 149188009 154201531 174609176 17760 ERX3293001 ERS3358384 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.9503   0.06838   0.70926   0.47475   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9663 9663 ERR3266380 ERX3293000 ERS3358383 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep1 SAMEA5556343 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep1 s sponge tdr gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6neg_S3_L001_R1_001.fastq.gz fastq 634491637.0 8440052.0 E MTAB 7846:sponge tdr gfp negative rep1 lane1 0:75.18 1:0 A:170881257;C:145535643;G:150561786;T:167495156;N:17795 75 0     170881257 145535643 150561786 167495156 17795 ERX3293000 ERS3358383 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94996   0.05672   0.70571   0.48691   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9664 9664 ERR3266381 ERX3293000 ERS3358383 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep1 SAMEA5556343 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep1 s sponge tdr gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6neg_S3_L002_R1_001.fastq.gz fastq 632900752.0 8418846.0 E MTAB 7846:sponge tdr gfp negative rep1 lane2 0:75.18 1:0 A:170454908;C:145141392;G:150172752;T:167112562;N:19138 75 0     170454908 145141392 150172752 167112562 19138 ERX3293000 ERS3358383 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94905   0.05627   0.70457   0.4865   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9665 9665 ERR3266382 ERX3293000 ERS3358383 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep1 SAMEA5556343 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep1 s sponge tdr gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6neg_S3_L003_R1_001.fastq.gz fastq 638530115.0 8494045.0 E MTAB 7846:sponge tdr gfp negative rep1 lane3 0:75.17 1:0 A:171907482;C:146526309;G:151612209;T:168464163;N:19952 75 0     171907482 146526309 151612209 168464163 19952 ERX3293000 ERS3358383 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94919   0.05578   0.70849   0.48073   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9666 9666 ERR3266383 ERX3293000 ERS3358383 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep1 SAMEA5556343 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep1 s sponge tdr gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6neg_S3_L004_R1_001.fastq.gz fastq 627433322.0 8346505.0 E MTAB 7846:sponge tdr gfp negative rep1 lane4 0:75.17 1:0 A:169016383;C:143886824;G:148914725;T:165593528;N:21862 75 0     169016383 143886824 148914725 165593528 21862 ERX3293000 ERS3358383 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94993   0.05721   0.7052   0.48878   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9667 9667 ERR3266376 ERX3292999 ERS3358382 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep2 SAMEA5556342 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep2 s sponge isl gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7pos_S10_L001_R1_001.fastq.gz fastq 618672195.0 8218047.0 E MTAB 7846:sponge isl gfp positive rep2 lane1 0:75.28 1:0 A:166422886;C:142212204;G:146857539;T:163167819;N:11747 75 0     166422886 142212204 146857539 163167819 11747 ERX3292999 ERS3358382 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94979   0.08351   0.70863   0.47581   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9668 9668 ERR3266377 ERX3292999 ERS3358382 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep2 SAMEA5556342 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep2 s sponge isl gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7pos_S10_L002_R1_001.fastq.gz fastq 618709102.0 8218295.0 E MTAB 7846:sponge isl gfp positive rep2 lane2 0:75.28 1:0 A:166470432;C:142189977;G:146819280;T:163216323;N:13090 75 0     166470432 142189977 146819280 163216323 13090 ERX3292999 ERS3358382 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94977   0.08255   0.70644   0.47228   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9669 9669 ERR3266378 ERX3292999 ERS3358382 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep2 SAMEA5556342 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep2 s sponge isl gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7pos_S10_L003_R1_001.fastq.gz fastq 625353059.0 8306375.0 E MTAB 7846:sponge isl gfp positive rep2 lane3 0:75.29 1:0 A:168233274;C:143793178;G:148510556;T:164802476;N:13575 75 0     168233274 143793178 148510556 164802476 13575 ERX3292999 ERS3358382 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95014   0.08368   0.70743   0.47846   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9670 9670 ERR3266379 ERX3292999 ERS3358382 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep2 SAMEA5556342 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep2 s sponge isl gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7pos_S10_L004_R1_001.fastq.gz fastq 615204990.0 8171748.0 E MTAB 7846:sponge isl gfp positive rep2 lane4 0:75.28 1:0 A:165565861;C:141380152;G:146028839;T:162214263;N:15875 75 0     165565861 141380152 146028839 162214263 15875 ERX3292999 ERS3358382 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94954   0.08233   0.70834   0.48166   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9671 9671 ERR3266372 ERX3292998 ERS3358381 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep1 SAMEA5556341 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep1 s sponge isl gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6pos_S12_L001_R1_001.fastq.gz fastq 626474467.0 8318996.0 E MTAB 7846:sponge isl gfp positive rep1 lane1 0:75.31 1:0 A:170186220;C:142441110;G:147048643;T:166786401;N:12093 75 0     170186220 142441110 147048643 166786401 12093 ERX3292998 ERS3358381 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94907   0.08132   0.69684   0.4736   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9672 9672 ERR3266373 ERX3292998 ERS3358381 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep1 SAMEA5556341 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep1 s sponge isl gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6pos_S12_L002_R1_001.fastq.gz fastq 626477579.0 8318750.0 E MTAB 7846:sponge isl gfp positive rep1 lane2 0:75.31 1:0 A:170185337;C:142396801;G:147032265;T:166850532;N:12644 75 0     170185337 142396801 147032265 166850532 12644 ERX3292998 ERS3358381 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94941   0.08253   0.6957   0.47554   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9673 9673 ERR3266374 ERX3292998 ERS3358381 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep1 SAMEA5556341 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep1 s sponge isl gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6pos_S12_L003_R1_001.fastq.gz fastq 632098509.0 8393388.0 E MTAB 7846:sponge isl gfp positive rep1 lane3 0:75.31 1:0 A:171699353;C:143766296;G:148442110;T:168177264;N:13486 75 0     171699353 143766296 148442110 168177264 13486 ERX3292998 ERS3358381 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94866   0.08247   0.69601   0.48009   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9674 9674 ERR3266375 ERX3292998 ERS3358381 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep1 SAMEA5556341 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep1 s sponge isl gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6pos_S12_L004_R1_001.fastq.gz fastq 622997479.0 8272752.0 E MTAB 7846:sponge isl gfp positive rep1 lane4 0:75.31 1:0 A:169306677;C:141586415;G:146241288;T:165847752;N:15347 75 0     169306677 141586415 146241288 165847752 15347 ERX3292998 ERS3358381 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.9483   0.08034   0.69662   0.47868   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9675 9675 ERR3266368 ERX3292997 ERS3358380 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep2 SAMEA5556340 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep2 s sponge isl gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7neg_S9_L001_R1_001.fastq.gz fastq 707454819.0 9395082.0 E MTAB 7846:sponge isl gfp negative rep2 lane1 0:75.30 1:0 A:194991862;C:157927850;G:163280639;T:191241488;N:12980 75 0     194991862 157927850 163280639 191241488 12980 ERX3292997 ERS3358380 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.93871   0.08926   0.70806   0.46501   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9676 9676 ERR3266369 ERX3292997 ERS3358380 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep2 SAMEA5556340 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep2 s sponge isl gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7neg_S9_L002_R1_001.fastq.gz fastq 704791838.0 9359668.0 E MTAB 7846:sponge isl gfp negative rep2 lane2 0:75.30 1:0 A:194317422;C:157276895;G:162624670;T:190558322;N:14529 75 0     194317422 157276895 162624670 190558322 14529 ERX3292997 ERS3358380 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.93816   0.08859   0.70999   0.4661   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9677 9677 ERR3266370 ERX3292997 ERS3358380 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep2 SAMEA5556340 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep2 s sponge isl gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7neg_S9_L003_R1_001.fastq.gz fastq 715991833.0 9508323.0 E MTAB 7846:sponge isl gfp negative rep2 lane3 0:75.30 1:0 A:197297222;C:159913026;G:165363927;T:193402765;N:14893 75 0     197297222 159913026 165363927 193402765 14893 ERX3292997 ERS3358380 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.93844   0.08854   0.70828   0.46042   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9678 9678 ERR3266371 ERX3292997 ERS3358380 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep2 SAMEA5556340 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep2 s sponge isl gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7neg_S9_L004_R1_001.fastq.gz fastq 703723869.0 9345669.0 E MTAB 7846:sponge isl gfp negative rep2 lane4 0:75.30 1:0 A:194029886;C:157050176;G:162432310;T:190193608;N:17889 75 0     194029886 157050176 162432310 190193608 17889 ERX3292997 ERS3358380 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.93897   0.08993   0.70863   0.45707   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9679 9679 ERR3266364 ERX3292996 ERS3358379 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep1 SAMEA5556339 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep1 s sponge isl gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6neg_S11_L001_R1_001.fastq.gz fastq 676581458.0 8983758.0 E MTAB 7846:sponge isl gfp negative rep1 lane1 0:75.31 1:0 A:184297337;C:153352193;G:158268476;T:180651038;N:12414 75 0     184297337 153352193 158268476 180651038 12414 ERX3292996 ERS3358379 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94981   0.07715   0.69138   0.47243   74   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9680 9680 ERR3266365 ERX3292996 ERS3358379 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep1 SAMEA5556339 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep1 s sponge isl gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6neg_S11_L002_R1_001.fastq.gz fastq 676876555.0 8987445.0 E MTAB 7846:sponge isl gfp negative rep1 lane2 0:75.31 1:0 A:184435129;C:153332402;G:158323789;T:180770978;N:14257 75 0     184435129 153332402 158323789 180770978 14257 ERX3292996 ERS3358379 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94901   0.07805   0.69179   0.47182   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9681 9681 ERR3266366 ERX3292996 ERS3358379 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep1 SAMEA5556339 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep1 s sponge isl gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6neg_S11_L003_R1_001.fastq.gz fastq 681771213.0 9052615.0 E MTAB 7846:sponge isl gfp negative rep1 lane3 0:75.31 1:0 A:185717696;C:154552039;G:159567102;T:181919781;N:14595 75 0     185717696 154552039 159567102 181919781 14595 ERX3292996 ERS3358379 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94923   0.07768   0.69167   0.47219   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9682 9682 ERR3266367 ERX3292996 ERS3358379 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep1 SAMEA5556339 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep1 s sponge isl gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6neg_S11_L004_R1_001.fastq.gz fastq 671169917.0 8911624.0 E MTAB 7846:sponge isl gfp negative rep1 lane4 0:75.31 1:0 A:182910490;C:152045814;G:157010053;T:179186548;N:17012 75 0     182910490 152045814 157010053 179186548 17012 ERX3292996 ERS3358379 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94941   0.07612   0.69106   0.47736   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9683 9683 ERR3266360 ERX3292995 ERS3358378 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp positive rep2 SAMEA5556338 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp positive rep2 s sponge ccn gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_8pos_S6_L001_R1_001.fastq.gz fastq 745666738.0 9917771.0 E MTAB 7846:sponge ccn gfp positive rep2 lane1 0:75.18 1:0 A:207714377;C:163732420;G:169037726;T:205161925;N:20290 75 0     207714377 163732420 169037726 205161925 20290 ERX3292995 ERS3358378 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94006   0.17809   0.68166   0.48912   74   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9684 9684 ERR3266361 ERX3292995 ERS3358378 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp positive rep2 SAMEA5556338 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp positive rep2 s sponge ccn gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_8pos_S6_L002_R1_001.fastq.gz fastq 747693645.0 9944395.0 E MTAB 7846:sponge ccn gfp positive rep2 lane2 0:75.19 1:0 A:208257288;C:164106384;G:169478025;T:205830399;N:21549 75 0     208257288 164106384 169478025 205830399 21549 ERX3292995 ERS3358378 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.93873   0.17738   0.68296   0.49656   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9685 9685 ERR3266362 ERX3292995 ERS3358378 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp positive rep2 SAMEA5556338 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp positive rep2 s sponge ccn gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_8pos_S6_L003_R1_001.fastq.gz fastq 756134124.0 10056818.0 E MTAB 7846:sponge ccn gfp positive rep2 lane3 0:75.19 1:0 A:210573012;C:166089133;G:171475300;T:207973232;N:23447 75 0     210573012 166089133 171475300 207973232 23447 ERX3292995 ERS3358378 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94077   0.18001   0.68004   0.49812   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9686 9686 ERR3266363 ERX3292995 ERS3358378 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp positive rep2 SAMEA5556338 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp positive rep2 s sponge ccn gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_8pos_S6_L004_R1_001.fastq.gz fastq 747687619.0 9944417.0 E MTAB 7846:sponge ccn gfp positive rep2 lane4 0:75.19 1:0 A:208315943;C:164104155;G:169484250;T:205757712;N:25559 75 0     208315943 164104155 169484250 205757712 25559 ERX3292995 ERS3358378 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94025   0.17965   0.68124   0.49249   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9687 9687 ERR3266356 ERX3292994 ERS3358377 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp positive rep1 SAMEA5556337 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp positive rep1 s sponge ccn gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_7pos_S8_L001_R1_001.fastq.gz fastq 600153564.0 7972767.0 E MTAB 7846:sponge ccn gfp positive rep1 lane1 0:75.28 1:0 A:165075878;C:133961511;G:138306424;T:162797903;N:11848 75 0     165075878 133961511 138306424 162797903 11848 ERX3292994 ERS3358377 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95367   0.14146   0.69154   0.46621   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9688 9688 ERR3266357 ERX3292994 ERS3358377 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp positive rep1 SAMEA5556337 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp positive rep1 s sponge ccn gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_7pos_S8_L002_R1_001.fastq.gz fastq 600790169.0 7981038.0 E MTAB 7846:sponge ccn gfp positive rep1 lane2 0:75.28 1:0 A:165262968;C:133988329;G:138458635;T:163066854;N:13383 75 0     165262968 133988329 138458635 163066854 13383 ERX3292994 ERS3358377 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95365   0.14116   0.69301   0.46836   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9689 9689 ERR3266358 ERX3292994 ERS3358377 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp positive rep1 SAMEA5556337 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp positive rep1 s sponge ccn gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_7pos_S8_L003_R1_001.fastq.gz fastq 608611085.0 8084904.0 E MTAB 7846:sponge ccn gfp positive rep1 lane3 0:75.28 1:0 A:167402055;C:135871708;G:140314669;T:165009252;N:13401 75 0     167402055 135871708 140314669 165009252 13401 ERX3292994 ERS3358377 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95403   0.14167   0.69311   0.4702   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9690 9690 ERR3266359 ERX3292994 ERS3358377 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp positive rep1 SAMEA5556337 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp positive rep1 s sponge ccn gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_7pos_S8_L004_R1_001.fastq.gz fastq 599558663.0 7964718.0 E MTAB 7846:sponge ccn gfp positive rep1 lane4 0:75.28 1:0 A:164965131;C:133749666;G:138194884;T:162633558;N:15424 75 0     164965131 133749666 138194884 162633558 15424 ERX3292994 ERS3358377 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95285   0.14085   0.69037   0.47345   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9691 9691 ERR3266352 ERX3292993 ERS3358376 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp negative rep2 SAMEA5556336 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp negative rep2 s sponge ccn gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_8neg_S5_L001_R1_001.fastq.gz fastq 599599608.0 7970460.0 E MTAB 7846:sponge ccn gfp negative rep2 lane1 0:75.23 1:0 A:162236409;C:136907675;G:141538730;T:158902520;N:14274 75 0     162236409 136907675 141538730 158902520 14274 ERX3292993 ERS3358376 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95404   0.05923   0.69737   0.48627   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9692 9692 ERR3266353 ERX3292993 ERS3358376 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp negative rep2 SAMEA5556336 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp negative rep2 s sponge ccn gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_8neg_S5_L002_R1_001.fastq.gz fastq 600057776.0 7976438.0 E MTAB 7846:sponge ccn gfp negative rep2 lane2 0:75.23 1:0 A:162367410;C:136994919;G:141577782;T:159102194;N:15471 75 0     162367410 136994919 141577782 159102194 15471 ERX3292993 ERS3358376 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.953   0.06085   0.6952   0.48868   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9693 9693 ERR3266354 ERX3292993 ERS3358376 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp negative rep2 SAMEA5556336 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp negative rep2 s sponge ccn gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_8neg_S5_L003_R1_001.fastq.gz fastq 607089697.0 8069901.0 E MTAB 7846:sponge ccn gfp negative rep2 lane3 0:75.23 1:0 A:164235344;C:138684000;G:143335680;T:160819270;N:15403 75 0     164235344 138684000 143335680 160819270 15403 ERX3292993 ERS3358376 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95245   0.06055   0.69589   0.48813   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9694 9694 ERR3266355 ERX3292993 ERS3358376 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp negative rep2 SAMEA5556336 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp negative rep2 s sponge ccn gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_8neg_S5_L004_R1_001.fastq.gz fastq 598098243.0 7950223.0 E MTAB 7846:sponge ccn gfp negative rep2 lane4 0:75.23 1:0 A:161836808;C:136564804;G:141157424;T:158521860;N:17347 75 0     161836808 136564804 141157424 158521860 17347 ERX3292993 ERS3358376 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95299   0.06032   0.69501   0.48928   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9695 9695 ERR3266348 ERX3292992 ERS3358375 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp negative rep1 SAMEA5556335 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp negative rep1 s sponge ccn gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_7neg_S7_L001_R1_001.fastq.gz fastq 668175990.0 8872549.0 E MTAB 7846:sponge ccn gfp negative rep1 lane1 0:75.31 1:0 A:179859350;C:153483169;G:158360605;T:176462088;N:10778 75 0     179859350 153483169 158360605 176462088 10778 ERX3292992 ERS3358375 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95955   0.07154   0.69696   0.46425   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9696 9696 ERR3266349 ERX3292992 ERS3358375 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp negative rep1 SAMEA5556335 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp negative rep1 s sponge ccn gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_7neg_S7_L002_R1_001.fastq.gz fastq 668154755.0 8872093.0 E MTAB 7846:sponge ccn gfp negative rep1 lane2 0:75.31 1:0 A:179811687;C:153454931;G:158314391;T:176560936;N:12810 75 0     179811687 153454931 158314391 176560936 12810 ERX3292992 ERS3358375 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.96029   0.06969   0.69684   0.46725   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9697 9697 ERR3266350 ERX3292992 ERS3358375 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp negative rep1 SAMEA5556335 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp negative rep1 s sponge ccn gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_7neg_S7_L003_R1_001.fastq.gz fastq 676984426.0 8989004.0 E MTAB 7846:sponge ccn gfp negative rep1 lane3 0:75.31 1:0 A:182159685;C:155578195;G:160511499;T:178722363;N:12684 75 0     182159685 155578195 160511499 178722363 12684 ERX3292992 ERS3358375 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.96012   0.07159   0.69554   0.46811   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9698 9698 ERR3266351 ERX3292992 ERS3358375 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp negative rep1 SAMEA5556335 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp negative rep1 s sponge ccn gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_7neg_S7_L004_R1_001.fastq.gz fastq 666031892.0 8843695.0 E MTAB 7846:sponge ccn gfp negative rep1 lane4 0:75.31 1:0 A:179243298;C:152946459;G:157873912;T:175953752;N:14471 75 0     179243298 152946459 157873912 175953752 14471 ERX3292992 ERS3358375 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.96014   0.07169   0.69493   0.47058   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
10285 10285 ERR7132868 ERX6700306 ERS8071630 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Oxy 6 SAMEA10418786 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418786|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:6|sample name:E MTAB 11086:Oxy 6|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Oxy 6 p Oxy 6 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.B11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.B11.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2330698400.0 23306984.0 E MTAB 11086:SLX 19351.B11.HMLG7DRXX.s 2.r 0:50 1:50 A:619569172;C:544582535;G:551543197;T:614938437;N:65059 50 50     619569172 544582535 551543197 614938437 65059 ERX6700306 ERS8071630 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.9448 0.95044 0.1029 0.09965 0.67152 0.66864 0.46844 0.47553 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10286 10286 ERR7132867 ERX6700305 ERS8071629 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Oxy 5 SAMEA10418785 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418785|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 5|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:5|sample name:E MTAB 11086:Oxy 5|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Oxy 5 p Oxy 5 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.H9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.H9.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2005314000.0 20053140.0 E MTAB 11086:SLX 19351.H9.HMLG7DRXX.s 2.r 0:50 1:50 A:533671597;C:466449227;G:473126638;T:532010412;N:56126 50 50     533671597 466449227 473126638 532010412 56126 ERX6700305 ERS8071629 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94406 0.94793 0.11192 0.10798 0.66184 0.66074 0.4603 0.4683 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10287 10287 ERR7132866 ERX6700304 ERS8071628 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Oxy 4 SAMEA10418784 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418784|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:4|sample name:E MTAB 11086:Oxy 4|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Oxy 4 p Oxy 4 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.A9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.A9.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2036392600.0 20363926.0 E MTAB 11086:SLX 19351.A9.HMLG7DRXX.s 2.r 0:50 1:50 A:547586305;C:468797712;G:476477515;T:543474510;N:56558 50 50     547586305 468797712 476477515 543474510 56558 ERX6700304 ERS8071628 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94235 0.94873 0.11388 0.11054 0.67655 0.67294 0.47135 0.47234 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10288 10288 ERR7132865 ERX6700303 ERS8071627 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Oxy 3 SAMEA10418783 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418783|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:3|sample name:E MTAB 11086:Oxy 3|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Oxy 3 p Oxy 3 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.B9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.B9.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2409819000.0 24098190.0 E MTAB 11086:SLX 19351.B9.HMLG7DRXX.s 2.r 0:50 1:50 A:641053989;C:561685242;G:569693271;T:637320302;N:66196 50 50     641053989 561685242 569693271 637320302 66196 ERX6700303 ERS8071627 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94407 0.94902 0.10789 0.10496 0.66478 0.66387 0.47154 0.47373 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10289 10289 ERR7132864 ERX6700302 ERS8071626 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Oxy 2 SAMEA10418782 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418782|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:2|sample name:E MTAB 11086:Oxy 2|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Oxy 2 p Oxy 2 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.A11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.A11.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2068575200.0 20685752.0 E MTAB 11086:SLX 19351.A11.HMLG7DRXX.s 2.r 0:50 1:50 A:547986796;C:484533693;G:490663629;T:545334125;N:56957 50 50     547986796 484533693 490663629 545334125 56957 ERX6700302 ERS8071626 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94539 0.95188 0.10373 0.10116 0.66718 0.66584 0.46991 0.47611 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10290 10290 ERR7132863 ERX6700301 ERS8071625 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Oxy 1 SAMEA10418781 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418781|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:1|sample name:E MTAB 11086:Oxy 1|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Oxy 1 p Oxy 1 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.G9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.G9.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2101607900.0 21016079.0 E MTAB 11086:SLX 19351.G9.HMLG7DRXX.s 2.r 0:50 1:50 A:557420271;C:491161431;G:497494262;T:555471610;N:60326 50 50     557420271 491161431 497494262 555471610 60326 ERX6700301 ERS8071625 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94378 0.94916 0.10779 0.10431 0.66507 0.66377 0.45477 0.4679 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10291 10291 ERR7132862 ERX6700300 ERS8071624 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Nic 6 SAMEA10418780 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418780|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:6|sample name:E MTAB 11086:Nic 6|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Nic 6 p Nic 6 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:nicotine|Experimental Factor: dose:5 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.H11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.H11.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2236235700.0 22362357.0 E MTAB 11086:SLX 19351.H11.HMLG7DRXX.s 2.r 0:50 1:50 A:597573047;C:518264376;G:525314754;T:595021334;N:62189 50 50     597573047 518264376 525314754 595021334 62189 ERX6700300 ERS8071624 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94255 0.94893 0.11268 0.10955 0.66819 0.66687 0.46882 0.47485 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10292 10292 ERR7132861 ERX6700299 ERS8071623 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Nic 5 SAMEA10418779 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418779|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 5|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:5|sample name:E MTAB 11086:Nic 5|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Nic 5 p Nic 5 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:nicotine|Experimental Factor: dose:5 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.D10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.D10.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 1904348300.0 19043483.0 E MTAB 11086:SLX 19351.D10.HMLG7DRXX.s 2.r 0:50 1:50 A:506678821;C:443756285;G:450118827;T:503742221;N:52146 50 50     506678821 443756285 450118827 503742221 52146 ERX6700299 ERS8071623 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94468 0.95019 0.10313 0.10023 0.66762 0.66513 0.47749 0.47611 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10293 10293 ERR7132860 ERX6700298 ERS8071622 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Nic 4 SAMEA10418778 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418778|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:4|sample name:E MTAB 11086:Nic 4|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Nic 4 p Nic 4 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:nicotine|Experimental Factor: dose:5 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.C10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.C10.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2134565600.0 21345656.0 E MTAB 11086:SLX 19351.C10.HMLG7DRXX.s 2.r 0:50 1:50 A:568799307;C:496480840;G:503115671;T:566109163;N:60619 50 50     568799307 496480840 503115671 566109163 60619 ERX6700298 ERS8071622 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94279 0.94878 0.11466 0.1122 0.66291 0.66176 0.46991 0.47168 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10294 10294 ERR7132859 ERX6700297 ERS8071621 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Nic 3 SAMEA10418777 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418777|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:3|sample name:E MTAB 11086:Nic 3|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Nic 3 p Nic 3 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:nicotine|Experimental Factor: dose:5 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.B10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.B10.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2409355400.0 24093554.0 E MTAB 11086:SLX 19351.B10.HMLG7DRXX.s 2.r 0:50 1:50 A:643046449;C:559571909;G:567748411;T:638920943;N:67688 50 50     643046449 559571909 567748411 638920943 67688 ERX6700297 ERS8071621 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94305 0.94796 0.11097 0.10766 0.66149 0.65888 0.46643 0.47512 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10295 10295 ERR7132858 ERX6700296 ERS8071620 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Nic 2 SAMEA10418776 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418776|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:2|sample name:E MTAB 11086:Nic 2|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Nic 2 p Nic 2 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:nicotine|Experimental Factor: dose:5 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.F10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.F10.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2046910800.0 20469108.0 E MTAB 11086:SLX 19351.F10.HMLG7DRXX.s 2.r 0:50 1:50 A:547096034;C:475610002;G:481041169;T:543104402;N:59193 50 50     547096034 475610002 481041169 543104402 59193 ERX6700296 ERS8071620 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94391 0.94965 0.10824 0.10557 0.66241 0.65963 0.47747 0.47375 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10296 10296 ERR7132857 ERX6700295 ERS8071619 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Nic 1 SAMEA10418775 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418775|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:1|sample name:E MTAB 11086:Nic 1|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Nic 1 p Nic 1 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:nicotine|Experimental Factor: dose:5 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.G10.HMLG7DRXX.s_2.r_2.fq.gz SLX-19351.G10.HMLG7DRXX.s_2.r_1.fq.gz fastq fastq 2001312600.0 20013126.0 E MTAB 11086:SLX 19351.G10.HMLG7DRXX.s 2.r 0:50 1:50 A:535065614;C:463328218;G:468900497;T:533963156;N:55115 50 50     535065614 463328218 468900497 533963156 55115 ERX6700295 ERS8071619 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94179 0.9477 0.11455 0.11139 0.66697 0.66569 0.45749 0.47217 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10297 10297 ERR7132856 ERX6700294 ERS8071618 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Cnt 6 SAMEA10418774 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418774|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:6|sample name:E MTAB 11086:Cnt 6|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Cnt 6 p Cnt 6 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:n1 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.C11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.C11.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2311609400.0 23116094.0 E MTAB 11086:SLX 19351.C11.HMLG7DRXX.s 2.r 0:50 1:50 A:616569709;C:538286683;G:545161394;T:611525546;N:66068 50 50     616569709 538286683 545161394 611525546 66068 ERX6700294 ERS8071618 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94486 0.95028 0.1097 0.10661 0.66703 0.6644 0.47311 0.47453 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10298 10298 ERR7132855 ERX6700293 ERS8071617 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Cnt 5 SAMEA10418773 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418773|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 5|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:5|sample name:E MTAB 11086:Cnt 5|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Cnt 5 p Cnt 5 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:n1 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.G11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.G11.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 1590322800.0 15903228.0 E MTAB 11086:SLX 19351.G11.HMLG7DRXX.s 2.r 0:50 1:50 A:407583907;C:385496371;G:392945463;T:404250386;N:46673 50 50     407583907 385496371 392945463 404250386 46673 ERX6700293 ERS8071617 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94942 0.95571 0.10693 0.10576 0.69329 0.69063 0.46419 0.4826 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10299 10299 ERR7132854 ERX6700292 ERS8071616 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Cnt 4 SAMEA10418772 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418772|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:4|sample name:E MTAB 11086:Cnt 4|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Cnt 4 p Cnt 4 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:n1 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.C9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.C9.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2079441500.0 20794415.0 E MTAB 11086:SLX 19351.C9.HMLG7DRXX.s 2.r 0:50 1:50 A:555430147;C:483109623;G:489773903;T:551069513;N:58314 50 50     555430147 483109623 489773903 551069513 58314 ERX6700292 ERS8071616 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94258 0.9491 0.10928 0.10545 0.66561 0.66279 0.46967 0.47237 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10300 10300 ERR7132853 ERX6700291 ERS8071615 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Cnt 3 SAMEA10418771 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418771|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:3|sample name:E MTAB 11086:Cnt 3|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Cnt 3 p Cnt 3 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:n1 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.H10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.H10.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2606680900.0 26066809.0 E MTAB 11086:SLX 19351.H10.HMLG7DRXX.s 2.r 0:50 1:50 A:698010494;C:604285893;G:612505273;T:691805693;N:73547 50 50     698010494 604285893 612505273 691805693 73547 ERX6700291 ERS8071615 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94271 0.94917 0.11288 0.10987 0.67115 0.66827 0.4729 0.4736 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10301 10301 ERR7132852 ERX6700290 ERS8071614 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Cnt 2 SAMEA10418770 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418770|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:2|sample name:E MTAB 11086:Cnt 2|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Cnt 2 p Cnt 2 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:n1 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.E11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.E11.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2248468400.0 22484684.0 E MTAB 11086:SLX 19351.E11.HMLG7DRXX.s 2.r 0:50 1:50 A:601914808;C:521501189;G:527610060;T:597380501;N:61842 50 50     601914808 521501189 527610060 597380501 61842 ERX6700290 ERS8071614 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94347 0.94939 0.11234 0.10984 0.66689 0.66342 0.46711 0.46831 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10302 10302 ERR7132851 ERX6700289 ERS8071613 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Cnt 1 SAMEA10418769 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418769|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:1|sample name:E MTAB 11086:Cnt 1|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Cnt 1 p Cnt 1 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:n1 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.D11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.D11.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 1958517300.0 19585173.0 E MTAB 11086:SLX 19351.D11.HMLG7DRXX.s 2.r 0:50 1:50 A:523101436;C:454540970;G:459925156;T:520895141;N:54597 50 50     523101436 454540970 459925156 520895141 54597 ERX6700289 ERS8071613 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94413 0.95047 0.10482 0.10253 0.67044 0.66782 0.47233 0.4771 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10303 10303 ERR7132850 ERX6700288 ERS8071612 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Amp 6 SAMEA10418768 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418768|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:6|sample name:E MTAB 11086:Amp 6|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Amp 6 p Amp 6 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:amphetamine|Experimental Factor: dose:25 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.E9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.E9.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 1712505000.0 17125050.0 E MTAB 11086:SLX 19351.E9.HMLG7DRXX.s 2.r 0:50 1:50 A:455641002;C:398314392;G:404466444;T:454036255;N:46907 50 50     455641002 398314392 404466444 454036255 46907 ERX6700288 ERS8071612 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94358 0.94966 0.10681 0.1037 0.66665 0.66373 0.46688 0.47225 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10304 10304 ERR7132849 ERX6700287 ERS8071611 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Amp 5 SAMEA10418767 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418767|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 5|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:5|sample name:E MTAB 11086:Amp 5|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Amp 5 p Amp 5 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:amphetamine|Experimental Factor: dose:25 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.A10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.A10.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2007519200.0 20075192.0 E MTAB 11086:SLX 19351.A10.HMLG7DRXX.s 2.r 0:50 1:50 A:534568558;C:467539630;G:473805079;T:531550688;N:55245 50 50     534568558 467539630 473805079 531550688 55245 ERX6700287 ERS8071611 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94408 0.9499 0.10888 0.10604 0.66797 0.66458 0.46039 0.46669 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10305 10305 ERR7132848 ERX6700286 ERS8071610 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Amp 4 SAMEA10418766 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418766|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:4|sample name:E MTAB 11086:Amp 4|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Amp 4 p Amp 4 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:amphetamine|Experimental Factor: dose:25 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.F11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.F11.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 1845345300.0 18453453.0 E MTAB 11086:SLX 19351.F11.HMLG7DRXX.s 2.r 0:50 1:50 A:490920758;C:430637266;G:435667744;T:488067453;N:52079 50 50     490920758 430637266 435667744 488067453 52079 ERX6700286 ERS8071610 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94484 0.9504 0.10472 0.10237 0.66618 0.66336 0.46903 0.47774 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10306 10306 ERR7132847 ERX6700285 ERS8071609 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Amp 3 SAMEA10418765 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418765|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:3|sample name:E MTAB 11086:Amp 3|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Amp 3 p Amp 3 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:amphetamine|Experimental Factor: dose:25 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.F9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.F9.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2195415300.0 21954153.0 E MTAB 11086:SLX 19351.F9.HMLG7DRXX.s 2.r 0:50 1:50 A:583956682;C:511927452;G:518373455;T:581095379;N:62332 50 50     583956682 511927452 518373455 581095379 62332 ERX6700285 ERS8071609 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94571 0.95178 0.10567 0.10288 0.6688 0.66661 0.4677 0.47288 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10307 10307 ERR7132846 ERX6700284 ERS8071608 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Amp 2 SAMEA10418764 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418764|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:2|sample name:E MTAB 11086:Amp 2|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Amp 2 p Amp 2 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:amphetamine|Experimental Factor: dose:25 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.D9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.D9.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2093635000.0 20936350.0 E MTAB 11086:SLX 19351.D9.HMLG7DRXX.s 2.r 0:50 1:50 A:556451381;C:488314672;G:495691630;T:553118514;N:58803 50 50     556451381 488314672 495691630 553118514 58803 ERX6700284 ERS8071608 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94407 0.95012 0.11198 0.10872 0.66651 0.66352 0.46901 0.47198 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
10308 10308 ERR7132845 ERX6700283 ERS8071607 ERP132573 PRJEB48231 RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs E-MTAB-11086 Transcriptome Analysis RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf. ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24   Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Amp 1 SAMEA10418763 Cambridge Institute of Therapeutic Immunology & Infectious Disease ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418763|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:1|sample name:E MTAB 11086:Amp 1|sex:not available|strain:Tüpfel long fin TLF                 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs E MTAB 11086:Amp 1 p Amp 1 p RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit. Experimental Factor: compound:amphetamine|Experimental Factor: dose:25 RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP132573 Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24 SLX-19351.E10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.E10.HMLG7DRXX.s_2.r_2.fq.gz fastq fastq 2254130000.0 22541300.0 E MTAB 11086:SLX 19351.E10.HMLG7DRXX.s 2.r 0:50 1:50 A:599784010;C:525655199;G:531849347;T:596777643;N:63801 50 50     599784010 525655199 531849347 596777643 63801 ERX6700283 ERS8071607 ERA6757821 Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive 2 0.94449 0.95026 0.10608 0.10323 0.66758 0.66257 0.46869 0.47045 50 50 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   United Kingdom 2022-01-24 Larval Larval Embryo Imprecise All anatomical structures
11723 11723 ERR11422840 ERX10830011 ERS15422295 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 hom ttn1 het 1 SAMEA113427169 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427169|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 het 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/ |individual:pool of 3 embryos 1|organism part:embryo|replicate:1|sample name:E MTAB 12934:srpk3 hom ttn1 het 1|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 hom ttn1 het 1 p srpk3 hom ttn1 het 1 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 / ; ttn.1 +/ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.C4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.C4.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 5201588100.0 17338627.0 E MTAB 12934:SLX 21419.C4.HV2TTDRXY.s 2.r 0:150 1:150 A:1395812979;C:1209220590;G:1233107747;T:1363200419;N:246365 150 150     1395812979 1209220590 1233107747 1363200419 246365 ERX10830011 ERS15422295 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11724 11724 ERR11422856 ERX10830027 ERS15422311 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 wt ttn1 het 8 SAMEA113427185 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427185|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 het 8|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/ |individual:pool of 3 embryos 8|organism part:embryo|replicate:8|sample name:E MTAB 12934:srpk3 wt ttn1 het 8|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 wt ttn1 het 8 p srpk3 wt ttn1 het 8 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 +/+; ttn.1 +/ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.C5.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.C5.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 6243031800.0 20810106.0 E MTAB 12934:SLX 21419.C5.HV2TTDRXY.s 2.r 0:150 1:150 A:1678428066;C:1448795147;G:1483028868;T:1632478253;N:301466 150 150     1678428066 1448795147 1483028868 1632478253 301466 ERX10830027 ERS15422311 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11725 11725 ERR11422863 ERX10830034 ERS15422318 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 wt ttn1 wt 7 SAMEA113427192 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427192|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 wt 7|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/+|individual:pool of 3 embryos 7|organism part:embryo|replicate:7|sample name:E MTAB 12934:srpk3 wt ttn1 wt 7|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 wt ttn1 wt 7 p srpk3 wt ttn1 wt 7 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 +/+; ttn.1 +/+ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.G3.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.G3.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 7924538100.0 26415127.0 E MTAB 12934:SLX 21419.G3.HV2TTDRXY.s 2.r 0:150 1:150 A:2128544326;C:1844570027;G:1875605207;T:2075443615;N:374925 150 150     2128544326 1844570027 1875605207 2075443615 374925 ERX10830034 ERS15422318 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11726 11726 ERR11422862 ERX10830033 ERS15422317 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 wt ttn1 wt 6 SAMEA113427191 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427191|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 wt 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/+|individual:pool of 3 embryos 6|organism part:embryo|replicate:6|sample name:E MTAB 12934:srpk3 wt ttn1 wt 6|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 wt ttn1 wt 6 p srpk3 wt ttn1 wt 6 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 +/+; ttn.1 +/+ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.D5.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.D5.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 8652848700.0 28842829.0 E MTAB 12934:SLX 21419.D5.HV2TTDRXY.s 2.r 0:150 1:150 A:2323784475;C:2011287942;G:2055678520;T:2261686116;N:411647 150 150     2323784475 2011287942 2055678520 2261686116 411647 ERX10830033 ERS15422317 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11727 11727 ERR11422852 ERX10830023 ERS15422307 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 wt ttn1 het 1 SAMEA113427181 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427181|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 het 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/ |individual:pool of 3 embryos 1|organism part:embryo|replicate:1|sample name:E MTAB 12934:srpk3 wt ttn1 het 1|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 wt ttn1 het 1 p srpk3 wt ttn1 het 1 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 +/+; ttn.1 +/ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.E3.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.E3.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 5595162300.0 18650541.0 E MTAB 12934:SLX 21419.E3.HV2TTDRXY.s 2.r 0:150 1:150 A:1500582422;C:1301393746;G:1326420086;T:1466508237;N:257809 150 150     1500582422 1301393746 1326420086 1466508237 257809 ERX10830023 ERS15422307 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11728 11728 ERR11422841 ERX10830012 ERS15422296 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 hom ttn1 het 10 SAMEA113427170 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427170|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 het 10|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/ |individual:pool of 3 embryos 10|organism part:embryo|replicate:10|sample name:E MTAB 12934:srpk3 hom ttn1 het 10|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 hom ttn1 het 10 p srpk3 hom ttn1 het 10 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 / ; ttn.1 +/ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.F2.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.F2.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 6163159800.0 20543866.0 E MTAB 12934:SLX 21419.F2.HV2TTDRXY.s 2.r 0:150 1:150 A:1651051246;C:1435397149;G:1465377920;T:1611039390;N:294095 150 150     1651051246 1435397149 1465377920 1611039390 294095 ERX10830012 ERS15422296 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11729 11729 ERR11422858 ERX10830029 ERS15422313 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 wt ttn1 wt 2 SAMEA113427187 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427187|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 wt 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/+|individual:pool of 3 embryos 2|organism part:embryo|replicate:2|sample name:E MTAB 12934:srpk3 wt ttn1 wt 2|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 wt ttn1 wt 2 p srpk3 wt ttn1 wt 2 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 +/+; ttn.1 +/+ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.E4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.E4.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 4948755000.0 16495850.0 E MTAB 12934:SLX 21419.E4.HV2TTDRXY.s 2.r 0:150 1:150 A:1328315519;C:1150664187;G:1172962823;T:1296576134;N:236337 150 150     1328315519 1150664187 1172962823 1296576134 236337 ERX10830029 ERS15422313 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11730 11730 ERR11422853 ERX10830024 ERS15422308 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 wt ttn1 het 2 SAMEA113427182 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427182|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 het 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/ |individual:pool of 3 embryos 2|organism part:embryo|replicate:2|sample name:E MTAB 12934:srpk3 wt ttn1 het 2|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 wt ttn1 het 2 p srpk3 wt ttn1 het 2 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 +/+; ttn.1 +/ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.A5.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.A5.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 5172515100.0 17241717.0 E MTAB 12934:SLX 21419.A5.HV2TTDRXY.s 2.r 0:150 1:150 A:1390660856;C:1200693628;G:1226597252;T:1354312680;N:250684 150 150     1390660856 1200693628 1226597252 1354312680 250684 ERX10830024 ERS15422308 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11731 11731 ERR11422842 ERX10830013 ERS15422297 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 hom ttn1 het 2 SAMEA113427171 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427171|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 het 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/ |individual:pool of 3 embryos 2|organism part:embryo|replicate:2|sample name:E MTAB 12934:srpk3 hom ttn1 het 2|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 hom ttn1 het 2 p srpk3 hom ttn1 het 2 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 / ; ttn.1 +/ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.B3.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.B3.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 7596727500.0 25322425.0 E MTAB 12934:SLX 21419.B3.HV2TTDRXY.s 2.r 0:150 1:150 A:2040744877;C:1765753859;G:1800431343;T:1989434039;N:363382 150 150     2040744877 1765753859 1800431343 1989434039 363382 ERX10830013 ERS15422297 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11732 11732 ERR11422854 ERX10830025 ERS15422309 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 wt ttn1 het 3 SAMEA113427183 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427183|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 het 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/ |individual:pool of 3 embryos 3|organism part:embryo|replicate:3|sample name:E MTAB 12934:srpk3 wt ttn1 het 3|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 wt ttn1 het 3 p srpk3 wt ttn1 het 3 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 +/+; ttn.1 +/ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.B4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.B4.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 4147455600.0 13824852.0 E MTAB 12934:SLX 21419.B4.HV2TTDRXY.s 2.r 0:150 1:150 A:1111933168;C:965101703;G:986324158;T:1083898570;N:198001 150 150     1111933168 965101703 986324158 1083898570 198001 ERX10830025 ERS15422309 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11733 11733 ERR11422855 ERX10830026 ERS15422310 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 wt ttn1 het 7 SAMEA113427184 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427184|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 het 7|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/ |individual:pool of 3 embryos 7|organism part:embryo|replicate:7|sample name:E MTAB 12934:srpk3 wt ttn1 het 7|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 wt ttn1 het 7 p srpk3 wt ttn1 het 7 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 +/+; ttn.1 +/ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.C3.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.C3.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 7815347400.0 26051158.0 E MTAB 12934:SLX 21419.C3.HV2TTDRXY.s 2.r 0:150 1:150 A:2105543787;C:1810060936;G:1848658748;T:2050709339;N:374590 150 150     2105543787 1810060936 1848658748 2050709339 374590 ERX10830026 ERS15422310 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11734 11734 ERR11422847 ERX10830018 ERS15422302 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 hom ttn1 wt 4 SAMEA113427176 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427176|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 wt 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/+|individual:pool of 3 embryos 4|organism part:embryo|replicate:4|sample name:E MTAB 12934:srpk3 hom ttn1 wt 4|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 hom ttn1 wt 4 p srpk3 hom ttn1 wt 4 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 / ; ttn.1 +/+ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.F4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.F4.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 5552048400.0 18506828.0 E MTAB 12934:SLX 21419.F4.HV2TTDRXY.s 2.r 0:150 1:150 A:1494691750;C:1287655327;G:1313223405;T:1456215647;N:262271 150 150     1494691750 1287655327 1313223405 1456215647 262271 ERX10830018 ERS15422302 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11735 11735 ERR11422843 ERX10830014 ERS15422298 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 hom ttn1 het 7 SAMEA113427172 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427172|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 het 7|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/ |individual:pool of 3 embryos 7|organism part:embryo|replicate:7|sample name:E MTAB 12934:srpk3 hom ttn1 het 7|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 hom ttn1 het 7 p srpk3 hom ttn1 het 7 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 / ; ttn.1 +/ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.G2.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.G2.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 6130593900.0 20435313.0 E MTAB 12934:SLX 21419.G2.HV2TTDRXY.s 2.r 0:150 1:150 A:1646268883;C:1426071699;G:1453474221;T:1604484627;N:294470 150 150     1646268883 1426071699 1453474221 1604484627 294470 ERX10830014 ERS15422298 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11736 11736 ERR11422857 ERX10830028 ERS15422312 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 wt ttn1 het 9 SAMEA113427186 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427186|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 het 9|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/ |individual:pool of 3 embryos 9|organism part:embryo|replicate:9|sample name:E MTAB 12934:srpk3 wt ttn1 het 9|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 wt ttn1 het 9 p srpk3 wt ttn1 het 9 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 +/+; ttn.1 +/ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.A3.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.A3.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 7955802600.0 26519342.0 E MTAB 12934:SLX 21419.A3.HV2TTDRXY.s 2.r 0:150 1:150 A:2139048525;C:1844468923;G:1881094685;T:2090808427;N:382040 150 150     2139048525 1844468923 1881094685 2090808427 382040 ERX10830028 ERS15422312 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11737 11737 ERR11422844 ERX10830015 ERS15422299 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 hom ttn1 het 8 SAMEA113427173 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427173|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 het 8|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/ |individual:pool of 3 embryos 8|organism part:embryo|replicate:8|sample name:E MTAB 12934:srpk3 hom ttn1 het 8|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 hom ttn1 het 8 p srpk3 hom ttn1 het 8 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 / ; ttn.1 +/ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.H2.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.H2.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 4707444000.0 15691480.0 E MTAB 12934:SLX 21419.H2.HV2TTDRXY.s 2.r 0:150 1:150 A:1266769556;C:1091810198;G:1114454117;T:1234185729;N:224400 150 150     1266769556 1091810198 1114454117 1234185729 224400 ERX10830015 ERS15422299 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11738 11738 ERR11422850 ERX10830021 ERS15422305 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 hom ttn1 wt 7 SAMEA113427179 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427179|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 wt 7|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/+|individual:pool of 3 embryos 7|organism part:embryo|replicate:7|sample name:E MTAB 12934:srpk3 hom ttn1 wt 7|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 hom ttn1 wt 7 p srpk3 hom ttn1 wt 7 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 / ; ttn.1 +/+ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.G4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.G4.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 6262379700.0 20874599.0 E MTAB 12934:SLX 21419.G4.HV2TTDRXY.s 2.r 0:150 1:150 A:1681113096;C:1456657472;G:1485545256;T:1638760380;N:303496 150 150     1681113096 1456657472 1485545256 1638760380 303496 ERX10830021 ERS15422305 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11739 11739 ERR11422846 ERX10830017 ERS15422301 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 hom ttn1 wt 1 SAMEA113427175 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427175|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 wt 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/+|individual:pool of 3 embryos 1|organism part:embryo|replicate:1|sample name:E MTAB 12934:srpk3 hom ttn1 wt 1|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 hom ttn1 wt 1 p srpk3 hom ttn1 wt 1 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 / ; ttn.1 +/+ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.A4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.A4.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 6071901300.0 20239671.0 E MTAB 12934:SLX 21419.A4.HV2TTDRXY.s 2.r 0:150 1:150 A:1629141748;C:1412963306;G:1441970376;T:1587528201;N:297669 150 150     1629141748 1412963306 1441970376 1587528201 297669 ERX10830017 ERS15422301 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11740 11740 ERR11422860 ERX10830031 ERS15422315 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 wt ttn1 wt 4 SAMEA113427189 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427189|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 wt 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/+|individual:pool of 3 embryos 4|organism part:embryo|replicate:4|sample name:E MTAB 12934:srpk3 wt ttn1 wt 4|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 wt ttn1 wt 4 p srpk3 wt ttn1 wt 4 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 +/+; ttn.1 +/+ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.H4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.H4.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 8552416200.0 28508054.0 E MTAB 12934:SLX 21419.H4.HV2TTDRXY.s 2.r 0:150 1:150 A:2292742388;C:1992671634;G:2031906776;T:2234679447;N:415955 150 150     2292742388 1992671634 2031906776 2234679447 415955 ERX10830031 ERS15422315 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11741 11741 ERR11422851 ERX10830022 ERS15422306 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 hom ttn1 wt 8 SAMEA113427180 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427180|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 wt 8|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/+|individual:pool of 3 embryos 8|organism part:embryo|replicate:8|sample name:E MTAB 12934:srpk3 hom ttn1 wt 8|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 hom ttn1 wt 8 p srpk3 hom ttn1 wt 8 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 / ; ttn.1 +/+ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.D4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.D4.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 4693977900.0 15646593.0 E MTAB 12934:SLX 21419.D4.HV2TTDRXY.s 2.r 0:150 1:150 A:1260530822;C:1090058889;G:1111595821;T:1231573984;N:218384 150 150     1260530822 1090058889 1111595821 1231573984 218384 ERX10830022 ERS15422306 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures
11742 11742 ERR11422849 ERX10830020 ERS15422304 ERP147133 PRJEB62042 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E-MTAB-12934 Transcriptome Analysis RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos. ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09   Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. srpk3 hom ttn1 wt 6 SAMEA113427178 QMUL ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427178|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 wt 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/+|individual:pool of 3 embryos 6|organism part:embryo|replicate:6|sample name:E MTAB 12934:srpk3 hom ttn1 wt 6|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin                 RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein E MTAB 12934:srpk3 hom ttn1 wt 6 p srpk3 hom ttn1 wt 6 p RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina. Experimental Factor: genotype:srpk3 / ; ttn.1 +/+ RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000   ERP147133 Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09 SLX-21419.E2.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.E2.HV2TTDRXY.s_2.r_2.fq.gz fastq fastq 8212296300.0 27374321.0 E MTAB 12934:SLX 21419.E2.HV2TTDRXY.s 2.r 0:150 1:150 A:2208490788;C:1905530286;G:1945454560;T:2152431537;N:389129 150 150     2208490788 1905530286 1945454560 2152431537 389129 ERX10830020 ERS15422304 ERA23329494 European Bioinformatics Institute|European Nucleotide Archive European Bioinformatics Institute|European Nucleotide Archive                       B B biological fallback assumption illumina novaseq_era unknown poly_a nebnext bulk unknown unknown   United Kingdom 2024-02-09 Larval Larval Embryo Imprecise All anatomical structures

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;