metadata: run_metadata: 10 rows where devstage_curation = "Hatching" and tissue

10 rows where devstage_curation = "Hatching" and tissue_curation = "Skin"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.PMIDs	sample.description	sample.title	sample.alias	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
38119	38119	SRR1551796	SRX681416	SRS685079	SRP045504	PRJNA258223	Danio rerio strain:TL Transcriptome or Gene expression	PRJNA258223	Other	Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos			Transcriptome from 2dpf keratocytes	keratocytes from 2dpf embryos	breed:TL\|strain:TL\|age:2dpf\|biomaterial provider:Julie Theriot Stanford University\|sex:not collected\|tissue:keratocytes skin\|cell type:keratocyte\|dev stage:2dpf\|BioSampleModel:Model organism or animal									Transcriptome from 2dpf keratocytes replicate 3	2dpf 3	2dpf 3	RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.			RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina Genome Analyzer IIx	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>40</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP045504	lane3_2dpf629.fastq	fastq	551787520.0	13794688.0	2dpf 3	0:40	A:138660463;C:132605577;G:134640312;T:145852714;N:28454	40		138660463	132605577	134640312	145852714	28454	SRX681416	SRS685079	SRA179323	Stanford University\|Julie Theriot	Stanford University	1	0.91375		0.21598		0.75317		0.47881		40		B		usable mapping rate	illumina	early_illumina	unknown	poly_a	trueseq	bulk	unknown	unknown	United States	2014-08-14	Hatching	Embryo	Skin	Surface Structure
38120	38120	SRR1551795	SRX681415	SRS685079	SRP045504	PRJNA258223	Danio rerio strain:TL Transcriptome or Gene expression	PRJNA258223	Other	Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos			Transcriptome from 2dpf keratocytes	keratocytes from 2dpf embryos	breed:TL\|strain:TL\|age:2dpf\|biomaterial provider:Julie Theriot Stanford University\|sex:not collected\|tissue:keratocytes skin\|cell type:keratocyte\|dev stage:2dpf\|BioSampleModel:Model organism or animal									Transcriptome from 2dpf keratocytes	2dpf 2	2dpf 2	RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.			RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina Genome Analyzer IIx	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>40</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP045504	lane1_2dpf.fastq	fastq	796874112.0	22135392.0	2dpf 2	0:36	A:209956517;C:184659684;G:185142987;T:216055902;N:1059022	36		209956517	184659684	185142987	216055902	1059022	SRX681415	SRS685079	SRA179323	Stanford University\|Julie Theriot	Stanford University	1	0.89178		0.17837		0.7609		0.49774		36		B		usable mapping rate	illumina	early_illumina	unknown	poly_a	trueseq	bulk	unknown	unknown	United States	2015-04-07	Hatching	Embryo	Skin	Surface Structure
38121	38121	SRR1551782	SRX681402	SRS685079	SRP045504	PRJNA258223	Danio rerio strain:TL Transcriptome or Gene expression	PRJNA258223	Other	Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos			Transcriptome from 2dpf keratocytes	keratocytes from 2dpf embryos	breed:TL\|strain:TL\|age:2dpf\|biomaterial provider:Julie Theriot Stanford University\|sex:not collected\|tissue:keratocytes skin\|cell type:keratocyte\|dev stage:2dpf\|BioSampleModel:Model organism or animal									2dpf keratocytes replicate 1	2dpf 1	2dpf 1	RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.			RNA-Seq	TRANSCRIPTOMIC	PolyA	SINGLE	ILLUMINA	Illumina Genome Analyzer IIx	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>40</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP045504	lane6_2dpf.fastq	fastq	647944118.0	17051161.0	2dpf 1	0:38	A:145735255;C:167786338;G:186677806;T:141598169;N:6146550	38		145735255	167786338	186677806	141598169	6146550	SRX681402	SRS685079	SRA179323	Stanford University\|Julie Theriot	Stanford University	1	0.7695		0.15816		0.81491		0.44972		38		B		usable mapping rate	illumina	early_illumina	unknown	poly_a	trueseq	bulk	unknown	unknown	United States	2014-08-14	Hatching	Embryo	Skin	Surface Structure
52812	52812	SRR9211490	SRX5982381	SRS4887886	SRP200656	PRJNA547573	Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos	GSE132304	Transcriptome Analysis	We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.	pubmed:31431477		52 hpf nonskin2 only replicate	GSM3855898	source name:FACS isolated nonskin cells from whole embryos\|strain:AB+TU\|developmental stage:52 hpf\|tissue:FACS nonskin2\|Sex:pooled male and female\|biomaterial provider:Fang Wang CSUDH\|birth location:UCLA\|genotype:krt4:DsRed;krt5:GFP	52 hpf nonskin2 only replicate	Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.	FACS isolated nonskin cells from whole embryos	Transgenic embryos without xxx treatment	Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.	Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.	strain:AB+TU\|developmental stage:52 hpf\|tissue:FACS nonskin2\|Sex:pooled male and female\|biomaterial provider:Fang Wang CSUDH\|birth location:UCLA\|genotype:krt4:DsRed;krt5:GFP	GSM3855898	GSM3855898: 52 hpf nonskin2 only replicate; Danio rerio; RNA Seq	GSM3855898		1	Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.	GEO Accession:GSM3855898	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP200656	ZFishSkin_Reads_c09_52hpf-nonskin2_once_i12.CTTGTAA.pf1_VA061L6.fastq.gz	fastq	1497326340.0	29359340.0	GSM3855898 r1	0:51	A:395115715;C:356520233;G:354572362;T:391098396;N:19634	51		395115715	356520233	354572362	391098396	19634	SRX5982381	SRS4887886	SRA894819	GEO	UCLA	1	0.93658		0.08376		0.70201		0.47789		51		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United States	2019-06-06	Hatching	Embryo	Skin	Surface Structure
52813	52813	SRR9211489	SRX5982380	SRS4887885	SRP200656	PRJNA547573	Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos	GSE132304	Transcriptome Analysis	We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.	pubmed:31431477		52 hpf all skin replicate B	GSM3855897	source name:FACS isolated all skin cells from whole embryos\|strain:AB+TU\|developmental stage:52 hpf\|tissue:FACS all skin\|Sex:pooled male and female\|biomaterial provider:Fang Wang CSUDH\|birth location:UCLA\|genotype:krt4:DsRed	52 hpf all skin replicate B	Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.	FACS isolated all skin cells from whole embryos	Transgenic embryos without xxx treatment	Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.	Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.	strain:AB+TU\|developmental stage:52 hpf\|tissue:FACS all skin\|Sex:pooled male and female\|biomaterial provider:Fang Wang CSUDH\|birth location:UCLA\|genotype:krt4:DsRed	GSM3855897	GSM3855897: 52 hpf all skin replicate B; Danio rerio; RNA Seq	GSM3855897		1	Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.	GEO Accession:GSM3855897	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500		SRP200656	ZFishSkin_Reads_c08_52hpf-allSkin-_repB_i03.TTAGGCA.pf1_XB039L2.fastq.gz	fastq	1519404450.0	30388089.0	GSM3855897 r1	0:50	A:387412457;C:374238433;G:369512809;T:388217220;N:23531	50		387412457	374238433	369512809	388217220	23531	SRX5982380	SRS4887885	SRA894819	GEO	UCLA	1	0.93866		0.05037		0.76437		0.37263		50		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United States	2019-06-06	Hatching	Embryo	Skin	Surface Structure
52814	52814	SRR9211488	SRX5982379	SRS4887884	SRP200656	PRJNA547573	Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos	GSE132304	Transcriptome Analysis	We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.	pubmed:31431477		52 hpf all skin replicate A	GSM3855896	source name:FACS isolated all skin cells from whole embryos\|strain:AB+TU\|developmental stage:52 hpf\|tissue:FACS all skin\|Sex:pooled male and female\|biomaterial provider:Fang Wang CSUDH\|birth location:UCLA\|genotype:krt4:DsRed	52 hpf all skin replicate A	Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.	FACS isolated all skin cells from whole embryos	Transgenic embryos without xxx treatment	Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.	Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.	strain:AB+TU\|developmental stage:52 hpf\|tissue:FACS all skin\|Sex:pooled male and female\|biomaterial provider:Fang Wang CSUDH\|birth location:UCLA\|genotype:krt4:DsRed	GSM3855896	GSM3855896: 52 hpf all skin replicate A; Danio rerio; RNA Seq	GSM3855896		1	Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.	GEO Accession:GSM3855896	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500		SRP200656	ZFishSkin_Reads_c07_52hpf-allSkin-_repA_i05.ACAGTGA.pf1_XA025L6plusXB039L2.fastq.gz	fastq	1419182550.0	28383651.0	GSM3855896 r1	0:50	A:352916142;C:345678567;G:351315754;T:364989027;N:4283060	50		352916142	345678567	351315754	364989027	4283060	SRX5982379	SRS4887884	SRA894819	GEO	UCLA	1	0.92139		0.06056		0.76763		0.39214		50		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United States	2019-06-06	Hatching	Embryo	Skin	Surface Structure
52815	52815	SRR9211487	SRX5982378	SRS4887883	SRP200656	PRJNA547573	Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos	GSE132304	Transcriptome Analysis	We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.	pubmed:31431477		52 hpf nonskin1 replicate B	GSM3855895	source name:FACS isolated nonskin cells from whole embryos\|strain:AB+TU\|developmental stage:52 hpf\|tissue:FACS nonskin1\|Sex:pooled male and female\|biomaterial provider:Fang Wang CSUDH\|birth location:UCLA\|genotype:krt4:DsRed	52 hpf nonskin1 replicate B	Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.	FACS isolated nonskin cells from whole embryos	Transgenic embryos without xxx treatment	Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.	Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.	strain:AB+TU\|developmental stage:52 hpf\|tissue:FACS nonskin1\|Sex:pooled male and female\|biomaterial provider:Fang Wang CSUDH\|birth location:UCLA\|genotype:krt4:DsRed	GSM3855895	GSM3855895: 52 hpf nonskin1 replicate B; Danio rerio; RNA Seq	GSM3855895		1	Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.	GEO Accession:GSM3855895	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500		SRP200656	ZFishSkin_Reads_c06_52hpf-nonskin1_repB_i01.ATCACGA.pf1_XB039L2.fastq.gz	fastq	2006001000.0	40120020.0	GSM3855895 r1	0:50	A:519738512;C:486660134;G:481964980;T:517604839;N:32535	50		519738512	486660134	481964980	517604839	32535	SRX5982378	SRS4887883	SRA894819	GEO	UCLA	1	0.9459		0.07046		0.68389		0.48047		50		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United States	2019-06-06	Hatching	Embryo	Skin	Surface Structure
52816	52816	SRR9211486	SRX5982377	SRS4887882	SRP200656	PRJNA547573	Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos	GSE132304	Transcriptome Analysis	We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.	pubmed:31431477		52 hpf nonskin1 replicate A	GSM3855894	source name:FACS isolated nonskin cells from whole embryos\|strain:AB+TU\|developmental stage:52 hpf\|tissue:FACS nonskin1\|Sex:pooled male and female\|biomaterial provider:Fang Wang CSUDH\|birth location:UCLA\|genotype:krt4:DsRed	52 hpf nonskin1 replicate A	Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.	FACS isolated nonskin cells from whole embryos	Transgenic embryos without xxx treatment	Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.	Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.	strain:AB+TU\|developmental stage:52 hpf\|tissue:FACS nonskin1\|Sex:pooled male and female\|biomaterial provider:Fang Wang CSUDH\|birth location:UCLA\|genotype:krt4:DsRed	GSM3855894	GSM3855894: 52 hpf nonskin1 replicate A; Danio rerio; RNA Seq	GSM3855894		1	Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.	GEO Accession:GSM3855894	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500		SRP200656	ZFishSkin_Reads_c05_52hpf-nonskin1_repA_i06.GCCAATA.pf1_XA025L6plusXB039L2.fastq.gz	fastq	1349409700.0	26988194.0	GSM3855894 r1	0:50	A:342685736;C:323811588;G:328073629;T:350810627;N:4028120	50		342685736	323811588	328073629	350810627	4028120	SRX5982377	SRS4887882	SRA894819	GEO	UCLA	1	0.92593		0.09166		0.70532		0.47167		50		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown	United States	2019-06-06	Hatching	Embryo	Skin	Surface Structure
71777	71777	SRR22094621	SRX18074628	SRS15579663	SRP405171	PRJNA893397	RNA sequencing of the zebrafish superficial epithelial cells	PRJNA893397	Other	We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it "asynthetic fission". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.		replicate	SEC 2dpf r	SEC 2dpf r	strain:EK\|age:2dpf\|dev stage:2dpf\|sex:NA\|tissue:skin superficial epithelial cell\|BioSampleModel:Model organism or animal									RNA sequencing of zebrafish:superficial epithelial cells 2dpf replicate	LTS21 YW01	LTS21 YW01	100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.			RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	PAIRED	ILLUMINA	NextSeq 2000		SRP405171	LTS21_YW01_S3_L001_R1_001.fastq.gz LTS21_YW01_S3_L001_R2_001.fastq.gz	fastq fastq	19999530824.0	66223612.0	LTS21 YW01 S3 L001 R1 001.fastq.gz	0:151 1:151	A:5239226851;C:4832853944;G:4579224440;T:5331222900;N:17002689	151	151	5239226851	4832853944	4579224440	5331222900	17002689	SRX18074628	SRS15579663	SRA1530145	Academia Sinica\|Institute of Cellular and Organismic Biology	Academia Sinica	2	0.77399	0.76874	0.04763	0.04655	0.75035	0.75087	0.423	0.42383	151	151	B	B	biological fallback assumption	illumina	nextseq_v2	unknown	poly_a	unknown	bulk	unknown	unknown	Taiwan	2022-10-29	Hatching	Embryo	Skin	Surface Structure
71778	71778	SRR22094622	SRX18074627	SRS15579662	SRP405171	PRJNA893397	RNA sequencing of the zebrafish superficial epithelial cells	PRJNA893397	Other	We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it "asynthetic fission". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.			SEC 2dpf	Zebrafish SEC 2dpf	strain:EK\|age:2dpf\|dev stage:2dpf\|sex:NA\|tissue:Skin\|BioSampleModel:Model organism or animal									RNA sequencing of zebrafish:superficial epithelial cells 2dpf	LTS21 YG01	LTS21 YG01	100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.			RNA-Seq	TRANSCRIPTOMIC	Oligo-dT	PAIRED	ILLUMINA	NextSeq 2000		SRP405171	LTS21_YG01_S1_L001_R1_001.fastq.gz LTS21_YG01_S1_L001_R2_001.fastq.gz	fastq fastq	18171646530.0	60171015.0	LTS21 YG01 S1 L001 R1 001.fastq.gz	0:151 1:151	A:4727063040;C:4426085600;G:4200458773;T:4802148545;N:15890572	151	151	4727063040	4426085600	4200458773	4802148545	15890572	SRX18074627	SRS15579662	SRA1530145	Academia Sinica\|Institute of Cellular and Organismic Biology	Academia Sinica	2	0.76303	0.75602	0.03268	0.03163	0.78427	0.78484	0.3601	0.35972	151	151	B	B	biological fallback assumption	illumina	nextseq_v2	unknown	poly_a	unknown	bulk	unknown	unknown	Taiwan	2022-10-29	Hatching	Embryo	Skin	Surface Structure

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;