metadata: run_metadata: 3,530 rows where devstage_curation = "Larval" and technology = "smartseq"

3,530 rows where devstage_curation = "Larval" and technology = "smartseq"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.nofeature_rate.mate1	seqdetective.sparsity.mate1	seqdetective.pos_strand_rate.mate1	seqdetective.readlen.mate1	seqdetective.judgement.mate1	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
9651	9651	ERR3266392	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L001_R1_001.fastq.gz	fastq	603238067.0	8014716.0	E MTAB 7846:sponge tdr gfp positive rep2 lane1	0:75.27 1:0	A:164797697;C:136552121;G:141138007;T:160737152;N:13090	75	0	164797697	136552121	141138007	160737152	13090	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95083	0.06432	0.71532	0.50098	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9652	9652	ERR3266393	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L002_R1_001.fastq.gz	fastq	603749720.0	8021069.0	E MTAB 7846:sponge tdr gfp positive rep2 lane2	0:75.27 1:0	A:164972969;C:136661417;G:141205792;T:160896264;N:13278	75	0	164972969	136661417	141205792	160896264	13278	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.951	0.06542	0.71768	0.50051	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9653	9653	ERR3266394	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L003_R1_001.fastq.gz	fastq	608154053.0	8079704.0	E MTAB 7846:sponge tdr gfp positive rep2 lane3	0:75.27 1:0	A:166117918;C:137731172;G:142320339;T:161970092;N:14532	75	0	166117918	137731172	142320339	161970092	14532	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95155	0.0657	0.71634	0.49493	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9654	9654	ERR3266395	ERX3293003	ERS3358386	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep2	SAMEA5556346	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556346\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep2 s	sponge tdr gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9pos_S2_L004_R1_001.fastq.gz	fastq	599143392.0	7959897.0	E MTAB 7846:sponge tdr gfp positive rep2 lane4	0:75.27 1:0	A:163706904;C:135622453;G:140192351;T:159605249;N:16435	75	0	163706904	135622453	140192351	159605249	16435	ERX3293003	ERS3358386	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95061	0.06431	0.71764	0.50166	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9655	9655	ERR3266388	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L001_R1_001.fastq.gz	fastq	616761505.0	8202480.0	E MTAB 7846:sponge tdr gfp positive rep1 lane1	0:75.19 1:0	A:168679238;C:139548565;G:143969797;T:164545362;N:18543	75	0	168679238	139548565	143969797	164545362	18543	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95019	0.06806	0.7097	0.50337	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9656	9656	ERR3266389	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L002_R1_001.fastq.gz	fastq	617529482.0	8212485.0	E MTAB 7846:sponge tdr gfp positive rep1 lane2	0:75.19 1:0	A:168925757;C:139655387;G:144096837;T:164831236;N:20265	75	0	168925757	139655387	144096837	164831236	20265	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9492	0.06753	0.712	0.49881	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9657	9657	ERR3266390	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L003_R1_001.fastq.gz	fastq	624156883.0	8300861.0	E MTAB 7846:sponge tdr gfp positive rep1 lane3	0:75.19 1:0	A:170696950;C:141302376;G:145759286;T:166377781;N:20490	75	0	170696950	141302376	145759286	166377781	20490	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94917	0.06724	0.71291	0.50783	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9658	9658	ERR3266391	ERX3293002	ERS3358385	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp positive rep1	SAMEA5556345	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556345\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp positive rep1 s	sponge tdr gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6pos_S4_L004_R1_001.fastq.gz	fastq	615013615.0	8179180.0	E MTAB 7846:sponge tdr gfp positive rep1 lane4	0:75.19 1:0	A:168237742;C:139106952;G:143535658;T:164110735;N:22528	75	0	168237742	139106952	143535658	164110735	22528	ERX3293002	ERS3358385	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94892	0.06723	0.71206	0.50775	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9659	9659	ERR3266384	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L001_R1_001.fastq.gz	fastq	659562366.0	8762947.0	E MTAB 7846:sponge tdr gfp negative rep2 lane1	0:75.27 1:0	A:178744772;C:150091912;G:155092318;T:175619332;N:14032	75	0	178744772	150091912	155092318	175619332	14032	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9517	0.06908	0.70822	0.48025	73	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9660	9660	ERR3266385	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L002_R1_001.fastq.gz	fastq	658688825.0	8751176.0	E MTAB 7846:sponge tdr gfp negative rep2 lane2	0:75.27 1:0	A:178540155;C:149844100;G:154850294;T:175438757;N:15519	75	0	178540155	149844100	154850294	175438757	15519	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95059	0.06748	0.70806	0.48177	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9661	9661	ERR3266386	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L003_R1_001.fastq.gz	fastq	665901310.0	8846927.0	E MTAB 7846:sponge tdr gfp negative rep2 lane3	0:75.27 1:0	A:180412445;C:151589489;G:156677030;T:177206192;N:16154	75	0	180412445	151589489	156677030	177206192	16154	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95095	0.06855	0.7082	0.4787	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9662	9662	ERR3266387	ERX3293001	ERS3358384	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep2	SAMEA5556344	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556344\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 6\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep2 s	sponge tdr gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_9neg_S1_L004_R1_001.fastq.gz	fastq	655674573.0	8711278.0	E MTAB 7846:sponge tdr gfp negative rep2 lane4	0:75.27 1:0	A:177658097;C:149188009;G:154201531;T:174609176;N:17760	75	0	177658097	149188009	154201531	174609176	17760	ERX3293001	ERS3358384	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9503	0.06838	0.70926	0.47475	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9663	9663	ERR3266380	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L001_R1_001.fastq.gz	fastq	634491637.0	8440052.0	E MTAB 7846:sponge tdr gfp negative rep1 lane1	0:75.18 1:0	A:170881257;C:145535643;G:150561786;T:167495156;N:17795	75	0	170881257	145535643	150561786	167495156	17795	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94996	0.05672	0.70571	0.48691	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9664	9664	ERR3266381	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L002_R1_001.fastq.gz	fastq	632900752.0	8418846.0	E MTAB 7846:sponge tdr gfp negative rep1 lane2	0:75.18 1:0	A:170454908;C:145141392;G:150172752;T:167112562;N:19138	75	0	170454908	145141392	150172752	167112562	19138	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94905	0.05627	0.70457	0.4865	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9665	9665	ERR3266382	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L003_R1_001.fastq.gz	fastq	638530115.0	8494045.0	E MTAB 7846:sponge tdr gfp negative rep1 lane3	0:75.17 1:0	A:171907482;C:146526309;G:151612209;T:168464163;N:19952	75	0	171907482	146526309	151612209	168464163	19952	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94919	0.05578	0.70849	0.48073	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9666	9666	ERR3266383	ERX3293000	ERS3358383	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge tdr gfp negative rep1	SAMEA5556343	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556343\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgstdrd3 diaph3:eGFPuq7mf\|individual:pool 5\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge tdr gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge tdr gfp negative rep1 s	sponge tdr gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E9_6neg_S3_L004_R1_001.fastq.gz	fastq	627433322.0	8346505.0	E MTAB 7846:sponge tdr gfp negative rep1 lane4	0:75.17 1:0	A:169016383;C:143886824;G:148914725;T:165593528;N:21862	75	0	169016383	143886824	148914725	165593528	21862	ERX3293000	ERS3358383	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94993	0.05721	0.7052	0.48878	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9667	9667	ERR3266376	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L001_R1_001.fastq.gz	fastq	618672195.0	8218047.0	E MTAB 7846:sponge isl gfp positive rep2 lane1	0:75.28 1:0	A:166422886;C:142212204;G:146857539;T:163167819;N:11747	75	0	166422886	142212204	146857539	163167819	11747	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94979	0.08351	0.70863	0.47581	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9668	9668	ERR3266377	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L002_R1_001.fastq.gz	fastq	618709102.0	8218295.0	E MTAB 7846:sponge isl gfp positive rep2 lane2	0:75.28 1:0	A:166470432;C:142189977;G:146819280;T:163216323;N:13090	75	0	166470432	142189977	146819280	163216323	13090	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94977	0.08255	0.70644	0.47228	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9669	9669	ERR3266378	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L003_R1_001.fastq.gz	fastq	625353059.0	8306375.0	E MTAB 7846:sponge isl gfp positive rep2 lane3	0:75.29 1:0	A:168233274;C:143793178;G:148510556;T:164802476;N:13575	75	0	168233274	143793178	148510556	164802476	13575	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95014	0.08368	0.70743	0.47846	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9670	9670	ERR3266379	ERX3292999	ERS3358382	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep2	SAMEA5556342	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556342\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep2 s	sponge isl gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7pos_S10_L004_R1_001.fastq.gz	fastq	615204990.0	8171748.0	E MTAB 7846:sponge isl gfp positive rep2 lane4	0:75.28 1:0	A:165565861;C:141380152;G:146028839;T:162214263;N:15875	75	0	165565861	141380152	146028839	162214263	15875	ERX3292999	ERS3358382	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94954	0.08233	0.70834	0.48166	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9671	9671	ERR3266372	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L001_R1_001.fastq.gz	fastq	626474467.0	8318996.0	E MTAB 7846:sponge isl gfp positive rep1 lane1	0:75.31 1:0	A:170186220;C:142441110;G:147048643;T:166786401;N:12093	75	0	170186220	142441110	147048643	166786401	12093	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94907	0.08132	0.69684	0.4736	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9672	9672	ERR3266373	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L002_R1_001.fastq.gz	fastq	626477579.0	8318750.0	E MTAB 7846:sponge isl gfp positive rep1 lane2	0:75.31 1:0	A:170185337;C:142396801;G:147032265;T:166850532;N:12644	75	0	170185337	142396801	147032265	166850532	12644	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94941	0.08253	0.6957	0.47554	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9673	9673	ERR3266374	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L003_R1_001.fastq.gz	fastq	632098509.0	8393388.0	E MTAB 7846:sponge isl gfp positive rep1 lane3	0:75.31 1:0	A:171699353;C:143766296;G:148442110;T:168177264;N:13486	75	0	171699353	143766296	148442110	168177264	13486	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94866	0.08247	0.69601	0.48009	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9674	9674	ERR3266375	ERX3292998	ERS3358381	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp positive rep1	SAMEA5556341	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556341\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp positive rep1 s	sponge isl gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6pos_S12_L004_R1_001.fastq.gz	fastq	622997479.0	8272752.0	E MTAB 7846:sponge isl gfp positive rep1 lane4	0:75.31 1:0	A:169306677;C:141586415;G:146241288;T:165847752;N:15347	75	0	169306677	141586415	146241288	165847752	15347	ERX3292998	ERS3358381	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.9483	0.08034	0.69662	0.47868	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9675	9675	ERR3266368	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L001_R1_001.fastq.gz	fastq	707454819.0	9395082.0	E MTAB 7846:sponge isl gfp negative rep2 lane1	0:75.30 1:0	A:194991862;C:157927850;G:163280639;T:191241488;N:12980	75	0	194991862	157927850	163280639	191241488	12980	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93871	0.08926	0.70806	0.46501	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9676	9676	ERR3266369	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L002_R1_001.fastq.gz	fastq	704791838.0	9359668.0	E MTAB 7846:sponge isl gfp negative rep2 lane2	0:75.30 1:0	A:194317422;C:157276895;G:162624670;T:190558322;N:14529	75	0	194317422	157276895	162624670	190558322	14529	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93816	0.08859	0.70999	0.4661	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9677	9677	ERR3266370	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L003_R1_001.fastq.gz	fastq	715991833.0	9508323.0	E MTAB 7846:sponge isl gfp negative rep2 lane3	0:75.30 1:0	A:197297222;C:159913026;G:165363927;T:193402765;N:14893	75	0	197297222	159913026	165363927	193402765	14893	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93844	0.08854	0.70828	0.46042	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9678	9678	ERR3266371	ERX3292997	ERS3358380	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep2	SAMEA5556340	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556340\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 2\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep2 s	sponge isl gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_7neg_S9_L004_R1_001.fastq.gz	fastq	703723869.0	9345669.0	E MTAB 7846:sponge isl gfp negative rep2 lane4	0:75.30 1:0	A:194029886;C:157050176;G:162432310;T:190193608;N:17889	75	0	194029886	157050176	162432310	190193608	17889	ERX3292997	ERS3358380	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93897	0.08993	0.70863	0.45707	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9679	9679	ERR3266364	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L001_R1_001.fastq.gz	fastq	676581458.0	8983758.0	E MTAB 7846:sponge isl gfp negative rep1 lane1	0:75.31 1:0	A:184297337;C:153352193;G:158268476;T:180651038;N:12414	75	0	184297337	153352193	158268476	180651038	12414	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94981	0.07715	0.69138	0.47243	74	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9680	9680	ERR3266365	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L002_R1_001.fastq.gz	fastq	676876555.0	8987445.0	E MTAB 7846:sponge isl gfp negative rep1 lane2	0:75.31 1:0	A:184435129;C:153332402;G:158323789;T:180770978;N:14257	75	0	184435129	153332402	158323789	180770978	14257	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94901	0.07805	0.69179	0.47182	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9681	9681	ERR3266366	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L003_R1_001.fastq.gz	fastq	681771213.0	9052615.0	E MTAB 7846:sponge isl gfp negative rep1 lane3	0:75.31 1:0	A:185717696;C:154552039;G:159567102;T:181919781;N:14595	75	0	185717696	154552039	159567102	181919781	14595	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94923	0.07768	0.69167	0.47219	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9682	9682	ERR3266367	ERX3292996	ERS3358379	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge isl gfp negative rep1	SAMEA5556339	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556339\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsisl2 scaper:eGFPuq5mf\|individual:pool 1\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge isl gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge isl gfp negative rep1 s	sponge isl gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E4_6neg_S11_L004_R1_001.fastq.gz	fastq	671169917.0	8911624.0	E MTAB 7846:sponge isl gfp negative rep1 lane4	0:75.31 1:0	A:182910490;C:152045814;G:157010053;T:179186548;N:17012	75	0	182910490	152045814	157010053	179186548	17012	ERX3292996	ERS3358379	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94941	0.07612	0.69106	0.47736	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9683	9683	ERR3266360	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L001_R1_001.fastq.gz	fastq	745666738.0	9917771.0	E MTAB 7846:sponge ccn gfp positive rep2 lane1	0:75.18 1:0	A:207714377;C:163732420;G:169037726;T:205161925;N:20290	75	0	207714377	163732420	169037726	205161925	20290	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94006	0.17809	0.68166	0.48912	74	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9684	9684	ERR3266361	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L002_R1_001.fastq.gz	fastq	747693645.0	9944395.0	E MTAB 7846:sponge ccn gfp positive rep2 lane2	0:75.19 1:0	A:208257288;C:164106384;G:169478025;T:205830399;N:21549	75	0	208257288	164106384	169478025	205830399	21549	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.93873	0.17738	0.68296	0.49656	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9685	9685	ERR3266362	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L003_R1_001.fastq.gz	fastq	756134124.0	10056818.0	E MTAB 7846:sponge ccn gfp positive rep2 lane3	0:75.19 1:0	A:210573012;C:166089133;G:171475300;T:207973232;N:23447	75	0	210573012	166089133	171475300	207973232	23447	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94077	0.18001	0.68004	0.49812	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9686	9686	ERR3266363	ERX3292995	ERS3358378	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep2	SAMEA5556338	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556338\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep2 s	sponge ccn gfp positive rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8pos_S6_L004_R1_001.fastq.gz	fastq	747687619.0	9944417.0	E MTAB 7846:sponge ccn gfp positive rep2 lane4	0:75.19 1:0	A:208315943;C:164104155;G:169484250;T:205757712;N:25559	75	0	208315943	164104155	169484250	205757712	25559	ERX3292995	ERS3358378	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.94025	0.17965	0.68124	0.49249	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9687	9687	ERR3266356	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L001_R1_001.fastq.gz	fastq	600153564.0	7972767.0	E MTAB 7846:sponge ccn gfp positive rep1 lane1	0:75.28 1:0	A:165075878;C:133961511;G:138306424;T:162797903;N:11848	75	0	165075878	133961511	138306424	162797903	11848	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95367	0.14146	0.69154	0.46621	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9688	9688	ERR3266357	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L002_R1_001.fastq.gz	fastq	600790169.0	7981038.0	E MTAB 7846:sponge ccn gfp positive rep1 lane2	0:75.28 1:0	A:165262968;C:133988329;G:138458635;T:163066854;N:13383	75	0	165262968	133988329	138458635	163066854	13383	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95365	0.14116	0.69301	0.46836	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9689	9689	ERR3266358	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L003_R1_001.fastq.gz	fastq	608611085.0	8084904.0	E MTAB 7846:sponge ccn gfp positive rep1 lane3	0:75.28 1:0	A:167402055;C:135871708;G:140314669;T:165009252;N:13401	75	0	167402055	135871708	140314669	165009252	13401	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95403	0.14167	0.69311	0.4702	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9690	9690	ERR3266359	ERX3292994	ERS3358377	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp positive rep1	SAMEA5556337	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556337\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP positive\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp positive rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp positive rep1 s	sponge ccn gfp positive rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP positive	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7pos_S8_L004_R1_001.fastq.gz	fastq	599558663.0	7964718.0	E MTAB 7846:sponge ccn gfp positive rep1 lane4	0:75.28 1:0	A:164965131;C:133749666;G:138194884;T:162633558;N:15424	75	0	164965131	133749666	138194884	162633558	15424	ERX3292994	ERS3358377	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95285	0.14085	0.69037	0.47345	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9691	9691	ERR3266352	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L001_R1_001.fastq.gz	fastq	599599608.0	7970460.0	E MTAB 7846:sponge ccn gfp negative rep2 lane1	0:75.23 1:0	A:162236409;C:136907675;G:141538730;T:158902520;N:14274	75	0	162236409	136907675	141538730	158902520	14274	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95404	0.05923	0.69737	0.48627	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9692	9692	ERR3266353	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L002_R1_001.fastq.gz	fastq	600057776.0	7976438.0	E MTAB 7846:sponge ccn gfp negative rep2 lane2	0:75.23 1:0	A:162367410;C:136994919;G:141577782;T:159102194;N:15471	75	0	162367410	136994919	141577782	159102194	15471	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.953	0.06085	0.6952	0.48868	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9693	9693	ERR3266354	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L003_R1_001.fastq.gz	fastq	607089697.0	8069901.0	E MTAB 7846:sponge ccn gfp negative rep2 lane3	0:75.23 1:0	A:164235344;C:138684000;G:143335680;T:160819270;N:15403	75	0	164235344	138684000	143335680	160819270	15403	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95245	0.06055	0.69589	0.48813	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9694	9694	ERR3266355	ERX3292993	ERS3358376	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep2	SAMEA5556336	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556336\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 4\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep2\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep2 s	sponge ccn gfp negative rep2 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_8neg_S5_L004_R1_001.fastq.gz	fastq	598098243.0	7950223.0	E MTAB 7846:sponge ccn gfp negative rep2 lane4	0:75.23 1:0	A:161836808;C:136564804;G:141157424;T:158521860;N:17347	75	0	161836808	136564804	141157424	158521860	17347	ERX3292993	ERS3358376	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95299	0.06032	0.69501	0.48928	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9695	9695	ERR3266348	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L001_R1_001.fastq.gz	fastq	668175990.0	8872549.0	E MTAB 7846:sponge ccn gfp negative rep1 lane1	0:75.31 1:0	A:179859350;C:153483169;G:158360605;T:176462088;N:10778	75	0	179859350	153483169	158360605	176462088	10778	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.95955	0.07154	0.69696	0.46425	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9696	9696	ERR3266349	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L002_R1_001.fastq.gz	fastq	668154755.0	8872093.0	E MTAB 7846:sponge ccn gfp negative rep1 lane2	0:75.31 1:0	A:179811687;C:153454931;G:158314391;T:176560936;N:12810	75	0	179811687	153454931	158314391	176560936	12810	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96029	0.06969	0.69684	0.46725	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9697	9697	ERR3266350	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L003_R1_001.fastq.gz	fastq	676984426.0	8989004.0	E MTAB 7846:sponge ccn gfp negative rep1 lane3	0:75.31 1:0	A:182159685;C:155578195;G:160511499;T:178722363;N:12684	75	0	182159685	155578195	160511499	178722363	12684	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96012	0.07159	0.69554	0.46811	75	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
9698	9698	ERR3266351	ERX3292992	ERS3358375	ERP114712	PRJEB32081	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E-MTAB-7846	Transcriptome Analysis	To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	sponge ccn gfp negative rep1	SAMEA5556335	UQ	ENA FIRST PUBLIC:2019 11 30T04:02:56Z\|ENA LAST UPDATE:2019 04 08T12:20:25Z\|External Id:SAMEA5556335\|INSDC center name:UQ\|INSDC first public:2019 11 30T04:02:56Z\|INSDC last update:2019 04 08T12:20:25Z\|INSDC status:public\|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1\|age:72\|broker name:ArrayExpress\|cell type:GFP negative\|common name:zebrafish\|developmental stage:larval protruding mouth\|genotype:Tgsccne1 c19orf2:eGFPuq6mf\|individual:pool 3\|organism part:zebrafish comp1nt\|sample name:E MTAB 7846:sponge ccn gfp negative rep1\|scientific name:Danio rerio\|sex:both\|strain:A/B or Tu strains									NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	E MTAB 7846:sponge ccn gfp negative rep1 s	sponge ccn gfp negative rep1 s	RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.	Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf\|Experimental Factor: cell type:GFP negative	RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	NextSeq 500	ERP114712	NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers	ENA FIRST PUBLIC:2019 11 30\|ENA LAST UPDATE:2019 04 08	E6_7neg_S7_L004_R1_001.fastq.gz	fastq	666031892.0	8843695.0	E MTAB 7846:sponge ccn gfp negative rep1 lane4	0:75.31 1:0	A:179243298;C:152946459;G:157873912;T:175953752;N:14471	75	0	179243298	152946459	157873912	175953752	14471	ERX3292992	ERS3358375	ERA1822647	European Nucleotide Archive	European Nucleotide Archive	1	0.96014	0.07169	0.69493	0.47058	76	B	usable mapping rate	illumina	nextseq	unknown	poly_a	nextera	sc	single_cell_plate	smartseq	Unknown	2019-04-08	Larval	Larval	Embryo Imprecise	All anatomical structures
28389	28389	SRR26213385	SRX21923919	SRS19008430	SRP463773	PRJNA1022165	Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.	GSE244308	Transcriptome Analysis	Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.			Neutrophils WT infected 4	GSM7813285		tissue:Neutrophil\|developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2/WT\|infection:Salm1lla typhimurium\|geo loc name:missing\|collection date:missing	Neutrophils WT infected 4	The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.	Neutrophil	At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.	Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions	developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2/WT\|infection:Salm1lla typhimurium	GSM7813285	GSM7813285: Neutrophils WT infected 4; Danio rerio; RNA Seq	GSM7813285 r1	GSM7813285	1	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP463773		loader:fastq load.py	WTInfected-4_S8_R1_001.fastq.gz	fastq	2240130033.0	29683768.0	GSM7813285 r1	0:75.47	A:639465198;C:479506246;G:493408026;T:627654835;N:95728	75		639465198	479506246	493408026	627654835	95728	SRX21923919	SRS19008430	SRA1722831	The University of Auckland	The University of Auckland	1	0.89082	0.28084	0.75523	0.4978	76	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	New Zealand	2023-09-28	Larval	Larval	Blood	Hematopoietic System
28390	28390	SRR26213386	SRX21923918	SRS19008429	SRP463773	PRJNA1022165	Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.	GSE244308	Transcriptome Analysis	Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.			Neutrophils WT infected 3	GSM7813284		tissue:Neutrophil\|developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2/WT\|infection:Salm1lla typhimurium\|geo loc name:missing\|collection date:missing	Neutrophils WT infected 3	The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.	Neutrophil	At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.	Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions	developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2/WT\|infection:Salm1lla typhimurium	GSM7813284	GSM7813284: Neutrophils WT infected 3; Danio rerio; RNA Seq	GSM7813284 r1	GSM7813284	1	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP463773		loader:fastq load.py	WTInfected-3_S7_R1_001.fastq.gz	fastq	2789643441.0	37059064.0	GSM7813284 r1	0:75.28	A:770315857;C:626379098;G:642210747;T:750373702;N:364037	75		770315857	626379098	642210747	750373702	364037	SRX21923918	SRS19008429	SRA1722831	The University of Auckland	The University of Auckland	1	0.89494	0.12907	0.81154	0.50044	76	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	New Zealand	2023-09-28	Larval	Larval	Blood	Hematopoietic System
28391	28391	SRR26213387	SRX21923917	SRS19008428	SRP463773	PRJNA1022165	Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.	GSE244308	Transcriptome Analysis	Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.			Neutrophils WT infected 2	GSM7813283		tissue:Neutrophil\|developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2/WT\|infection:Salm1lla typhimurium\|geo loc name:missing\|collection date:missing	Neutrophils WT infected 2	The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.	Neutrophil	At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.	Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions	developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2/WT\|infection:Salm1lla typhimurium	GSM7813283	GSM7813283: Neutrophils WT infected 2; Danio rerio; RNA Seq	GSM7813283 r1	GSM7813283	1	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP463773		loader:fastq load.py	WTInfected-2_S6_R1_001.fastq.gz	fastq	2502579643.0	33171064.0	GSM7813283 r1	0:75.44	A:690295075;C:562877524;G:577315919;T:671999174;N:91951	75		690295075	562877524	577315919	671999174	91951	SRX21923917	SRS19008428	SRA1722831	The University of Auckland	The University of Auckland	1	0.89596	0.11653	0.82562	0.47762	76	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	New Zealand	2023-09-28	Larval	Larval	Blood	Hematopoietic System
28392	28392	SRR26213388	SRX21923916	SRS19008427	SRP463773	PRJNA1022165	Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.	GSE244308	Transcriptome Analysis	Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.			Neutrophils WT infected 1	GSM7813282		tissue:Neutrophil\|developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2/WT\|infection:Salm1lla typhimurium\|geo loc name:missing\|collection date:missing	Neutrophils WT infected 1	The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.	Neutrophil	At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.	Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions	developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2/WT\|infection:Salm1lla typhimurium	GSM7813282	GSM7813282: Neutrophils WT infected 1; Danio rerio; RNA Seq	GSM7813282 r1	GSM7813282	1	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP463773		loader:fastq load.py	WTInfected-1_S5_R1_001.fastq.gz	fastq	2629109363.0	34890907.0	GSM7813282 r1	0:75.35	A:717313087;C:596048245;G:613729475;T:701790568;N:227988	75		717313087	596048245	613729475	701790568	227988	SRX21923916	SRS19008427	SRA1722831	The University of Auckland	The University of Auckland	1	0.88964	0.13171	0.81142	0.49273	73	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	New Zealand	2023-09-28	Larval	Larval	Blood	Hematopoietic System
28393	28393	SRR26213389	SRX21923915	SRS19008426	SRP463773	PRJNA1022165	Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.	GSE244308	Transcriptome Analysis	Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.			Neutrophils per2 infected 4	GSM7813281		tissue:Neutrophil\|developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2;per2 / \|infection:Salm1lla typhimurium\|geo loc name:missing\|collection date:missing	Neutrophils per2 infected 4	The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.	Neutrophil	At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.	Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions	developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2;per2 / \|infection:Salm1lla typhimurium	GSM7813281	GSM7813281: Neutrophils per2 infected 4; Danio rerio; RNA Seq	GSM7813281 r1	GSM7813281	1	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP463773		loader:fastq load.py	per2Infected-4_S16_R1_001.fastq.gz	fastq	2915831120.0	38708122.0	GSM7813281 r1	0:75.33	A:819771092;C:637630362;G:654348519;T:803699649;N:381498	75		819771092	637630362	654348519	803699649	381498	SRX21923915	SRS19008426	SRA1722831	The University of Auckland	The University of Auckland	1	0.90568	0.15837	0.82055	0.49547	76	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	New Zealand	2023-09-28	Larval	Larval	Blood	Hematopoietic System
28394	28394	SRR26213390	SRX21923914	SRS19008425	SRP463773	PRJNA1022165	Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.	GSE244308	Transcriptome Analysis	Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.			Neutrophils per2 infected 3	GSM7813280		tissue:Neutrophil\|developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2;per2 / \|infection:Salm1lla typhimurium\|geo loc name:missing\|collection date:missing	Neutrophils per2 infected 3	The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.	Neutrophil	At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.	Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions	developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2;per2 / \|infection:Salm1lla typhimurium	GSM7813280	GSM7813280: Neutrophils per2 infected 3; Danio rerio; RNA Seq	GSM7813280 r1	GSM7813280	1	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP463773		loader:fastq load.py	per2Infected-3_S15_R1_001.fastq.gz	fastq	2622630688.0	34745018.0	GSM7813280 r1	0:75.48	A:726047024;C:584906297;G:600999032;T:710582433;N:95902	75		726047024	584906297	600999032	710582433	95902	SRX21923914	SRS19008425	SRA1722831	The University of Auckland	The University of Auckland	1	0.91129	0.1229	0.81345	0.48284	75	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	New Zealand	2023-09-28	Larval	Larval	Blood	Hematopoietic System
28395	28395	SRR26213391	SRX21923913	SRS19008424	SRP463773	PRJNA1022165	Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.	GSE244308	Transcriptome Analysis	Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.			Neutrophils per2 infected 2	GSM7813279		tissue:Neutrophil\|developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2;per2 / \|infection:Salm1lla typhimurium\|geo loc name:missing\|collection date:missing	Neutrophils per2 infected 2	The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.	Neutrophil	At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.	Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions	developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2;per2 / \|infection:Salm1lla typhimurium	GSM7813279	GSM7813279: Neutrophils per2 infected 2; Danio rerio; RNA Seq	GSM7813279 r1	GSM7813279	1	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP463773		loader:fastq load.py	per2Infected-2_S14_R1_001.fastq.gz	fastq	2152892336.0	28547218.0	GSM7813279 r1	0:75.42	A:594950127;C:480727855;G:495163350;T:581915730;N:135274	75		594950127	480727855	495163350	581915730	135274	SRX21923913	SRS19008424	SRA1722831	The University of Auckland	The University of Auckland	1	0.9068	0.11944	0.82804	0.48956	76	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	New Zealand	2023-09-28	Larval	Larval	Blood	Hematopoietic System
28396	28396	SRR26213392	SRX21923912	SRS19008423	SRP463773	PRJNA1022165	Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.	GSE244308	Transcriptome Analysis	Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.			Neutrophils per2 infected 1	GSM7813278		tissue:Neutrophil\|developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2;per2 / \|infection:Salm1lla typhimurium\|geo loc name:missing\|collection date:missing	Neutrophils per2 infected 1	The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.	Neutrophil	At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.	Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions	developmental stage:larvae\|cell type:Neutrophil\|genotype:Tglyz:DsRED2;per2 / \|infection:Salm1lla typhimurium	GSM7813278	GSM7813278: Neutrophils per2 infected 1; Danio rerio; RNA Seq	GSM7813278 r1	GSM7813278	1	Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500	SRP463773		loader:fastq load.py	per2Infcted-1_S13_R1_001.fastq.gz	fastq	2276537599.0	30215018.0	GSM7813278 r1	0:75.34	A:614225653;C:523562022;G:541795396;T:596817124;N:137404	75		614225653	523562022	541795396	596817124	137404	SRX21923912	SRS19008423	SRA1722831	The University of Auckland	The University of Auckland	1	0.92361	0.09247	0.81324	0.46862	76	B	usable mapping rate	illumina	nextseq	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	New Zealand	2023-09-28	Larval	Larval	Blood	Hematopoietic System
29894	29894	SRR30873028	SRX26270368	SRS22808226	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep15	GSM8553345		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i wild types\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep15	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i wild types	GSM8553345	GSM8553345: arid1b 6 dpf rep15; Danio rerio; RNA Seq	GSM8553345 r1	GSM8553345	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-wt_AR28_S28_R1_001.fastq.gz	fastq	4135380800.0	41353808.0	GSM8553345 r1	0:100	A:1084939463;C:1011079577;G:970891275;T:1068398012;N:72473	100		1084939463	1011079577	970891275	1068398012	72473	SRX26270368	SRS22808226	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29895	29895	SRR30873029	SRX26270367	SRS22808225	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep14	GSM8553344		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i wild types\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep14	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i wild types	GSM8553344	GSM8553344: arid1b 6 dpf rep14; Danio rerio; RNA Seq	GSM8553344 r1	GSM8553344	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-wt_AR27_S27_R1_001.fastq.gz	fastq	6224312000.0	62243120.0	GSM8553344 r1	0:100	A:1606079574;C:1540033115;G:1483199092;T:1594888859;N:111360	100		1606079574	1540033115	1483199092	1594888859	111360	SRX26270367	SRS22808225	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29896	29896	SRR30873030	SRX26270366	SRS22808224	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep13	GSM8553343		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i wild types\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep13	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i wild types	GSM8553343	GSM8553343: arid1b 6 dpf rep13; Danio rerio; RNA Seq	GSM8553343 r1	GSM8553343	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-wt_AR26_S26_R1_001.fastq.gz	fastq	4549812900.0	45498129.0	GSM8553343 r1	0:100	A:1188852707;C:1130004381;G:1033560381;T:1197314769;N:80662	100		1188852707	1130004381	1033560381	1197314769	80662	SRX26270366	SRS22808224	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29897	29897	SRR30873031	SRX26270365	SRS22808223	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep12	GSM8553342		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i wild types\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep12	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i wild types	GSM8553342	GSM8553342: arid1b 6 dpf rep12; Danio rerio; RNA Seq	GSM8553342 r1	GSM8553342	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-wt_AR25_S25_R1_001.fastq.gz	fastq	4879728400.0	48797284.0	GSM8553342 r1	0:100	A:1257198257;C:1231843411;G:1157132375;T:1233469179;N:85178	100		1257198257	1231843411	1157132375	1233469179	85178	SRX26270365	SRS22808223	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29898	29898	SRR30873032	SRX26270364	SRS22808222	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep11	GSM8553341		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i wild types\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep11	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i wild types	GSM8553341	GSM8553341: arid1b 6 dpf rep11; Danio rerio; RNA Seq	GSM8553341 r1	GSM8553341	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-wt_AR24_S24_R1_001.fastq.gz	fastq	4082165400.0	40821654.0	GSM8553341 r1	0:100	A:1040984378;C:1022942149;G:978845633;T:1039318707;N:74533	100		1040984378	1022942149	978845633	1039318707	74533	SRX26270364	SRS22808222	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29899	29899	SRR30873033	SRX26270363	SRS22808221	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep10	GSM8553340		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i homozygous\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep10	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i homozygous	GSM8553340	GSM8553340: arid1b 6 dpf rep10; Danio rerio; RNA Seq	GSM8553340 r1	GSM8553340	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-hom_AR23_S23_R1_001.fastq.gz	fastq	4661017700.0	46610177.0	GSM8553340 r1	0:100	A:1238725482;C:1138186288;G:1061058641;T:1222964445;N:82844	100		1238725482	1138186288	1061058641	1222964445	82844	SRX26270363	SRS22808221	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29900	29900	SRR30873034	SRX26270362	SRS22808220	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep9	GSM8553339		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i homozygous\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep9	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i homozygous	GSM8553339	GSM8553339: arid1b 6 dpf rep9; Danio rerio; RNA Seq	GSM8553339 r1	GSM8553339	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-hom_AR22_S22_R1_001.fastq.gz	fastq	4221752400.0	42217524.0	GSM8553339 r1	0:100	A:1065652742;C:1071696614;G:1016007642;T:1068321142;N:74260	100		1065652742	1071696614	1016007642	1068321142	74260	SRX26270362	SRS22808220	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29901	29901	SRR30873035	SRX26270361	SRS22808219	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep8	GSM8553338		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i homozygous\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep8	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i homozygous	GSM8553338	GSM8553338: arid1b 6 dpf rep8; Danio rerio; RNA Seq	GSM8553338 r1	GSM8553338	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-hom_AR21_S21_R1_001.fastq.gz	fastq	4432057900.0	44320579.0	GSM8553338 r1	0:100	A:1141942260;C:1108384050;G:1058194972;T:1123456708;N:79910	100		1141942260	1108384050	1058194972	1123456708	79910	SRX26270361	SRS22808219	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29902	29902	SRR30873036	SRX26270360	SRS22808218	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep7	GSM8553337		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i homozygous\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep7	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i homozygous	GSM8553337	GSM8553337: arid1b 6 dpf rep7; Danio rerio; RNA Seq	GSM8553337 r1	GSM8553337	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-hom_AR20_S20_R1_001.fastq.gz	fastq	4445102100.0	44451021.0	GSM8553337 r1	0:100	A:1155131497;C:1102948564;G:1044423066;T:1142521451;N:77522	100		1155131497	1102948564	1044423066	1142521451	77522	SRX26270360	SRS22808218	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29903	29903	SRR30873037	SRX26270359	SRS22808217	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep6	GSM8553336		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i homozygous\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep6	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i homozygous	GSM8553336	GSM8553336: arid1b 6 dpf rep6; Danio rerio; RNA Seq	GSM8553336 r1	GSM8553336	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-hom_AR19_S19_R1_001.fastq.gz	fastq	4466739200.0	44667392.0	GSM8553336 r1	0:100	A:1142963908;C:1130243443;G:1069626640;T:1123824589;N:80620	100		1142963908	1130243443	1069626640	1123824589	80620	SRX26270359	SRS22808217	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29904	29904	SRR30873038	SRX26270358	SRS22808216	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep5	GSM8553335		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i heterozygous\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep5	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i heterozygous	GSM8553335	GSM8553335: arid1b 6 dpf rep5; Danio rerio; RNA Seq	GSM8553335 r1	GSM8553335	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-het_AR18_S18_R1_001.fastq.gz	fastq	3870464200.0	38704642.0	GSM8553335 r1	0:100	A:1000259085;C:960215025;G:917241491;T:992680013;N:68586	100		1000259085	960215025	917241491	992680013	68586	SRX26270358	SRS22808216	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29905	29905	SRR30873039	SRX26270357	SRS22808215	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep4	GSM8553334		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i heterozygous\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep4	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i heterozygous	GSM8553334	GSM8553334: arid1b 6 dpf rep4; Danio rerio; RNA Seq	GSM8553334 r1	GSM8553334	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-het_AR17_S17_R1_001.fastq.gz	fastq	4594184100.0	45941841.0	GSM8553334 r1	0:100	A:1184283243;C:1151731213;G:1096934508;T:1161152565;N:82571	100		1184283243	1151731213	1096934508	1161152565	82571	SRX26270357	SRS22808215	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29906	29906	SRR30873040	SRX26270356	SRS22808214	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep3	GSM8553333		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i heterozygous\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep3	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i heterozygous	GSM8553333	GSM8553333: arid1b 6 dpf rep3; Danio rerio; RNA Seq	GSM8553333 r1	GSM8553333	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-het_AR16_S16_R1_001.fastq.gz	fastq	4941522000.0	49415220.0	GSM8553333 r1	0:100	A:1259383920;C:1247709712;G:1186755788;T:1247582989;N:89591	100		1259383920	1247709712	1186755788	1247582989	89591	SRX26270356	SRS22808214	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29907	29907	SRR30873041	SRX26270355	SRS22808213	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep2	GSM8553332		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i heterozygous\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep2	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i heterozygous	GSM8553332	GSM8553332: arid1b 6 dpf rep2; Danio rerio; RNA Seq	GSM8553332 r1	GSM8553332	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-het_AR15_S15_R1_001.fastq.gz	fastq	4104651300.0	41046513.0	GSM8553332 r1	0:100	A:1076649631;C:1007609502;G:973534133;T:1046799245;N:58789	100		1076649631	1007609502	973534133	1046799245	58789	SRX26270355	SRS22808213	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29908	29908	SRR30873042	SRX26270354	SRS22808212	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			arid1b 6 dpf rep1	GSM8553331		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i heterozygous\|geo loc name:missing\|collection date:missing	arid1b 6 dpf rep1	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:arid1b 195d50i heterozygous	GSM8553331	GSM8553331: arid1b 6 dpf rep1; Danio rerio; RNA Seq	GSM8553331 r1	GSM8553331	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215			arid1b-195d50i-het_AR14_S14_R1_001.fastq.gz	fastq	2182363600.0	21823636.0	GSM8553331 r1	0:100	A:567445925;C:541275778;G:507884278;T:565718419;N:39200	100		567445925	541275778	507884278	565718419	39200	SRX26270354	SRS22808212	SRA1985473	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-10-03	Larval	Larval	Multi-tissue	Multi-system
29960	29960	SRR27592985	SRX23261695	SRS20163660	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			deaf1 6 dpf rep14	GSM8020155		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i wild types\|geo loc name:missing\|collection date:missing	deaf1 6 dpf rep14	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i wild types	GSM8020155	GSM8020155: deaf1 6 dpf rep14; Danio rerio; RNA Seq	GSM8020155 r1	GSM8020155	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	deaf1-23d46i-6dpf-wt_C4_S28_R1_001.fastq.gz	fastq	3929983225.0	38910725.0	GSM8020155 r1	0:101	A:1024547567;C:957640911;G:915138235;T:1032535260;N:121252	101		1024547567	957640911	915138235	1032535260	121252	SRX23261695	SRS20163660	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29961	29961	SRR27592986	SRX23261694	SRS20163658	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			deaf1 6 dpf rep13	GSM8020154		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i wild types\|geo loc name:missing\|collection date:missing	deaf1 6 dpf rep13	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i wild types	GSM8020154	GSM8020154: deaf1 6 dpf rep13; Danio rerio; RNA Seq	GSM8020154 r1	GSM8020154	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	deaf1-23d46i-6dpf-wt_C3_S27_R1_001.fastq.gz	fastq	3398044101.0	33644001.0	GSM8020154 r1	0:101	A:885187846;C:821364346;G:803770460;T:887617386;N:104063	101		885187846	821364346	803770460	887617386	104063	SRX23261694	SRS20163658	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29962	29962	SRR27592987	SRX23261693	SRS20163659	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			deaf1 6 dpf rep12	GSM8020153		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i wild types\|geo loc name:missing\|collection date:missing	deaf1 6 dpf rep12	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i wild types	GSM8020153	GSM8020153: deaf1 6 dpf rep12; Danio rerio; RNA Seq	GSM8020153 r1	GSM8020153	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	deaf1-23d46i-6dpf-wt_C2_S26_R1_001.fastq.gz	fastq	5035800713.0	49859413.0	GSM8020153 r1	0:101	A:1333647614;C:1193799648;G:1179125857;T:1329071614;N:155980	101		1333647614	1193799648	1179125857	1329071614	155980	SRX23261693	SRS20163659	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29963	29963	SRR27592988	SRX23261692	SRS20163657	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			deaf1 6 dpf rep11	GSM8020152		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i wild types\|geo loc name:missing\|collection date:missing	deaf1 6 dpf rep11	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i wild types	GSM8020152	GSM8020152: deaf1 6 dpf rep11; Danio rerio; RNA Seq	GSM8020152 r1	GSM8020152	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	deaf1-23d46i-6dpf-wt_C1_S25_R1_001.fastq.gz	fastq	3565807727.0	35305027.0	GSM8020152 r1	0:101	A:912147405;C:880055335;G:858888661;T:914605631;N:110695	101		912147405	880055335	858888661	914605631	110695	SRX23261692	SRS20163657	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29964	29964	SRR27592989	SRX23261691	SRS20163655	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			deaf1 6 dpf rep10	GSM8020151		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i homozygous\|geo loc name:missing\|collection date:missing	deaf1 6 dpf rep10	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i homozygous	GSM8020151	GSM8020151: deaf1 6 dpf rep10; Danio rerio; RNA Seq	GSM8020151 r1	GSM8020151	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	deaf1-23d46i-6dpf-hom_B12_S24_R1_001.fastq.gz	fastq	3931681439.0	38927539.0	GSM8020151 r1	0:101	A:1019714387;C:963143457;G:926446608;T:1022254324;N:122663	101		1019714387	963143457	926446608	1022254324	122663	SRX23261691	SRS20163655	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29965	29965	SRR27592990	SRX23261690	SRS20163654	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			deaf1 6 dpf rep9	GSM8020150		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i homozygous\|geo loc name:missing\|collection date:missing	deaf1 6 dpf rep9	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i homozygous	GSM8020150	GSM8020150: deaf1 6 dpf rep9; Danio rerio; RNA Seq	GSM8020150 r1	GSM8020150	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	deaf1-23d46i-6dpf-hom_B11_S23_R1_001.fastq.gz	fastq	3494769074.0	34601674.0	GSM8020150 r1	0:101	A:900665381;C:855792466;G:834354551;T:903848341;N:108335	101		900665381	855792466	834354551	903848341	108335	SRX23261690	SRS20163654	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29966	29966	SRR27592991	SRX23261689	SRS20163653	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			deaf1 6 dpf rep8	GSM8020149		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i homozygous\|geo loc name:missing\|collection date:missing	deaf1 6 dpf rep8	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i homozygous	GSM8020149	GSM8020149: deaf1 6 dpf rep8; Danio rerio; RNA Seq	GSM8020149 r1	GSM8020149	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	deaf1-23d46i-6dpf-hom_B10_S22_R1_001.fastq.gz	fastq	5266326042.0	52141842.0	GSM8020149 r1	0:101	A:1377092992;C:1271335207;G:1235215906;T:1382519057;N:162880	101		1377092992	1271335207	1235215906	1382519057	162880	SRX23261689	SRS20163653	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29967	29967	SRR27592992	SRX23261688	SRS20163656	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			deaf1 6 dpf rep7	GSM8020148		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i homozygous\|geo loc name:missing\|collection date:missing	deaf1 6 dpf rep7	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i homozygous	GSM8020148	GSM8020148: deaf1 6 dpf rep7; Danio rerio; RNA Seq	GSM8020148 r1	GSM8020148	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	deaf1-23d46i-6dpf-hom_B9_S21_R1_001.fastq.gz	fastq	3981685832.0	39422632.0	GSM8020148 r1	0:101	A:1027397987;C:970696826;G:955899926;T:1027567681;N:123412	101		1027397987	970696826	955899926	1027567681	123412	SRX23261688	SRS20163656	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29968	29968	SRR27592993	SRX23261687	SRS20163652	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			deaf1 6 dpf rep6	GSM8020147		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i homozygous\|geo loc name:missing\|collection date:missing	deaf1 6 dpf rep6	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i homozygous	GSM8020147	GSM8020147: deaf1 6 dpf rep6; Danio rerio; RNA Seq	GSM8020147 r1	GSM8020147	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	deaf1-23d46i-6dpf-hom_B8_S20_R1_001.fastq.gz	fastq	3511062899.0	34762999.0	GSM8020147 r1	0:101	A:920619550;C:847444051;G:821952225;T:920937641;N:109432	101		920619550	847444051	821952225	920937641	109432	SRX23261687	SRS20163652	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29969	29969	SRR27592994	SRX23261686	SRS20163651	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			deaf1 6 dpf rep5	GSM8020146		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i heterozygous\|geo loc name:missing\|collection date:missing	deaf1 6 dpf rep5	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i heterozygous	GSM8020146	GSM8020146: deaf1 6 dpf rep5; Danio rerio; RNA Seq	GSM8020146 r1	GSM8020146	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	deaf1-23d46i-6dpf-het_B7_S19_R1_001.fastq.gz	fastq	3584512624.0	35490224.0	GSM8020146 r1	0:101	A:913282881;C:889075256;G:865104443;T:916938683;N:111361	101		913282881	889075256	865104443	916938683	111361	SRX23261686	SRS20163651	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29970	29970	SRR27592995	SRX23261685	SRS20163650	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			deaf1 6 dpf rep4	GSM8020145		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i heterozygous\|geo loc name:missing\|collection date:missing	deaf1 6 dpf rep4	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:deaf1 23d46i heterozygous	GSM8020145	GSM8020145: deaf1 6 dpf rep4; Danio rerio; RNA Seq	GSM8020145 r1	GSM8020145	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	deaf1-23d46i-6dpf-het_B6_S18_R1_001.fastq.gz	fastq	1942752978.0	19235178.0	GSM8020145 r1	0:101	A:510778300;C:474772116;G:456593849;T:500548378;N:60335	101		510778300	474772116	456593849	500548378	60335	SRX23261685	SRS20163650	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29972	29972	SRR27592997	SRX23261683	SRS20163648	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			kmt5b 6 dpf rep11	GSM8020215		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:kmt5b wild types\|geo loc name:missing\|collection date:missing	kmt5b 6 dpf rep11	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:kmt5b wild types	GSM8020215	GSM8020215: kmt5b 6 dpf rep11; Danio rerio; RNA Seq	GSM8020215 r1	GSM8020215	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	kmt5b-6dpf-wt_ST12_S11_L001_R1_001.fastq.gz	fastq	2811106942.0	27832742.0	GSM8020215 r1	0:101	A:742607456;C:672481785;G:661003699;T:735010237;N:3765	101		742607456	672481785	661003699	735010237	3765	SRX23261683	SRS20163648	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29973	29973	SRR27592998	SRX23261682	SRS20163646	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			kmt5b 6 dpf rep10	GSM8020214		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:kmt5b wild types\|geo loc name:missing\|collection date:missing	kmt5b 6 dpf rep10	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:kmt5b wild types	GSM8020214	GSM8020214: kmt5b 6 dpf rep10; Danio rerio; RNA Seq	GSM8020214 r1	GSM8020214	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	kmt5b-6dpf-wt_ST11_S10_L001_R1_001.fastq.gz	fastq	2995768474.0	29661074.0	GSM8020214 r1	0:101	A:778796313;C:726678609;G:718151791;T:772137908;N:3853	101		778796313	726678609	718151791	772137908	3853	SRX23261682	SRS20163646	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29974	29974	SRR27592999	SRX23261681	SRS20163647	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			kmt5b 6 dpf rep9	GSM8020213		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:kmt5b wild types\|geo loc name:missing\|collection date:missing	kmt5b 6 dpf rep9	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:kmt5b wild types	GSM8020213	GSM8020213: kmt5b 6 dpf rep9; Danio rerio; RNA Seq	GSM8020213 r1	GSM8020213	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	kmt5b-6dpf-wt_ST10_S9_L001_R1_001.fastq.gz	fastq	3100692122.0	30699922.0	GSM8020213 r1	0:101	A:802618514;C:755714809;G:746538025;T:795816685;N:4089	101		802618514	755714809	746538025	795816685	4089	SRX23261681	SRS20163647	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29975	29975	SRR27593000	SRX23261680	SRS20163645	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			kmt5b 6 dpf rep8	GSM8020212		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:kmt5b homozygous\|geo loc name:missing\|collection date:missing	kmt5b 6 dpf rep8	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:kmt5b homozygous	GSM8020212	GSM8020212: kmt5b 6 dpf rep8; Danio rerio; RNA Seq	GSM8020212 r1	GSM8020212	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	kmt5b-6dpf-hom_ST9_S8_L001_R1_001.fastq.gz	fastq	3106011792.0	30752592.0	GSM8020212 r1	0:101	A:863424381;C:702180650;G:684425392;T:855977322;N:4047	101		863424381	702180650	684425392	855977322	4047	SRX23261680	SRS20163645	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29976	29976	SRR27593001	SRX23261679	SRS20163644	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			kmt5b 6 dpf rep7	GSM8020211		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:kmt5b homozygous\|geo loc name:missing\|collection date:missing	kmt5b 6 dpf rep7	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:kmt5b homozygous	GSM8020211	GSM8020211: kmt5b 6 dpf rep7; Danio rerio; RNA Seq	GSM8020211 r1	GSM8020211	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	kmt5b-6dpf-hom_ST8_S7_L001_R1_001.fastq.gz	fastq	3075023982.0	30445782.0	GSM8020211 r1	0:101	A:835646166;C:717541810;G:703459633;T:818372433;N:3940	101		835646166	717541810	703459633	818372433	3940	SRX23261679	SRS20163644	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29977	29977	SRR27593002	SRX23261678	SRS20163643	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			kmt5b 6 dpf rep6	GSM8020210		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:kmt5b homozygous\|geo loc name:missing\|collection date:missing	kmt5b 6 dpf rep6	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:kmt5b homozygous	GSM8020210	GSM8020210: kmt5b 6 dpf rep6; Danio rerio; RNA Seq	GSM8020210 r1	GSM8020210	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	kmt5b-6dpf-hom_ST7_S6_L001_R1_001.fastq.gz	fastq	2624342186.0	25983586.0	GSM8020210 r1	0:101	A:679347120;C:640703762;G:632252315;T:672035427;N:3562	101		679347120	640703762	632252315	672035427	3562	SRX23261678	SRS20163643	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29978	29978	SRR27593003	SRX23261677	SRS20163642	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			kmt5b 6 dpf rep5	GSM8020209		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:kmt5b homozygous\|geo loc name:missing\|collection date:missing	kmt5b 6 dpf rep5	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:kmt5b homozygous	GSM8020209	GSM8020209: kmt5b 6 dpf rep5; Danio rerio; RNA Seq	GSM8020209 r1	GSM8020209	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	kmt5b-6dpf-hom_ST6_S5_L001_R1_001.fastq.gz	fastq	5437715063.0	53838763.0	GSM8020209 r1	0:101	A:1481531392;C:1262906390;G:1249347683;T:1443922426;N:7172	101		1481531392	1262906390	1249347683	1443922426	7172	SRX23261677	SRS20163642	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29979	29979	SRR27593004	SRX23261676	SRS20163641	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			kmt5b 6 dpf rep4	GSM8020208		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:kmt5b heterozygous\|geo loc name:missing\|collection date:missing	kmt5b 6 dpf rep4	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:kmt5b heterozygous	GSM8020208	GSM8020208: kmt5b 6 dpf rep4; Danio rerio; RNA Seq	GSM8020208 r1	GSM8020208	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	kmt5b-6dpf-het_ST5_S4_L001_R1_001.fastq.gz	fastq	3496810587.0	34621887.0	GSM8020208 r1	0:101	A:920956592;C:840496211;G:832829579;T:902523782;N:4423	101		920956592	840496211	832829579	902523782	4423	SRX23261676	SRS20163641	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29980	29980	SRR27593005	SRX23261675	SRS20163640	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			kmt5b 6 dpf rep3	GSM8020207		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:kmt5b heterozygous\|geo loc name:missing\|collection date:missing	kmt5b 6 dpf rep3	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:kmt5b heterozygous	GSM8020207	GSM8020207: kmt5b 6 dpf rep3; Danio rerio; RNA Seq	GSM8020207 r1	GSM8020207	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	kmt5b-6dpf-het_ST4_S3_L001_R1_001.fastq.gz	fastq	3779380105.0	37419605.0	GSM8020207 r1	0:101	A:998848737;C:910675528;G:892963309;T:976887623;N:4908	101		998848737	910675528	892963309	976887623	4908	SRX23261675	SRS20163640	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29981	29981	SRR27593006	SRX23261674	SRS20163639	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			kmt5b 6 dpf rep2	GSM8020206		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:kmt5b heterozygous\|geo loc name:missing\|collection date:missing	kmt5b 6 dpf rep2	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:kmt5b heterozygous	GSM8020206	GSM8020206: kmt5b 6 dpf rep2; Danio rerio; RNA Seq	GSM8020206 r1	GSM8020206	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	kmt5b-6dpf-het_ST3_S2_L001_R1_001.fastq.gz	fastq	4697277599.0	46507699.0	GSM8020206 r1	0:101	A:1214157843;C:1147760212;G:1129537221;T:1205816178;N:6145	101		1214157843	1147760212	1129537221	1205816178	6145	SRX23261674	SRS20163639	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29982	29982	SRR27593007	SRX23261673	SRS20163638	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			kmt5b 6 dpf rep1	GSM8020205		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:kmt5b heterozygous\|geo loc name:missing\|collection date:missing	kmt5b 6 dpf rep1	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:kmt5b heterozygous	GSM8020205	GSM8020205: kmt5b 6 dpf rep1; Danio rerio; RNA Seq	GSM8020205 r1	GSM8020205	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	kmt5b-6dpf-het_ST2_S1_L001_R1_001.fastq.gz	fastq	4057743175.0	40175675.0	GSM8020205 r1	0:101	A:1072507807;C:970584483;G:958817150;T:1055828545;N:5190	101		1072507807	970584483	958817150	1055828545	5190	SRX23261673	SRS20163638	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29983	29983	SRR27593008	SRX23261672	SRS20163637	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			hdlbpa 6 dpf rep10	GSM8020204		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa wild types\|geo loc name:missing\|collection date:missing	hdlbpa 6 dpf rep10	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa wild types	GSM8020204	GSM8020204: hdlbpa 6 dpf rep10; Danio rerio; RNA Seq	GSM8020204 r1	GSM8020204	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	hdlbpa-6dpf-wt_H14_S21_L002_R1_001.fastq.gz	fastq	5345570642.0	52926442.0	GSM8020204 r1	0:101	A:1439943379;C:1249929878;G:1229033309;T:1426645468;N:18608	101		1439943379	1249929878	1229033309	1426645468	18608	SRX23261672	SRS20163637	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29984	29984	SRR27593009	SRX23261671	SRS20163636	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			hdlbpa 6 dpf rep9	GSM8020203		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa wild types\|geo loc name:missing\|collection date:missing	hdlbpa 6 dpf rep9	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa wild types	GSM8020203	GSM8020203: hdlbpa 6 dpf rep9; Danio rerio; RNA Seq	GSM8020203 r1	GSM8020203	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	hdlbpa-6dpf-wt_H13_S20_L002_R1_001.fastq.gz	fastq	3927587101.0	38887001.0	GSM8020203 r1	0:101	A:1065676696;C:913744882;G:891757533;T:1056394325;N:13665	101		1065676696	913744882	891757533	1056394325	13665	SRX23261671	SRS20163636	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29985	29985	SRR27593010	SRX23261670	SRS20163635	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			hdlbpa 6 dpf rep8	GSM8020202		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa wild types\|geo loc name:missing\|collection date:missing	hdlbpa 6 dpf rep8	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa wild types	GSM8020202	GSM8020202: hdlbpa 6 dpf rep8; Danio rerio; RNA Seq	GSM8020202 r1	GSM8020202	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	hdlbpa-6dpf-wt_H12_S19_L002_R1_001.fastq.gz	fastq	6495421706.0	64311106.0	GSM8020202 r1	0:101	A:1776534004;C:1513743907;G:1447648946;T:1757472399;N:22450	101		1776534004	1513743907	1447648946	1757472399	22450	SRX23261670	SRS20163635	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29986	29986	SRR27593011	SRX23261669	SRS20163634	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			hdlbpa 6 dpf rep7	GSM8020201		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa wild types\|geo loc name:missing\|collection date:missing	hdlbpa 6 dpf rep7	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa wild types	GSM8020201	GSM8020201: hdlbpa 6 dpf rep7; Danio rerio; RNA Seq	GSM8020201 r1	GSM8020201	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	hdlbpa-6dpf-wt_H11_S18_L002_R1_001.fastq.gz	fastq	3911576379.0	38728479.0	GSM8020201 r1	0:101	A:1058589544;C:907080870;G:898659386;T:1047232965;N:13614	101		1058589544	907080870	898659386	1047232965	13614	SRX23261669	SRS20163634	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29987	29987	SRR27593012	SRX23261668	SRS20163633	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			hdlbpa 6 dpf rep6	GSM8020200		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa homozygous\|geo loc name:missing\|collection date:missing	hdlbpa 6 dpf rep6	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa homozygous	GSM8020200	GSM8020200: hdlbpa 6 dpf rep6; Danio rerio; RNA Seq	GSM8020200 r1	GSM8020200	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	hdlbpa-6dpf-hom_H9_S16_L002_R1_001.fastq.gz	fastq	1927080000.0	19080000.0	GSM8020200 r1	0:101	A:523643390;C:445913624;G:440889014;T:516627902;N:6070	101		523643390	445913624	440889014	516627902	6070	SRX23261668	SRS20163633	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29988	29988	SRR27593013	SRX23261667	SRS20163632	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			hdlbpa 6 dpf rep5	GSM8020199		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa homozygous\|geo loc name:missing\|collection date:missing	hdlbpa 6 dpf rep5	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa homozygous	GSM8020199	GSM8020199: hdlbpa 6 dpf rep5; Danio rerio; RNA Seq	GSM8020199 r1	GSM8020199	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	hdlbpa-6dpf-hom_H8_S15_L002_R1_001.fastq.gz	fastq	1946049618.0	19267818.0	GSM8020199 r1	0:101	A:539909954;C:443888173;G:429627730;T:532616963;N:6798	101		539909954	443888173	429627730	532616963	6798	SRX23261667	SRS20163632	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system
29989	29989	SRR27593014	SRX23261666	SRS20163631	SRP484215	PRJNA1065838	Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations	GSE253405	Transcriptome Analysis	Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.			hdlbpa 6 dpf rep4	GSM8020198		source name:head with eyes 2 5 heads combined\|tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa homozygous\|geo loc name:missing\|collection date:missing	hdlbpa 6 dpf rep4	Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.	head with eyes 2 5 heads combined		RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		tissue:head with eyes 2 5 heads combined\|genotype:hdlbpa homozygous	GSM8020198	GSM8020198: hdlbpa 6 dpf rep4; Danio rerio; RNA Seq	GSM8020198 r1	GSM8020198	1	RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina NovaSeq 6000	SRP484215		loader:fastq load.py	hdlbpa-6dpf-hom_H7_S14_L002_R1_001.fastq.gz	fastq	1039274749.0	10289849.0	GSM8020198 r1	0:101	A:283894686;C:241034413;G:233108651;T:281233307;N:3692	101		283894686	241034413	233108651	281233307	3692	SRX23261666	SRS20163631	SRA1787174	UMass Chan Medical School	UMass Chan Medical School							B	usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	nextera	sc	single_cell_plate	smartseq	United States	2024-01-16	Larval	Larval	Multi-tissue	Multi-system

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;