RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

1,137 rows where devstage_curation = "Larval" and experiment.library_selection = "PolyA"

✎ View and edit SQL

This data as json, CSV (advanced)

tissue_curation >10

technology 4

experiment.library_strategy 3

experiment.platform 2

experiment.library_layout 2

experiment.library_source 1

experiment.library_selection 1

  • PolyA · 1,137 ✖

devstage_curation_coarse 1

devstage_curation 1

  • Larval · 1,137 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
101 101 DRR189403 DRX179868 DRS200418 DRP003977 PRJDB4470 Gene expression analysis of the zebrafish brain DRP003977 Other Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.       Telencephalon of adult zebrafrish 30 min post test session of 2 weeks memory test in non trace 2 Way Active Avoidance coditioning 3 SAMD00182246   sample name:CSUS Tel 30 2w memory 3|genotype:wild type|tissue:brain                 Illumina HiSeq 3000 sequencing of SAMD00182246 DRX179868 CSUS Tel 30 2w memory 3 1 SureSelect Strand Specific RNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina HiSeq 3000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003977 Illumina HiSeq 3000 sequencing of SAMD00182246       2791119960.0 77531110.0 DRR189403 0:36 A:685050951;C:641519684;G:664655385;T:799677669;N:216271 36       685050951 641519684 664655385 799677669 216271 DRX179868 DRS200418 DRA008865 NIG|National Institute of Genetics (Japan) National Institute of Genetics (Japan) 1 0.89653   0.1773   0.70725   0.49873   36   B   usable mapping rate illumina hiseq_era unknown poly_a unknown bulk unknown unknown   Japan 2021-08-08 Larval Larval Brain Nervous System
102 102 DRR189402 DRX179867 DRS200417 DRP003977 PRJDB4470 Gene expression analysis of the zebrafish brain DRP003977 Other Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.       Telencephalon of adult zebrafrish 30 min post test session of 2 weeks memory test in non trace 2 Way Active Avoidance coditioning 2 SAMD00182245   sample name:CSUS Tel 30 2w memory 2|genotype:wild type|tissue:brain                 Illumina HiSeq 3000 sequencing of SAMD00182245 DRX179867 CSUS Tel 30 2w memory 2 1 SureSelect Strand Specific RNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina HiSeq 3000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003977 Illumina HiSeq 3000 sequencing of SAMD00182245       1505449224.0 41818034.0 DRR189402 0:36 A:369895057;C:346914787;G:358624651;T:429897489;N:117240 36       369895057 346914787 358624651 429897489 117240 DRX179867 DRS200417 DRA008865 NIG|National Institute of Genetics (Japan) National Institute of Genetics (Japan) 1 0.89514   0.17677   0.7025   0.49571   36   B   usable mapping rate illumina hiseq_era unknown poly_a unknown bulk unknown unknown   Japan 2021-08-08 Larval Larval Brain Nervous System
103 103 DRR189401 DRX179866 DRS200416 DRP003977 PRJDB4470 Gene expression analysis of the zebrafish brain DRP003977 Other Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.       Telencephalon of adult zebrafrish 30 min post test session of 2 weeks memory test in non trace 2 Way Active Avoidance coditioning 1 SAMD00182244   sample name:CSUS Tel 30 2w memory 1|genotype:wild type|tissue:brain                 Illumina HiSeq 3000 sequencing of SAMD00182244 DRX179866 CSUS Tel 30 2w memory 1 1 SureSelect Strand Specific RNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina HiSeq 3000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003977 Illumina HiSeq 3000 sequencing of SAMD00182244       2088507024.0 58014084.0 DRR189401 0:36 A:516255405;C:478036869;G:496415722;T:597637091;N:161937 36       516255405 478036869 496415722 597637091 161937 DRX179866 DRS200416 DRA008865 NIG|National Institute of Genetics (Japan) National Institute of Genetics (Japan) 1 0.89533   0.18553   0.70981   0.49554   36   B   usable mapping rate illumina hiseq_era unknown poly_a unknown bulk unknown unknown   Japan 2021-08-08 Larval Larval Brain Nervous System
125 125 DRR189379 DRX179844 DRS200410 DRP003977 PRJDB4470 Gene expression analysis of the zebrafish brain DRP003977 Other Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.       Whole body of EMX3 / larval zebrafish 5dpf 3 SAMD00182222   sample name:Emx3 Larva body 3|genotype:Emx3 / |tissue:whole body                 Illumina HiSeq 3000 sequencing of SAMD00182222 DRX179844 Emx3 / Larva body 3 1 SureSelect Strand Specific RNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina HiSeq 3000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003977 Illumina HiSeq 3000 sequencing of SAMD00182222       1759409208.0 48872478.0 DRR189379 0:36 A:401147348;C:424523813;G:426350919;T:507310828;N:76300 36       401147348 424523813 426350919 507310828 76300 DRX179844 DRS200410 DRA008857 NIG|National Institute of Genetics (Japan) National Institute of Genetics (Japan) 1 0.90975   0.11439   0.66076   0.47775   36   B   usable mapping rate illumina hiseq_era unknown poly_a unknown bulk unknown unknown   Japan 2021-08-08 Larval Larval Trunk Surface Structure
126 126 DRR189378 DRX179843 DRS200409 DRP003977 PRJDB4470 Gene expression analysis of the zebrafish brain DRP003977 Other Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.       Whole body of EMX3 / larval zebrafish 5dpf 2 SAMD00182221   sample name:Emx3 Larva body 2|genotype:Emx3 / |tissue:whole body                 Illumina HiSeq 3000 sequencing of SAMD00182221 DRX179843 Emx3 / Larva body 2 1 SureSelect Strand Specific RNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina HiSeq 3000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003977 Illumina HiSeq 3000 sequencing of SAMD00182221       1318201020.0 36616695.0 DRR189378 0:36 A:297850068;C:316786585;G:323717530;T:379789606;N:57231 36       297850068 316786585 323717530 379789606 57231 DRX179843 DRS200409 DRA008857 NIG|National Institute of Genetics (Japan) National Institute of Genetics (Japan) 1 0.9116   0.11269   0.65837   0.46733   36   B   usable mapping rate illumina hiseq_era unknown poly_a unknown bulk unknown unknown   Japan 2021-08-08 Larval Larval Trunk Surface Structure
127 127 DRR189377 DRX179842 DRS200408 DRP003977 PRJDB4470 Gene expression analysis of the zebrafish brain DRP003977 Other Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.       Whole body of EMX3 / larval zebrafish 5dpf 1 SAMD00182220   sample name:Emx3 Larva body 1|genotype:Emx3 / |tissue:whole body                 Illumina HiSeq 3000 sequencing of SAMD00182220 DRX179842 Emx3 / Larva body 1 1 SureSelect Strand Specific RNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina HiSeq 3000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003977 Illumina HiSeq 3000 sequencing of SAMD00182220       812483964.0 22568999.0 DRR189377 0:36 A:185173338;C:197790160;G:197482964;T:232000884;N:36618 36       185173338 197790160 197482964 232000884 36618 DRX179842 DRS200408 DRA008857 NIG|National Institute of Genetics (Japan) National Institute of Genetics (Japan) 1 0.91107   0.1171   0.65981   0.47458   36   B   usable mapping rate illumina hiseq_era unknown poly_a unknown bulk unknown unknown   Japan 2021-08-08 Larval Larval Trunk Surface Structure
128 128 DRR189376 DRX179841 DRS200449 DRP003977 PRJDB4470 Gene expression analysis of the zebrafish brain DRP003977 Other Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.       Whole body of wild type larval zebrafish 5dpf 3 SAMD00182219   sample name:WT Larva body 3|genotype:wild type|tissue:whole body                 Illumina HiSeq 3000 sequencing of SAMD00182219 DRX179841 WT Larva body 3 1 SureSelect Strand Specific RNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina HiSeq 3000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003977 Illumina HiSeq 3000 sequencing of SAMD00182219       4030038144.0 111945504.0 DRR189376 0:36 A:943709984;C:971756680;G:977594500;T:1136798448;N:178532 36       943709984 971756680 977594500 1136798448 178532 DRX179841 DRS200449 DRA008856 NIG|National Institute of Genetics (Japan) National Institute of Genetics (Japan) 1 0.89574   0.12331   0.65831   0.48096   36   B   usable mapping rate illumina hiseq_era unknown poly_a unknown bulk unknown unknown   Japan 2021-08-08 Larval Larval Trunk Surface Structure
129 129 DRR189375 DRX179840 DRS200448 DRP003977 PRJDB4470 Gene expression analysis of the zebrafish brain DRP003977 Other Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.       Whole body of wild type larval zebrafish 5dpf 2 SAMD00182218   sample name:WT Larva body 2|genotype:wild type|tissue:whole body                 Illumina HiSeq 3000 sequencing of SAMD00182218 DRX179840 WT Larva body 2 1 SureSelect Strand Specific RNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina HiSeq 3000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003977 Illumina HiSeq 3000 sequencing of SAMD00182218       1991670804.0 55324189.0 DRR189375 0:36 A:454367176;C:479012055;G:488407231;T:569793674;N:90668 36       454367176 479012055 488407231 569793674 90668 DRX179840 DRS200448 DRA008856 NIG|National Institute of Genetics (Japan) National Institute of Genetics (Japan) 1 0.90911   0.12455   0.65494   0.47971   36   B   usable mapping rate illumina hiseq_era unknown poly_a unknown bulk unknown unknown   Japan 2021-08-08 Larval Larval Trunk Surface Structure
130 130 DRR189374 DRX179839 DRS200447 DRP003977 PRJDB4470 Gene expression analysis of the zebrafish brain DRP003977 Other Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.       Whole body of wild type larval zebrafish 5dpf 1 SAMD00182217   sample name:WT Larva body 1|genotype:wild type|tissue:whole body                 Illumina HiSeq 3000 sequencing of SAMD00182217 DRX179839 WT Larva body 1 1 SureSelect Strand Specific RNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA Illumina HiSeq 3000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003977 Illumina HiSeq 3000 sequencing of SAMD00182217       1018340100.0 28287225.0 DRR189374 0:36 A:233370050;C:244140659;G:247795084;T:292989542;N:44765 36       233370050 244140659 247795084 292989542 44765 DRX179839 DRS200447 DRA008856 NIG|National Institute of Genetics (Japan) National Institute of Genetics (Japan) 1 0.91078   0.12578   0.6524   0.48016   36   B   usable mapping rate illumina hiseq_era unknown poly_a unknown bulk unknown unknown   Japan 2021-08-08 Larval Larval Trunk Surface Structure
294 294 DRR224548 DRX214833 DRS236356 DRP008458 PRJDB9741 RNA seq for developing pectoral fin in zebrafish DRP008458 Other From the developmental view of fin to limb transition an important event in vertebrate evolution we seek fish specific genes that show characteristic expression pattern in the developing fin.       pectoral fin from RIKEN Wild type zebrafish at 28dpf C SAMD00222579   sample name:28dpf C                 Illumina NovaSeq 6000 paired end sequencing of SAMD00222579 DRX214833 28dpf C 1 Illumina TruSeq Stranded mRNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP008458 Illumina NovaSeq 6000 paired end sequencing of SAMD00222579       16269568600.0 81347843.0 DRR224548 0:100 1:100 A:3978004953;C:4160626131;G:4174223034;T:3956539398;N:175084 100 100     3978004953 4160626131 4174223034 3956539398 175084 DRX214833 DRS236356 DRA010086 TOHOKUGL|Laboratory of organ morphogenesis Graduate School of Life Sciences, Tohoku University 2 0.9633 0.95842 0.0474 0.04564 0.72184 0.72253 0.47871 0.46471 100 100 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   Japan 2022-04-21 Larval Larval Fin Surface Structure
295 295 DRR224547 DRX214832 DRS236355 DRP008458 PRJDB9741 RNA seq for developing pectoral fin in zebrafish DRP008458 Other From the developmental view of fin to limb transition an important event in vertebrate evolution we seek fish specific genes that show characteristic expression pattern in the developing fin.       pectoral fin from RIKEN Wild type zebrafish at 28dpf B SAMD00222578   sample name:28dpf B                 Illumina NovaSeq 6000 paired end sequencing of SAMD00222578 DRX214832 28dpf B 1 Illumina TruSeq Stranded mRNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP008458 Illumina NovaSeq 6000 paired end sequencing of SAMD00222578       19970979800.0 99854899.0 DRR224547 0:100 1:100 A:5064043525;C:4909415172;G:5303813974;T:4693498507;N:208622 100 100     5064043525 4909415172 5303813974 4693498507 208622 DRX214832 DRS236355 DRA010086 TOHOKUGL|Laboratory of organ morphogenesis Graduate School of Life Sciences, Tohoku University 2 0.95486 0.94587 0.05718 0.05404 0.73746 0.74754 0.51956 0.47088 100 100 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   Japan 2022-04-21 Larval Larval Fin Surface Structure
296 296 DRR224546 DRX214831 DRS236354 DRP008458 PRJDB9741 RNA seq for developing pectoral fin in zebrafish DRP008458 Other From the developmental view of fin to limb transition an important event in vertebrate evolution we seek fish specific genes that show characteristic expression pattern in the developing fin.       pectoral fin from RIKEN Wild type zebrafish at 28dpf A SAMD00222577   sample name:28dpf A                 Illumina NovaSeq 6000 paired end sequencing of SAMD00222577 DRX214831 28dpf A 1 Illumina TruSeq Stranded mRNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP008458 Illumina NovaSeq 6000 paired end sequencing of SAMD00222577       17870876400.0 89354382.0 DRR224546 0:100 1:100 A:4431724830;C:4512913394;G:4543413766;T:4382632384;N:192026 100 100     4431724830 4512913394 4543413766 4382632384 192026 DRX214831 DRS236354 DRA010086 TOHOKUGL|Laboratory of organ morphogenesis Graduate School of Life Sciences, Tohoku University 2 0.9608 0.95643 0.045 0.04296 0.7236 0.7234 0.50029 0.50287 100 100 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   Japan 2022-04-21 Larval Larval Fin Surface Structure
297 297 DRR224545 DRX214830 DRS236353 DRP008458 PRJDB9741 RNA seq for developing pectoral fin in zebrafish DRP008458 Other From the developmental view of fin to limb transition an important event in vertebrate evolution we seek fish specific genes that show characteristic expression pattern in the developing fin.       pectoral fin from RIKEN Wild type zebrafish at 14dpf C SAMD00222576   sample name:14dpf C                 Illumina NovaSeq 6000 paired end sequencing of SAMD00222576 DRX214830 14dpf C 1 Illumina TruSeq Stranded mRNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP008458 Illumina NovaSeq 6000 paired end sequencing of SAMD00222576       16979810200.0 84899051.0 DRR224545 0:100 1:100 A:4241907225;C:4256915446;G:4277991608;T:4202813567;N:182354 100 100     4241907225 4256915446 4277991608 4202813567 182354 DRX214830 DRS236353 DRA010086 TOHOKUGL|Laboratory of organ morphogenesis Graduate School of Life Sciences, Tohoku University 2 0.96662 0.96168 0.03768 0.03562 0.72368 0.72464 0.48494 0.48687 100 100 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   Japan 2022-04-21 Larval Larval Fin Surface Structure
298 298 DRR224544 DRX214829 DRS236352 DRP008458 PRJDB9741 RNA seq for developing pectoral fin in zebrafish DRP008458 Other From the developmental view of fin to limb transition an important event in vertebrate evolution we seek fish specific genes that show characteristic expression pattern in the developing fin.       pectoral fin from RIKEN Wild type zebrafish at 14dpf B SAMD00222575   sample name:14dpf B                 Illumina NovaSeq 6000 paired end sequencing of SAMD00222575 DRX214829 14dpf B 1 Illumina TruSeq Stranded mRNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP008458 Illumina NovaSeq 6000 paired end sequencing of SAMD00222575       18273780000.0 91368900.0 DRR224544 0:100 1:100 A:4545336763;C:4589502978;G:4635310325;T:4503435996;N:193938 100 100     4545336763 4589502978 4635310325 4503435996 193938 DRX214829 DRS236352 DRA010086 TOHOKUGL|Laboratory of organ morphogenesis Graduate School of Life Sciences, Tohoku University 2 0.97073 0.96595 0.03063 0.02973 0.73632 0.73758 0.47494 0.46918 100 100 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   Japan 2022-04-21 Larval Larval Fin Surface Structure
299 299 DRR224543 DRX214828 DRS236351 DRP008458 PRJDB9741 RNA seq for developing pectoral fin in zebrafish DRP008458 Other From the developmental view of fin to limb transition an important event in vertebrate evolution we seek fish specific genes that show characteristic expression pattern in the developing fin.       pectoral fin from RIKEN Wild type zebrafish at 14dpf A SAMD00222574   sample name:14dpf A                 Illumina NovaSeq 6000 paired end sequencing of SAMD00222574 DRX214828 14dpf A 1 Illumina TruSeq Stranded mRNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP008458 Illumina NovaSeq 6000 paired end sequencing of SAMD00222574       18294607600.0 91473038.0 DRR224543 0:100 1:100 A:4623135433;C:4539347940;G:4561846652;T:4570079366;N:198209 100 100     4623135433 4539347940 4561846652 4570079366 198209 DRX214828 DRS236351 DRA010086 TOHOKUGL|Laboratory of organ morphogenesis Graduate School of Life Sciences, Tohoku University 2 0.96261 0.9592 0.02999 0.02873 0.72699 0.72796 0.4679 0.46591 100 100 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   Japan 2022-04-21 Larval Larval Fin Surface Structure
300 300 DRR224542 DRX214827 DRS236350 DRP008458 PRJDB9741 RNA seq for developing pectoral fin in zebrafish DRP008458 Other From the developmental view of fin to limb transition an important event in vertebrate evolution we seek fish specific genes that show characteristic expression pattern in the developing fin.       pectoral fin from RIKEN Wild type zebrafish at 5dpf C SAMD00222573   sample name:5dpf C                 Illumina NovaSeq 6000 paired end sequencing of SAMD00222573 DRX214827 5dpf C 1 Illumina TruSeq Stranded mRNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP008458 Illumina NovaSeq 6000 paired end sequencing of SAMD00222573       18736996000.0 93684980.0 DRR224542 0:100 1:100 A:4647244376;C:4733187951;G:4746515898;T:4609906214;N:141561 100 100     4647244376 4733187951 4746515898 4609906214 141561 DRX214827 DRS236350 DRA010086 TOHOKUGL|Laboratory of organ morphogenesis Graduate School of Life Sciences, Tohoku University 2 0.97229 0.96893 0.042 0.03995 0.74172 0.74328 0.44607 0.44755 100 100 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   Japan 2022-04-21 Larval Larval Fin Surface Structure
301 301 DRR224541 DRX214826 DRS236349 DRP008458 PRJDB9741 RNA seq for developing pectoral fin in zebrafish DRP008458 Other From the developmental view of fin to limb transition an important event in vertebrate evolution we seek fish specific genes that show characteristic expression pattern in the developing fin.       pectoral fin from RIKEN Wild type zebrafish at 5dpf B SAMD00222572   sample name:5dpf B                 Illumina NovaSeq 6000 paired end sequencing of SAMD00222572 DRX214826 5dpf B 1 Illumina TruSeq Stranded mRNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP008458 Illumina NovaSeq 6000 paired end sequencing of SAMD00222572       22151021400.0 110755107.0 DRR224541 0:100 1:100 A:5555093734;C:5532777660;G:5592525988;T:5470461779;N:162239 100 100     5555093734 5532777660 5592525988 5470461779 162239 DRX214826 DRS236349 DRA010086 TOHOKUGL|Laboratory of organ morphogenesis Graduate School of Life Sciences, Tohoku University 2 0.96835 0.96645 0.04001 0.03872 0.72865 0.72934 0.46355 0.46428 100 100 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   Japan 2022-04-21 Larval Larval Fin Surface Structure
302 302 DRR224540 DRX214825 DRS236348 DRP008458 PRJDB9741 RNA seq for developing pectoral fin in zebrafish DRP008458 Other From the developmental view of fin to limb transition an important event in vertebrate evolution we seek fish specific genes that show characteristic expression pattern in the developing fin.       pectoral fin from RIKEN Wild type zebrafish at 5dpf A SAMD00222571   sample name:5dpf A                 Illumina NovaSeq 6000 paired end sequencing of SAMD00222571 DRX214825 5dpf A 1 Illumina TruSeq Stranded mRNA Library Prep Kit   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina NovaSeq 6000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>200</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>101</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP008458 Illumina NovaSeq 6000 paired end sequencing of SAMD00222571       18219864200.0 91099321.0 DRR224540 0:100 1:100 A:4485880313;C:4629712312;G:4617351502;T:4486786107;N:133966 100 100     4485880313 4629712312 4617351502 4486786107 133966 DRX214825 DRS236348 DRA010086 TOHOKUGL|Laboratory of organ morphogenesis Graduate School of Life Sciences, Tohoku University 2 0.97075 0.96902 0.04498 0.0432 0.72971 0.73044 0.45267 0.4604 100 100 B B biological fallback assumption illumina novaseq_era unknown poly_a trueseq bulk unknown unknown   Japan 2022-04-21 Larval Larval Fin Surface Structure
7898 7898 ERR3446778 ERX3468777 ERS1806709 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 A7 SAMEA104147691 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147691|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:32Z|INSDC status:public|Submitter Id:3a44a000 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:3a44a000 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934993                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#48 DN488439N:H6 Illumina sequencing of library DN488439N:H6 constructed from sample accession ERS1806709 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TTCAGCTC. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#48.cram cram 308695200.0 2057968.0 SC RUN 22829 8#48 0:75 1:75 A:81122866;C:71193244;G:71997258;T:83822324;N:559508 75 75     81122866 71193244 71997258 83822324 559508 ERX3468777 ERS1806709 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.89599 0.93164 0.14865 0.15283 0.69217 0.69759 0.50417 0.50646 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7899 7899 ERR3446777 ERX3468776 ERS1806708 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 A10 SAMEA104147690 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147690|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:32Z|INSDC status:public|Submitter Id:3a397c70 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:3a397c70 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934992                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#47 DN488439N:G6 Illumina sequencing of library DN488439N:G6 constructed from sample accession ERS1806708 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TACTAGTC. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#47.cram cram 995580450.0 6637203.0 SC RUN 22829 8#47 0:75 1:75 A:262413326;C:232761029;G:232382381;T:266176133;N:1847581 75 75     262413326 232761029 232382381 266176133 1847581 ERX3468776 ERS1806708 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95746 0.96146 0.13411 0.13002 0.69954 0.70128 0.51593 0.51584 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7900 7900 ERR3446776 ERX3468775 ERS1806707 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 A5 SAMEA104147689 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147689|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:32Z|INSDC status:public|Submitter Id:3a2b4ba0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:3a2b4ba0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934991                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#46 DN488439N:F6 Illumina sequencing of library DN488439N:F6 constructed from sample accession ERS1806707 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TCAGATTC. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#46.cram cram 802088550.0 5347257.0 SC RUN 22829 8#46 0:75 1:75 A:215471665;C:183766661;G:183444943;T:217939641;N:1465640 75 75     215471665 183766661 183444943 217939641 1465640 ERX3468775 ERS1806707 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95288 0.95668 0.16762 0.16588 0.68785 0.6896 0.51555 0.51471 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7901 7901 ERR3446775 ERX3468774 ERS1806706 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 E7 SAMEA104147688 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147688|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:32Z|INSDC status:public|Submitter Id:3a207630 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:3a207630 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934990                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#45 DN488439N:E6 Illumina sequencing of library DN488439N:E6 constructed from sample accession ERS1806706 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TATGCCAG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#45.cram cram 895634850.0 5970899.0 SC RUN 22829 8#45 0:75 1:75 A:237133265;C:208424547;G:207465996;T:240955635;N:1655407 75 75     237133265 208424547 207465996 240955635 1655407 ERX3468774 ERS1806706 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95242 0.95616 0.148 0.14527 0.68166 0.68489 0.49334 0.49766 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7902 7902 ERR3446774 ERX3468773 ERS1806705 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 D5 SAMEA104147687 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147687|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:32Z|INSDC status:public|Submitter Id:3a15a0c0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:3a15a0c0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934989                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#44 DN488439N:D6 Illumina sequencing of library DN488439N:D6 constructed from sample accession ERS1806705 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TGGCTCAG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#44.cram cram 897162300.0 5981082.0 SC RUN 22829 8#44 0:75 1:75 A:236623845;C:209590114;G:209138794;T:240168869;N:1640678 75 75     236623845 209590114 209138794 240168869 1640678 ERX3468773 ERS1806705 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95642 0.95978 0.15673 0.15393 0.68941 0.69298 0.50945 0.51331 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7903 7903 ERR3446773 ERX3468772 ERS1806704 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 B9 SAMEA104147686 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147686|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:32Z|INSDC status:public|Submitter Id:3a0acb50 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:3a0acb50 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934988                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#43 DN488439N:C6 Illumina sequencing of library DN488439N:C6 constructed from sample accession ERS1806704 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TCATTGAG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#43.cram cram 1041347100.0 6942314.0 SC RUN 22829 8#43 0:75 1:75 A:275192375;C:242588569;G:242047235;T:279597410;N:1921511 75 75     275192375 242588569 242047235 279597410 1921511 ERX3468772 ERS1806704 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95538 0.95935 0.12658 0.12175 0.68527 0.68594 0.49686 0.49869 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7904 7904 ERR3446772 ERX3468771 ERS1806703 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 A9 SAMEA104147685 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147685|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:32Z|INSDC status:public|Submitter Id:39fff5e0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:39fff5e0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934987                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#42 DN488439N:B6 Illumina sequencing of library DN488439N:B6 constructed from sample accession ERS1806703 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TGTATGCG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#42.cram cram 1003046550.0 6686977.0 SC RUN 22829 8#42 0:75 1:75 A:264604462;C:234287668;G:233610516;T:268704610;N:1839294 75 75     264604462 234287668 233610516 268704610 1839294 ERX3468771 ERS1806703 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.9545 0.95817 0.14837 0.14477 0.69075 0.69477 0.5059 0.50954 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7905 7905 ERR3446771 ERX3468770 ERS1806702 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 D1 SAMEA104147684 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147684|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:32Z|INSDC status:public|Submitter Id:39f52070 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:39f52070 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934986                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#41 DN488439N:A6 Illumina sequencing of library DN488439N:A6 constructed from sample accession ERS1806702 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TCCAGTCG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#41.cram cram 941981400.0 6279876.0 SC RUN 22829 8#41 0:75 1:75 A:246347736;C:221993645;G:222033599;T:249879875;N:1726545 75 75     246347736 221993645 222033599 249879875 1726545 ERX3468770 ERS1806702 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95497 0.95862 0.14626 0.14366 0.68069 0.68219 0.51091 0.5108 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7906 7906 ERR3446770 ERX3468769 ERS1806701 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 F3 SAMEA104147683 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147683|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:31Z|INSDC status:public|Submitter Id:39ea4b00 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:39ea4b00 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934985                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#40 DN488439N:H5 Illumina sequencing of library DN488439N:H5 constructed from sample accession ERS1806701 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TAAGTTCG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#40.cram cram 943793700.0 6291958.0 SC RUN 22829 8#40 0:75 1:75 A:248418195;C:220858029;G:220899307;T:251893736;N:1724433 75 75     248418195 220858029 220899307 251893736 1724433 ERX3468769 ERS1806701 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95501 0.95869 0.15165 0.15013 0.6858 0.68968 0.51097 0.51107 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7907 7907 ERR3446769 ERX3468768 ERS1806700 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 A12 SAMEA104147682 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147682|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:31Z|INSDC status:public|Submitter Id:39df7590 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:39df7590 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934984                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#39 DN488439N:G5 Illumina sequencing of library DN488439N:G5 constructed from sample accession ERS1806700 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TCAGGAGG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#39.cram cram 1013740350.0 6758269.0 SC RUN 22829 8#39 0:75 1:75 A:272175825;C:231609775;G:230992859;T:277093551;N:1868340 75 75     272175825 231609775 230992859 277093551 1868340 ERX3468768 ERS1806700 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95017 0.95405 0.17783 0.17326 0.69374 0.69792 0.52105 0.52106 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7908 7908 ERR3446768 ERX3468767 ERS1806699 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 A8 SAMEA104147681 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147681|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:31Z|INSDC status:public|Submitter Id:39d4a020 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:39d4a020 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934983                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#38 DN488439N:F5 Illumina sequencing of library DN488439N:F5 constructed from sample accession ERS1806699 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TCTCACGG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#38.cram cram 795064350.0 5300429.0 SC RUN 22829 8#38 0:75 1:75 A:213296717;C:181969652;G:181448689;T:216888172;N:1461120 75 75     213296717 181969652 181448689 216888172 1461120 ERX3468767 ERS1806699 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95132 0.955 0.15976 0.15558 0.68483 0.68828 0.50493 0.50817 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7909 7909 ERR3446767 ERX3468766 ERS1806698 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 D8 SAMEA104147680 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147680|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:31Z|INSDC status:public|Submitter Id:39c9cab0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:39c9cab0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934982                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#37 DN488439N:E5 Illumina sequencing of library DN488439N:E5 constructed from sample accession ERS1806698 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TACTTCGG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#37.cram cram 977579400.0 6517196.0 SC RUN 22829 8#37 0:75 1:75 A:259910020;C:226288538;G:225374569;T:264216059;N:1790214 75 75     259910020 226288538 225374569 264216059 1790214 ERX3468766 ERS1806698 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95353 0.95725 0.15221 0.14901 0.68442 0.6873 0.48878 0.49948 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7910 7910 ERR3446766 ERX3468765 ERS1806697 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 D9 SAMEA104147679 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147679|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:31Z|INSDC status:public|Submitter Id:39bece30 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:39bece30 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934981                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#36 DN488439N:D5 Illumina sequencing of library DN488439N:D5 constructed from sample accession ERS1806697 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TGAACTGG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#36.cram cram 936668850.0 6244459.0 SC RUN 22829 8#36 0:75 1:75 A:249181628;C:216639604;G:216150821;T:252967247;N:1729550 75 75     249181628 216639604 216150821 252967247 1729550 ERX3468765 ERS1806697 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95513 0.95852 0.15768 0.15381 0.68438 0.68799 0.51177 0.50632 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7911 7911 ERR3446765 ERX3468764 ERS1806696 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 C1 SAMEA104147678 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147678|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:31Z|INSDC status:public|Submitter Id:39b3f8c0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:39b3f8c0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934980                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#35 DN488439N:C5 Illumina sequencing of library DN488439N:C5 constructed from sample accession ERS1806696 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TTGGTATG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#35.cram cram 975853650.0 6505691.0 SC RUN 22829 8#35 0:75 1:75 A:258866840;C:226232975;G:225877015;T:263074733;N:1802087 75 75     258866840 226232975 225877015 263074733 1802087 ERX3468764 ERS1806696 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95586 0.9586 0.14753 0.14367 0.68964 0.69345 0.50825 0.50489 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7912 7912 ERR3446764 ERX3468763 ERS1806694 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 E5 SAMEA104147676 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147676|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:30Z|INSDC status:public|Submitter Id:39a74e90 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:39a74e90 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934979                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#34 DN488439N:B5 Illumina sequencing of library DN488439N:B5 constructed from sample accession ERS1806694 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TAACGCTG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#34.cram cram 960618450.0 6404123.0 SC RUN 22829 8#34 0:75 1:75 A:252530928;C:225220073;G:224701067;T:256397819;N:1768563 75 75     252530928 225220073 224701067 256397819 1768563 ERX3468763 ERS1806694 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95621 0.95933 0.15326 0.15001 0.68278 0.68574 0.50498 0.50559 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7913 7913 ERR3446763 ERX3468762 ERS1806693 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 D11 SAMEA104147675 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147675|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:30Z|INSDC status:public|Submitter Id:399c7920 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:399c7920 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934978                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#33 DN488439N:A5 Illumina sequencing of library DN488439N:A5 constructed from sample accession ERS1806693 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TCGAAGTG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#33.cram cram 1038077400.0 6920516.0 SC RUN 22829 8#33 0:75 1:75 A:270310565;C:245873612;G:245834117;T:274135301;N:1923805 75 75     270310565 245873612 245834117 274135301 1923805 ERX3468762 ERS1806693 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.9563 0.96046 0.13363 0.13125 0.67858 0.68095 0.49926 0.4941 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7914 7914 ERR3446762 ERX3468761 ERS1806695 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 A1 SAMEA104147677 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147677|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:30Z|INSDC status:public|Submitter Id:39901d10 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:39901d10 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934977                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#32 DN488439N:H4 Illumina sequencing of library DN488439N:H4 constructed from sample accession ERS1806695 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TTCCATTG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#32.cram cram 986612850.0 6577419.0 SC RUN 22829 8#32 0:75 1:75 A:259827485;C:230648413;G:231077889;T:263216608;N:1842455 75 75     259827485 230648413 231077889 263216608 1842455 ERX3468761 ERS1806695 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95392 0.95801 0.15749 0.15741 0.68633 0.68941 0.51453 0.5162 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7915 7915 ERR3446761 ERX3468760 ERS1806691 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 B1 SAMEA104147673 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147673|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:30Z|INSDC status:public|Submitter Id:398547a0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:398547a0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934976                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#31 DN488439N:G4 Illumina sequencing of library DN488439N:G4 constructed from sample accession ERS1806691 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TAGTCTTG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#31.cram cram 1031442450.0 6876283.0 SC RUN 22829 8#31 0:75 1:75 A:274203878;C:238375461;G:238376358;T:278589476;N:1897277 75 75     274203878 238375461 238376358 278589476 1897277 ERX3468760 ERS1806691 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95118 0.95551 0.16324 0.16064 0.68615 0.68925 0.51221 0.50738 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7916 7916 ERR3446760 ERX3468759 ERS1806692 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 B8 SAMEA104147674 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147674|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:30Z|INSDC status:public|Submitter Id:397a9940 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:397a9940 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934975                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#30 DN488439N:F4 Illumina sequencing of library DN488439N:F4 constructed from sample accession ERS1806692 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TGTGGTTG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#30.cram cram 841629750.0 5610865.0 SC RUN 22829 8#30 0:75 1:75 A:224237300;C:194199747;G:193893668;T:227725985;N:1573050 75 75     224237300 194199747 193893668 227725985 1573050 ERX3468759 ERS1806692 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95236 0.95666 0.15496 0.1528 0.68049 0.68406 0.50292 0.50201 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7917 7917 ERR3446759 ERX3468758 ERS1806690 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 C3 SAMEA104147672 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147672|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:30Z|INSDC status:public|Submitter Id:396fc3d0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:396fc3d0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934974                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#29 DN488439N:E4 Illumina sequencing of library DN488439N:E4 constructed from sample accession ERS1806690 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TCCTCAAT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#29.cram cram 1003675800.0 6691172.0 SC RUN 22829 8#29 0:75 1:75 A:267034518;C:232079842;G:231287862;T:271430075;N:1843503 75 75     267034518 232079842 231287862 271430075 1843503 ERX3468758 ERS1806690 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95315 0.9573 0.15329 0.151 0.6869 0.68911 0.49176 0.49755 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7918 7918 ERR3446758 ERX3468757 ERS1806689 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 A2 SAMEA104147671 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147671|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:30Z|INSDC status:public|Submitter Id:3962a470 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:3962a470 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934973                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#28 DN488439N:D4 Illumina sequencing of library DN488439N:D4 constructed from sample accession ERS1806689 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TACAGGAT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#28.cram cram 877026750.0 5846845.0 SC RUN 22829 8#28 0:75 1:75 A:234056953;C:201909571;G:201550258;T:237878368;N:1631600 75 75     234056953 201909571 201550258 237878368 1631600 ERX3468757 ERS1806689 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95174 0.95506 0.16448 0.1594 0.68696 0.68956 0.51105 0.51529 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7919 7919 ERR3446757 ERX3468756 ERS1806688 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 B7 SAMEA104147670 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147670|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:30Z|INSDC status:public|Submitter Id:3957cf00 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:3957cf00 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934972                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#27 DN488439N:C4 Illumina sequencing of library DN488439N:C4 constructed from sample accession ERS1806688 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TAGTGACT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#27.cram cram 976188150.0 6507921.0 SC RUN 22829 8#27 0:75 1:75 A:258533450;C:226872670;G:226382560;T:262604964;N:1794506 75 75     258533450 226872670 226382560 262604964 1794506 ERX3468756 ERS1806688 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95189 0.95679 0.13942 0.13618 0.68274 0.68505 0.50235 0.50513 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7920 7920 ERR3446756 ERX3468755 ERS1806687 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 B2 SAMEA104147669 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147669|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:30Z|INSDC status:public|Submitter Id:394a8890 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:394a8890 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934971                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#26 DN488439N:B4 Illumina sequencing of library DN488439N:B4 constructed from sample accession ERS1806687 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TTCCTGCT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#26.cram cram 893242800.0 5954952.0 SC RUN 22829 8#26 0:75 1:75 A:233780534;C:210342200;G:210386139;T:237085352;N:1648575 75 75     233780534 210342200 210386139 237085352 1648575 ERX3468755 ERS1806687 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.9547 0.95931 0.14551 0.14251 0.68605 0.6871 0.51109 0.51231 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7921 7921 ERR3446755 ERX3468754 ERS1806686 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 D6 SAMEA104147668 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147668|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:29Z|INSDC status:public|Submitter Id:393fb320 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:393fb320 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934970                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#25 DN488439N:A4 Illumina sequencing of library DN488439N:A4 constructed from sample accession ERS1806686 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TGCGATCT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#25.cram cram 990960750.0 6606405.0 SC RUN 22829 8#25 0:75 1:75 A:256751586;C:236231048;G:236105966;T:260051730;N:1820420 75 75     256751586 236231048 236105966 260051730 1820420 ERX3468754 ERS1806686 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95946 0.96347 0.13307 0.13209 0.68217 0.68505 0.4931 0.50013 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7922 7922 ERR3446754 ERX3468753 ERS1806685 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 E12 SAMEA104147667 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147667|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:29Z|INSDC status:public|Submitter Id:3931f780 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:3931f780 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934969                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#24 DN488439N:H3 Illumina sequencing of library DN488439N:H3 constructed from sample accession ERS1806685 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TTGACTCT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#24.cram cram 964485000.0 6429900.0 SC RUN 22829 8#24 0:75 1:75 A:251451665;C:228331952;G:228439906;T:254469084;N:1792393 75 75     251451665 228331952 228439906 254469084 1792393 ERX3468753 ERS1806685 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.9564 0.96106 0.12973 0.12899 0.67876 0.68254 0.49322 0.4891 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7923 7923 ERR3446753 ERX3468752 ERS1806684 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 D4 SAMEA104147666 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147666|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:29Z|INSDC status:public|Submitter Id:39272210 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:39272210 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934968                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#23 DN488439N:G3 Illumina sequencing of library DN488439N:G3 constructed from sample accession ERS1806684 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TGCATAGT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#23.cram cram 964272000.0 6428480.0 SC RUN 22829 8#23 0:75 1:75 A:251105580;C:228453524;G:228253397;T:254687699;N:1771800 75 75     251105580 228453524 228253397 254687699 1771800 ERX3468752 ERS1806684 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95716 0.96163 0.14819 0.14629 0.69016 0.69378 0.50746 0.51427 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7924 7924 ERR3446752 ERX3468751 ERS1806683 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 A3 SAMEA104147665 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147665|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:29Z|INSDC status:public|Submitter Id:391c4ca0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:391c4ca0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934967                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#22 DN488439N:F3 Illumina sequencing of library DN488439N:F3 constructed from sample accession ERS1806683 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TGATACGT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#22.cram cram 799230000.0 5328200.0 SC RUN 22829 8#22 0:75 1:75 A:212348969;C:184890796;G:184847246;T:215676416;N:1466573 75 75     212348969 184890796 184847246 215676416 1466573 ERX3468751 ERS1806683 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95436 0.95813 0.16036 0.1592 0.68759 0.69027 0.51144 0.50841 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7925 7925 ERR3446751 ERX3468750 ERS1806681 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 B6 SAMEA104147663 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147663|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:29Z|INSDC status:public|Submitter Id:3910b3e0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:3910b3e0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934966                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#21 DN488439N:E3 Illumina sequencing of library DN488439N:E3 constructed from sample accession ERS1806681 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TCGAGCGT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#21.cram cram 923983200.0 6159888.0 SC RUN 22829 8#21 0:75 1:75 A:243217021;C:216142090;G:216007590;T:246916174;N:1700325 75 75     243217021 216142090 216007590 246916174 1700325 ERX3468750 ERS1806681 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95874 0.96248 0.14485 0.14306 0.69633 0.69877 0.5064 0.50544 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7926 7926 ERR3446750 ERX3468749 ERS1806682 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 B10 SAMEA104147664 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147664|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:29Z|INSDC status:public|Submitter Id:3905b760 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:3905b760 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934965                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#20 DN488439N:D3 Illumina sequencing of library DN488439N:D3 constructed from sample accession ERS1806682 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TTGGAGGT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#20.cram cram 896749650.0 5978331.0 SC RUN 22829 8#20 0:75 1:75 A:236504641;C:209373052;G:209286381;T:239943497;N:1642079 75 75     236504641 209373052 209286381 239943497 1642079 ERX3468749 ERS1806682 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95456 0.9591 0.14445 0.14205 0.68544 0.68809 0.50085 0.50894 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7927 7927 ERR3446749 ERX3468748 ERS1806680 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 C7 SAMEA104147662 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147662|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:29Z|INSDC status:public|Submitter Id:38fae1f0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:38fae1f0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934964                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#19 DN488439N:C3 Illumina sequencing of library DN488439N:C3 constructed from sample accession ERS1806680 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TCTGCTGT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#19.cram cram 933815700.0 6225438.0 SC RUN 22829 8#19 0:75 1:75 A:244718120;C:219569356;G:219612527;T:248215417;N:1700280 75 75     244718120 219569356 219612527 248215417 1700280 ERX3468748 ERS1806680 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95407 0.95781 0.14211 0.14014 0.68142 0.6845 0.5066 0.5032 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7928 7928 ERR3446748 ERX3468747 ERS1806678 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 A11 SAMEA104147660 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147660|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:28Z|INSDC status:public|Submitter Id:38f00c80 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:38f00c80 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934963                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#18 DN488439N:B3 Illumina sequencing of library DN488439N:B3 constructed from sample accession ERS1806678 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TTCTGTGT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#18.cram cram 905329500.0 6035530.0 SC RUN 22829 8#18 0:75 1:75 A:240021393;C:210015428;G:210218903;T:243401797;N:1671979 75 75     240021393 210015428 210218903 243401797 1671979 ERX3468747 ERS1806678 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95212 0.95525 0.15692 0.15381 0.68254 0.68525 0.52037 0.5208 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7929 7929 ERR3446747 ERX3468746 ERS1806679 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 E3 SAMEA104147661 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147661|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:28Z|INSDC status:public|Submitter Id:38e51000 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:38e51000 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934962                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#17 DN488439N:A3 Illumina sequencing of library DN488439N:A3 constructed from sample accession ERS1806679 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TGTACCTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#17.cram cram 947665500.0 6317770.0 SC RUN 22829 8#17 0:75 1:75 A:246559305;C:224934978;G:224812411;T:249601963;N:1756843 75 75     246559305 224934978 224812411 249601963 1756843 ERX3468746 ERS1806679 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95666 0.96095 0.14463 0.14314 0.68757 0.68885 0.51144 0.51225 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7930 7930 ERR3446746 ERX3468745 ERS1806677 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 B4 SAMEA104147659 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147659|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:28Z|INSDC status:public|Submitter Id:38da3a90 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:38da3a90 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934961                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#16 DN488439N:H2 Illumina sequencing of library DN488439N:H2 constructed from sample accession ERS1806677 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TCCGTCTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#16.cram cram 1017363750.0 6782425.0 SC RUN 22829 8#16 0:75 1:75 A:265624052;C:240509411;G:240546256;T:268829904;N:1854127 75 75     265624052 240509411 240546256 268829904 1854127 ERX3468745 ERS1806677 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95466 0.95911 0.14109 0.13929 0.68199 0.68262 0.49544 0.4999 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7931 7931 ERR3446745 ERX3468744 ERS1806676 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 D3 SAMEA104147658 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147658|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:28Z|INSDC status:public|Submitter Id:38c8d570 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:38c8d570 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934960                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#15 DN488439N:G2 Illumina sequencing of library DN488439N:G2 constructed from sample accession ERS1806676 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TAAGCGTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#15.cram cram 1000345500.0 6668970.0 SC RUN 22829 8#15 0:75 1:75 A:258884239;C:238639192;G:238825356;T:262142988;N:1853725 75 75     258884239 238639192 238825356 262142988 1853725 ERX3468744 ERS1806676 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95861 0.96266 0.13649 0.13563 0.68755 0.69098 0.49977 0.50834 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7932 7932 ERR3446744 ERX3468743 ERS1806675 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 D7 SAMEA104147657 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147657|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:28Z|INSDC status:public|Submitter Id:38be0000 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:38be0000 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934959                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#14 DN488439N:F2 Illumina sequencing of library DN488439N:F2 constructed from sample accession ERS1806675 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TCTCGGTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#14.cram cram 831508200.0 5543388.0 SC RUN 22829 8#14 0:75 1:75 A:216944404;C:196565581;G:196615479;T:219853985;N:1528751 75 75     216944404 196565581 196615479 219853985 1528751 ERX3468743 ERS1806675 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95565 0.95932 0.13261 0.13138 0.67724 0.67971 0.49732 0.50908 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7933 7933 ERR3446743 ERX3468742 ERS1806674 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 C6 SAMEA104147656 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147656|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:28Z|INSDC status:public|Submitter Id:38b39fc0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:38b39fc0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934958                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#13 DN488439N:E2 Illumina sequencing of library DN488439N:E2 constructed from sample accession ERS1806674 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TGGTTGTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#13.cram cram 880251450.0 5868343.0 SC RUN 22829 8#13 0:75 1:75 A:230018306;C:207962954;G:207702793;T:232909633;N:1657764 75 75     230018306 207962954 207702793 232909633 1657764 ERX3468742 ERS1806674 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95442 0.95837 0.12979 0.12922 0.6762 0.68081 0.49384 0.49413 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7934 7934 ERR3446742 ERX3468741 ERS1806673 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 C9 SAMEA104147655 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147655|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:28Z|INSDC status:public|Submitter Id:38aa29e0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:38aa29e0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934957                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#12 DN488439N:D2 Illumina sequencing of library DN488439N:D2 constructed from sample accession ERS1806673 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence CTTGTACT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#12.cram cram 885733500.0 5904890.0 SC RUN 22829 8#12 0:75 1:75 A:231281663;C:209310630;G:209302780;T:234229805;N:1608622 75 75     231281663 209310630 209302780 234229805 1608622 ERX3468741 ERS1806673 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95605 0.96017 0.13822 0.13754 0.68069 0.68385 0.50267 0.5053 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7935 7935 ERR3446741 ERX3468740 ERS1806672 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 B12 SAMEA104147654 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147654|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:28Z|INSDC status:public|Submitter Id:38a03ed0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:38a03ed0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934956                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#11 DN488439N:C2 Illumina sequencing of library DN488439N:C2 constructed from sample accession ERS1806672 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence GGCTACAG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#11.cram cram 836620350.0 5577469.0 SC RUN 22829 8#11 0:75 1:75 A:219115747;C:196807550;G:197091855;T:222058678;N:1546520 75 75     219115747 196807550 197091855 222058678 1546520 ERX3468740 ERS1806672 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95466 0.95919 0.15021 0.14856 0.69043 0.69244 0.50929 0.51567 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7936 7936 ERR3446740 ERX3468739 ERS1806670 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 E2 SAMEA104147652 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147652|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:27Z|INSDC status:public|Submitter Id:38908760 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:38908760 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934955                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#10 DN488439N:B2 Illumina sequencing of library DN488439N:B2 constructed from sample accession ERS1806670 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TAGCTTGT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#10.cram cram 911744850.0 6078299.0 SC RUN 22829 8#10 0:75 1:75 A:237470738;C:216053868;G:216099189;T:240450404;N:1670651 75 75     237470738 216053868 216099189 240450404 1670651 ERX3468739 ERS1806670 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95716 0.96092 0.14455 0.14187 0.68686 0.68954 0.50635 0.50911 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7937 7937 ERR3446739 ERX3468738 ERS1806671 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 C12 SAMEA104147653 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147653|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:27Z|INSDC status:public|Submitter Id:3886c360 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:3886c360 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934954                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#9 DN488439N:A2 Illumina sequencing of library DN488439N:A2 constructed from sample accession ERS1806671 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence GATCAGCG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#9.cram cram 928894050.0 6192627.0 SC RUN 22829 8#9 0:75 1:75 A:243727946;C:218420567;G:218359552;T:246701233;N:1684752 75 75     243727946 218420567 218359552 246701233 1684752 ERX3468738 ERS1806671 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.9532 0.95745 0.14809 0.14652 0.68627 0.68911 0.5112 0.51053 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7938 7938 ERR3446738 ERX3468737 ERS1806669 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 B5 SAMEA104147651 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147651|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:27Z|INSDC status:public|Submitter Id:387c1500 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:387c1500 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934953                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#8 DN488439N:H1 Illumina sequencing of library DN488439N:H1 constructed from sample accession ERS1806669 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence ACTTGATG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#8.cram cram 930119400.0 6200796.0 SC RUN 22829 8#8 0:75 1:75 A:242979598;C:220045143;G:219448143;T:245941628;N:1704888 75 75     242979598 220045143 219448143 245941628 1704888 ERX3468737 ERS1806669 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95653 0.95946 0.14247 0.14149 0.6842 0.68738 0.4957 0.49737 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7939 7939 ERR3446737 ERX3468736 ERS1806667 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 D2 SAMEA104147649 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147649|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:27Z|INSDC status:public|Submitter Id:38729f20 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:38729f20 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934952                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#7 DN488439N:G1 Illumina sequencing of library DN488439N:G1 constructed from sample accession ERS1806667 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence CAGATCTG. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#7.cram cram 992301900.0 6615346.0 SC RUN 22829 8#7 0:75 1:75 A:259898582;C:233807624;G:233974368;T:262804375;N:1816951 75 75     259898582 233807624 233974368 262804375 1816951 ERX3468736 ERS1806667 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95492 0.95925 0.14 0.13935 0.68112 0.68312 0.50181 0.49932 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7940 7940 ERR3446736 ERX3468735 ERS1806668 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 F2 SAMEA104147650 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147650|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:27Z|INSDC status:public|Submitter Id:385e05b0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:385e05b0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934951                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#6 DN488439N:F1 Illumina sequencing of library DN488439N:F1 constructed from sample accession ERS1806668 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence GCCAATGT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#6.cram cram 875586600.0 5837244.0 SC RUN 22829 8#6 0:75 1:75 A:231423685;C:204253857;G:204201395;T:234093029;N:1614634 75 75     231423685 204253857 204201395 234093029 1614634 ERX3468735 ERS1806668 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95428 0.95811 0.15334 0.15296 0.67905 0.68256 0.50447 0.50735 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7941 7941 ERR3446735 ERX3468734 ERS1806666 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 A4 SAMEA104147648 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147648|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:27Z|INSDC status:public|Submitter Id:384833c0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:384833c0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934950                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#5 DN488439N:E1 Illumina sequencing of library DN488439N:E1 constructed from sample accession ERS1806666 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence ACAGTGGT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#5.cram cram 835599450.0 5570663.0 SC RUN 22829 8#5 0:75 1:75 A:221022844;C:194609457;G:194728372;T:223667754;N:1571023 75 75     221022844 194609457 194728372 223667754 1571023 ERX3468734 ERS1806666 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95389 0.95704 0.16434 0.16289 0.68363 0.68669 0.50299 0.51388 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7942 7942 ERR3446734 ERX3468733 ERS1806664 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 F1 SAMEA104147646 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147646|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:26Z|INSDC status:public|Submitter Id:3832aff0 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:3832aff0 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934949                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#4 DN488439N:D1 Illumina sequencing of library DN488439N:D1 constructed from sample accession ERS1806664 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TGACCACT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#4.cram cram 891655350.0 5944369.0 SC RUN 22829 8#4 0:75 1:75 A:236505554;C:207018655;G:207193827;T:239299452;N:1637862 75 75     236505554 207018655 207193827 239299452 1637862 ERX3468733 ERS1806664 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95251 0.95547 0.16653 0.16502 0.68822 0.68984 0.51935 0.51421 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7943 7943 ERR3446733 ERX3468732 ERS1806665 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 C2 SAMEA104147647 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147647|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:26Z|INSDC status:public|Submitter Id:38138f30 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:38138f30 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934948                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#3 DN488439N:C1 Illumina sequencing of library DN488439N:C1 constructed from sample accession ERS1806665 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence TTAGGCAT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#3.cram cram 888434250.0 5922895.0 SC RUN 22829 8#3 0:75 1:75 A:233268153;C:208683895;G:208766742;T:236094656;N:1620804 75 75     233268153 208683895 208766742 236094656 1620804 ERX3468732 ERS1806665 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95631 0.96066 0.14611 0.14537 0.68422 0.6854 0.50209 0.50377 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7944 7944 ERR3446732 ERX3468731 ERS1806663 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 B3 SAMEA104147645 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147645|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:26Z|INSDC status:public|Submitter Id:37fdbd40 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:37fdbd40 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934947                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#2 DN488439N:B1 Illumina sequencing of library DN488439N:B1 constructed from sample accession ERS1806663 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence CGATGTTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#2.cram cram 883215600.0 5888104.0 SC RUN 22829 8#2 0:75 1:75 A:231296783;C:208055844;G:208135446;T:234080007;N:1647520 75 75     231296783 208055844 208135446 234080007 1647520 ERX3468731 ERS1806663 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95417 0.95779 0.14224 0.14158 0.67945 0.68178 0.49376 0.49496 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
7945 7945 ERR3446731 ERX3468730 ERS1806662 ERP023267 PRJEB21045 RNASeq of zebrafish metabolic mutants RNASeq_of_zebrafish_metabolic_mutants-sc-4765 Transcriptome Analysis RNAseq data was generated from one or more alleles of zebrafish metabolic mutants for transcriptome analysis. ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2017 05 25|ArrayExpress:E ERAD 683     zmp ph279 E4 SAMEA104147644 Wellcome Sanger Institute ArrayExpress DEVELOPMENTAL STAGE:Larval:Protruding mouth ZFS:0000035|ArrayExpress ORGANISM PART:Whole organism|ArrayExpress SPECIES:Danio rerio|ArrayExpress STRAIN OR LINE:mixed|ENA first public:2019 06 29|ENA last update:2017 06 29|External Id:SAMEA104147644|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2019 06 29T04:02:25Z|INSDC last update:2017 06 29T14:54:26Z|INSDC status:public|Submitter Id:37e37e80 41ed 11e7 b6fe 3c4a9275d6c8|common name:zebrafish|sample name:37e37e80 41ed 11e7 b6fe 3c4a9275d6c8|subject id:4765STDY6934946                 Illumina HiSeq 2500 paired end sequencing SC EXP 22829 8#1 DN488439N:A1 Illumina sequencing of library DN488439N:A1 constructed from sample accession ERS1806662 for study accession ERP023267. This is part of an Illumina multiplexed sequencing run 22829 8. This submission includes reads tagged with the sequence ATCACGTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC PolyA PAIRED ILLUMINA Illumina HiSeq 2500   ERP023267 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2019 07 22|ENA LAST UPDATE:2019 07 22 22829_8#1.cram cram 832221450.0 5548143.0 SC RUN 22829 8#1 0:75 1:75 A:218233303;C:195802305;G:195652594;T:221003769;N:1529479 75 75     218233303 195802305 195652594 221003769 1529479 ERX3468730 ERS1806662 ERA2044656 European Nucleotide Archive Wellcome Sanger Institute 2 0.95539 0.95958 0.13422 0.13299 0.68631 0.68828 0.49563 0.49505 75 75 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   United Kingdom 2017-05-25 Larval Larval Whole Organism All anatomical structures
9651 9651 ERR3266392 ERX3293003 ERS3358386 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep2 SAMEA5556346 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep2 s sponge tdr gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9pos_S2_L001_R1_001.fastq.gz fastq 603238067.0 8014716.0 E MTAB 7846:sponge tdr gfp positive rep2 lane1 0:75.27 1:0 A:164797697;C:136552121;G:141138007;T:160737152;N:13090 75 0     164797697 136552121 141138007 160737152 13090 ERX3293003 ERS3358386 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95083   0.06432   0.71532   0.50098   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9652 9652 ERR3266393 ERX3293003 ERS3358386 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep2 SAMEA5556346 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep2 s sponge tdr gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9pos_S2_L002_R1_001.fastq.gz fastq 603749720.0 8021069.0 E MTAB 7846:sponge tdr gfp positive rep2 lane2 0:75.27 1:0 A:164972969;C:136661417;G:141205792;T:160896264;N:13278 75 0     164972969 136661417 141205792 160896264 13278 ERX3293003 ERS3358386 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.951   0.06542   0.71768   0.50051   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9653 9653 ERR3266394 ERX3293003 ERS3358386 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep2 SAMEA5556346 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep2 s sponge tdr gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9pos_S2_L003_R1_001.fastq.gz fastq 608154053.0 8079704.0 E MTAB 7846:sponge tdr gfp positive rep2 lane3 0:75.27 1:0 A:166117918;C:137731172;G:142320339;T:161970092;N:14532 75 0     166117918 137731172 142320339 161970092 14532 ERX3293003 ERS3358386 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95155   0.0657   0.71634   0.49493   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9654 9654 ERR3266395 ERX3293003 ERS3358386 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep2 SAMEA5556346 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep2 s sponge tdr gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9pos_S2_L004_R1_001.fastq.gz fastq 599143392.0 7959897.0 E MTAB 7846:sponge tdr gfp positive rep2 lane4 0:75.27 1:0 A:163706904;C:135622453;G:140192351;T:159605249;N:16435 75 0     163706904 135622453 140192351 159605249 16435 ERX3293003 ERS3358386 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95061   0.06431   0.71764   0.50166   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9655 9655 ERR3266388 ERX3293002 ERS3358385 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep1 SAMEA5556345 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep1 s sponge tdr gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6pos_S4_L001_R1_001.fastq.gz fastq 616761505.0 8202480.0 E MTAB 7846:sponge tdr gfp positive rep1 lane1 0:75.19 1:0 A:168679238;C:139548565;G:143969797;T:164545362;N:18543 75 0     168679238 139548565 143969797 164545362 18543 ERX3293002 ERS3358385 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95019   0.06806   0.7097   0.50337   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9656 9656 ERR3266389 ERX3293002 ERS3358385 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep1 SAMEA5556345 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep1 s sponge tdr gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6pos_S4_L002_R1_001.fastq.gz fastq 617529482.0 8212485.0 E MTAB 7846:sponge tdr gfp positive rep1 lane2 0:75.19 1:0 A:168925757;C:139655387;G:144096837;T:164831236;N:20265 75 0     168925757 139655387 144096837 164831236 20265 ERX3293002 ERS3358385 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.9492   0.06753   0.712   0.49881   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9657 9657 ERR3266390 ERX3293002 ERS3358385 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep1 SAMEA5556345 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep1 s sponge tdr gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6pos_S4_L003_R1_001.fastq.gz fastq 624156883.0 8300861.0 E MTAB 7846:sponge tdr gfp positive rep1 lane3 0:75.19 1:0 A:170696950;C:141302376;G:145759286;T:166377781;N:20490 75 0     170696950 141302376 145759286 166377781 20490 ERX3293002 ERS3358385 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94917   0.06724   0.71291   0.50783   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9658 9658 ERR3266391 ERX3293002 ERS3358385 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp positive rep1 SAMEA5556345 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp positive rep1 s sponge tdr gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6pos_S4_L004_R1_001.fastq.gz fastq 615013615.0 8179180.0 E MTAB 7846:sponge tdr gfp positive rep1 lane4 0:75.19 1:0 A:168237742;C:139106952;G:143535658;T:164110735;N:22528 75 0     168237742 139106952 143535658 164110735 22528 ERX3293002 ERS3358385 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94892   0.06723   0.71206   0.50775   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9659 9659 ERR3266384 ERX3293001 ERS3358384 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep2 SAMEA5556344 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep2 s sponge tdr gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9neg_S1_L001_R1_001.fastq.gz fastq 659562366.0 8762947.0 E MTAB 7846:sponge tdr gfp negative rep2 lane1 0:75.27 1:0 A:178744772;C:150091912;G:155092318;T:175619332;N:14032 75 0     178744772 150091912 155092318 175619332 14032 ERX3293001 ERS3358384 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.9517   0.06908   0.70822   0.48025   73   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9660 9660 ERR3266385 ERX3293001 ERS3358384 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep2 SAMEA5556344 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep2 s sponge tdr gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9neg_S1_L002_R1_001.fastq.gz fastq 658688825.0 8751176.0 E MTAB 7846:sponge tdr gfp negative rep2 lane2 0:75.27 1:0 A:178540155;C:149844100;G:154850294;T:175438757;N:15519 75 0     178540155 149844100 154850294 175438757 15519 ERX3293001 ERS3358384 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95059   0.06748   0.70806   0.48177   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9661 9661 ERR3266386 ERX3293001 ERS3358384 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep2 SAMEA5556344 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep2 s sponge tdr gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9neg_S1_L003_R1_001.fastq.gz fastq 665901310.0 8846927.0 E MTAB 7846:sponge tdr gfp negative rep2 lane3 0:75.27 1:0 A:180412445;C:151589489;G:156677030;T:177206192;N:16154 75 0     180412445 151589489 156677030 177206192 16154 ERX3293001 ERS3358384 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95095   0.06855   0.7082   0.4787   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9662 9662 ERR3266387 ERX3293001 ERS3358384 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep2 SAMEA5556344 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep2 s sponge tdr gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_9neg_S1_L004_R1_001.fastq.gz fastq 655674573.0 8711278.0 E MTAB 7846:sponge tdr gfp negative rep2 lane4 0:75.27 1:0 A:177658097;C:149188009;G:154201531;T:174609176;N:17760 75 0     177658097 149188009 154201531 174609176 17760 ERX3293001 ERS3358384 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.9503   0.06838   0.70926   0.47475   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9663 9663 ERR3266380 ERX3293000 ERS3358383 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep1 SAMEA5556343 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep1 s sponge tdr gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6neg_S3_L001_R1_001.fastq.gz fastq 634491637.0 8440052.0 E MTAB 7846:sponge tdr gfp negative rep1 lane1 0:75.18 1:0 A:170881257;C:145535643;G:150561786;T:167495156;N:17795 75 0     170881257 145535643 150561786 167495156 17795 ERX3293000 ERS3358383 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94996   0.05672   0.70571   0.48691   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9664 9664 ERR3266381 ERX3293000 ERS3358383 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep1 SAMEA5556343 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep1 s sponge tdr gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6neg_S3_L002_R1_001.fastq.gz fastq 632900752.0 8418846.0 E MTAB 7846:sponge tdr gfp negative rep1 lane2 0:75.18 1:0 A:170454908;C:145141392;G:150172752;T:167112562;N:19138 75 0     170454908 145141392 150172752 167112562 19138 ERX3293000 ERS3358383 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94905   0.05627   0.70457   0.4865   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9665 9665 ERR3266382 ERX3293000 ERS3358383 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep1 SAMEA5556343 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep1 s sponge tdr gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6neg_S3_L003_R1_001.fastq.gz fastq 638530115.0 8494045.0 E MTAB 7846:sponge tdr gfp negative rep1 lane3 0:75.17 1:0 A:171907482;C:146526309;G:151612209;T:168464163;N:19952 75 0     171907482 146526309 151612209 168464163 19952 ERX3293000 ERS3358383 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94919   0.05578   0.70849   0.48073   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9666 9666 ERR3266383 ERX3293000 ERS3358383 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge tdr gfp negative rep1 SAMEA5556343 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge tdr gfp negative rep1 s sponge tdr gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E9_6neg_S3_L004_R1_001.fastq.gz fastq 627433322.0 8346505.0 E MTAB 7846:sponge tdr gfp negative rep1 lane4 0:75.17 1:0 A:169016383;C:143886824;G:148914725;T:165593528;N:21862 75 0     169016383 143886824 148914725 165593528 21862 ERX3293000 ERS3358383 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94993   0.05721   0.7052   0.48878   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9667 9667 ERR3266376 ERX3292999 ERS3358382 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep2 SAMEA5556342 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep2 s sponge isl gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7pos_S10_L001_R1_001.fastq.gz fastq 618672195.0 8218047.0 E MTAB 7846:sponge isl gfp positive rep2 lane1 0:75.28 1:0 A:166422886;C:142212204;G:146857539;T:163167819;N:11747 75 0     166422886 142212204 146857539 163167819 11747 ERX3292999 ERS3358382 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94979   0.08351   0.70863   0.47581   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9668 9668 ERR3266377 ERX3292999 ERS3358382 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep2 SAMEA5556342 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep2 s sponge isl gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7pos_S10_L002_R1_001.fastq.gz fastq 618709102.0 8218295.0 E MTAB 7846:sponge isl gfp positive rep2 lane2 0:75.28 1:0 A:166470432;C:142189977;G:146819280;T:163216323;N:13090 75 0     166470432 142189977 146819280 163216323 13090 ERX3292999 ERS3358382 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94977   0.08255   0.70644   0.47228   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9669 9669 ERR3266378 ERX3292999 ERS3358382 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep2 SAMEA5556342 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep2 s sponge isl gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7pos_S10_L003_R1_001.fastq.gz fastq 625353059.0 8306375.0 E MTAB 7846:sponge isl gfp positive rep2 lane3 0:75.29 1:0 A:168233274;C:143793178;G:148510556;T:164802476;N:13575 75 0     168233274 143793178 148510556 164802476 13575 ERX3292999 ERS3358382 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.95014   0.08368   0.70743   0.47846   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9670 9670 ERR3266379 ERX3292999 ERS3358382 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep2 SAMEA5556342 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep2 s sponge isl gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7pos_S10_L004_R1_001.fastq.gz fastq 615204990.0 8171748.0 E MTAB 7846:sponge isl gfp positive rep2 lane4 0:75.28 1:0 A:165565861;C:141380152;G:146028839;T:162214263;N:15875 75 0     165565861 141380152 146028839 162214263 15875 ERX3292999 ERS3358382 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94954   0.08233   0.70834   0.48166   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9671 9671 ERR3266372 ERX3292998 ERS3358381 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep1 SAMEA5556341 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep1 s sponge isl gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6pos_S12_L001_R1_001.fastq.gz fastq 626474467.0 8318996.0 E MTAB 7846:sponge isl gfp positive rep1 lane1 0:75.31 1:0 A:170186220;C:142441110;G:147048643;T:166786401;N:12093 75 0     170186220 142441110 147048643 166786401 12093 ERX3292998 ERS3358381 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94907   0.08132   0.69684   0.4736   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9672 9672 ERR3266373 ERX3292998 ERS3358381 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep1 SAMEA5556341 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep1 s sponge isl gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6pos_S12_L002_R1_001.fastq.gz fastq 626477579.0 8318750.0 E MTAB 7846:sponge isl gfp positive rep1 lane2 0:75.31 1:0 A:170185337;C:142396801;G:147032265;T:166850532;N:12644 75 0     170185337 142396801 147032265 166850532 12644 ERX3292998 ERS3358381 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94941   0.08253   0.6957   0.47554   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9673 9673 ERR3266374 ERX3292998 ERS3358381 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep1 SAMEA5556341 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep1 s sponge isl gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6pos_S12_L003_R1_001.fastq.gz fastq 632098509.0 8393388.0 E MTAB 7846:sponge isl gfp positive rep1 lane3 0:75.31 1:0 A:171699353;C:143766296;G:148442110;T:168177264;N:13486 75 0     171699353 143766296 148442110 168177264 13486 ERX3292998 ERS3358381 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94866   0.08247   0.69601   0.48009   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9674 9674 ERR3266375 ERX3292998 ERS3358381 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp positive rep1 SAMEA5556341 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp positive rep1 s sponge isl gfp positive rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6pos_S12_L004_R1_001.fastq.gz fastq 622997479.0 8272752.0 E MTAB 7846:sponge isl gfp positive rep1 lane4 0:75.31 1:0 A:169306677;C:141586415;G:146241288;T:165847752;N:15347 75 0     169306677 141586415 146241288 165847752 15347 ERX3292998 ERS3358381 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.9483   0.08034   0.69662   0.47868   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9675 9675 ERR3266368 ERX3292997 ERS3358380 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep2 SAMEA5556340 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep2 s sponge isl gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7neg_S9_L001_R1_001.fastq.gz fastq 707454819.0 9395082.0 E MTAB 7846:sponge isl gfp negative rep2 lane1 0:75.30 1:0 A:194991862;C:157927850;G:163280639;T:191241488;N:12980 75 0     194991862 157927850 163280639 191241488 12980 ERX3292997 ERS3358380 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.93871   0.08926   0.70806   0.46501   75   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9676 9676 ERR3266369 ERX3292997 ERS3358380 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep2 SAMEA5556340 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep2 s sponge isl gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7neg_S9_L002_R1_001.fastq.gz fastq 704791838.0 9359668.0 E MTAB 7846:sponge isl gfp negative rep2 lane2 0:75.30 1:0 A:194317422;C:157276895;G:162624670;T:190558322;N:14529 75 0     194317422 157276895 162624670 190558322 14529 ERX3292997 ERS3358380 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.93816   0.08859   0.70999   0.4661   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9677 9677 ERR3266370 ERX3292997 ERS3358380 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep2 SAMEA5556340 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep2 s sponge isl gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7neg_S9_L003_R1_001.fastq.gz fastq 715991833.0 9508323.0 E MTAB 7846:sponge isl gfp negative rep2 lane3 0:75.30 1:0 A:197297222;C:159913026;G:165363927;T:193402765;N:14893 75 0     197297222 159913026 165363927 193402765 14893 ERX3292997 ERS3358380 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.93844   0.08854   0.70828   0.46042   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9678 9678 ERR3266371 ERX3292997 ERS3358380 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep2 SAMEA5556340 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep2 s sponge isl gfp negative rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_7neg_S9_L004_R1_001.fastq.gz fastq 703723869.0 9345669.0 E MTAB 7846:sponge isl gfp negative rep2 lane4 0:75.30 1:0 A:194029886;C:157050176;G:162432310;T:190193608;N:17889 75 0     194029886 157050176 162432310 190193608 17889 ERX3292997 ERS3358380 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.93897   0.08993   0.70863   0.45707   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9679 9679 ERR3266364 ERX3292996 ERS3358379 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep1 SAMEA5556339 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep1 s sponge isl gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6neg_S11_L001_R1_001.fastq.gz fastq 676581458.0 8983758.0 E MTAB 7846:sponge isl gfp negative rep1 lane1 0:75.31 1:0 A:184297337;C:153352193;G:158268476;T:180651038;N:12414 75 0     184297337 153352193 158268476 180651038 12414 ERX3292996 ERS3358379 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94981   0.07715   0.69138   0.47243   74   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9680 9680 ERR3266365 ERX3292996 ERS3358379 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep1 SAMEA5556339 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep1 s sponge isl gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6neg_S11_L002_R1_001.fastq.gz fastq 676876555.0 8987445.0 E MTAB 7846:sponge isl gfp negative rep1 lane2 0:75.31 1:0 A:184435129;C:153332402;G:158323789;T:180770978;N:14257 75 0     184435129 153332402 158323789 180770978 14257 ERX3292996 ERS3358379 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94901   0.07805   0.69179   0.47182   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9681 9681 ERR3266366 ERX3292996 ERS3358379 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep1 SAMEA5556339 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep1 s sponge isl gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6neg_S11_L003_R1_001.fastq.gz fastq 681771213.0 9052615.0 E MTAB 7846:sponge isl gfp negative rep1 lane3 0:75.31 1:0 A:185717696;C:154552039;G:159567102;T:181919781;N:14595 75 0     185717696 154552039 159567102 181919781 14595 ERX3292996 ERS3358379 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94923   0.07768   0.69167   0.47219   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9682 9682 ERR3266367 ERX3292996 ERS3358379 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge isl gfp negative rep1 SAMEA5556339 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge isl gfp negative rep1 s sponge isl gfp negative rep1 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E4_6neg_S11_L004_R1_001.fastq.gz fastq 671169917.0 8911624.0 E MTAB 7846:sponge isl gfp negative rep1 lane4 0:75.31 1:0 A:182910490;C:152045814;G:157010053;T:179186548;N:17012 75 0     182910490 152045814 157010053 179186548 17012 ERX3292996 ERS3358379 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94941   0.07612   0.69106   0.47736   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9683 9683 ERR3266360 ERX3292995 ERS3358378 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp positive rep2 SAMEA5556338 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp positive rep2 s sponge ccn gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_8pos_S6_L001_R1_001.fastq.gz fastq 745666738.0 9917771.0 E MTAB 7846:sponge ccn gfp positive rep2 lane1 0:75.18 1:0 A:207714377;C:163732420;G:169037726;T:205161925;N:20290 75 0     207714377 163732420 169037726 205161925 20290 ERX3292995 ERS3358378 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.94006   0.17809   0.68166   0.48912   74   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures
9684 9684 ERR3266361 ERX3292995 ERS3358378 ERP114712 PRJEB32081 RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E-MTAB-7846 Transcriptome Analysis To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08   Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. sponge ccn gfp positive rep2 SAMEA5556338 UQ ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains                 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers E MTAB 7846:sponge ccn gfp positive rep2 s sponge ccn gfp positive rep2 s RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive RNA-Seq TRANSCRIPTOMIC PolyA SINGLE ILLUMINA NextSeq 500   ERP114712 NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 E6_8pos_S6_L002_R1_001.fastq.gz fastq 747693645.0 9944395.0 E MTAB 7846:sponge ccn gfp positive rep2 lane2 0:75.19 1:0 A:208257288;C:164106384;G:169478025;T:205830399;N:21549 75 0     208257288 164106384 169478025 205830399 21549 ERX3292995 ERS3358378 ERA1822647 European Nucleotide Archive European Nucleotide Archive 1 0.93873   0.17738   0.68296   0.49656   76   B   usable mapping rate illumina nextseq unknown poly_a nextera sc single_cell_plate smartseq   Unknown 2019-04-08 Larval Larval Embryo Imprecise All anatomical structures

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;