run_metadata
141 rows where devstage_curation = "Hatching" and tissue_curation = "Heart"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 26483 | 26483 | SRR25930975 | SRX21649988 | SRS18818460 | SRP458853 | PRJNA1013567 | scRNA seq of 50 hpf and 80 hpf isolated zebrafish hearts | GSE242483 | Transcriptome Analysis | Seeking to identify additional transcription factors required for cardiac valve formation we determined and explored the transcriptional landscape of endocardial cells at the time when key morphogenetic events underlying valve development take place. Overall design: We isolated wild type zebrafish hearts at 50 hpf when valve identity has just been established and at 80 hpf when forming valves are first observed | pubmed:38748804 | 50hpf | GSM7764481 | source name:heart|tissue:heart|genotype:wild type|age:50hpf|geo loc name:missing|collection date:missing | 50hpf | Reads were aligned against the zebrafish genome and counted by StarSolo. Preprocessed counts were further analysed using Scanpy. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed cells that did not express more than 300 genes or had a mitochondrial content greater than 8%. Furthermore we filtered genes if they were detected in less than 30 cells. Raw counts per cell were normalised to the median count over all cells and transformed into log space to stabilise variance. We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding and cell clustering were based on the initial PCA. Final data visualization was done by scanpy and cellxgene packages. Assembly: DanRer11 Supplementary files format and content: starsolo outputs | heart | Whole hearts were isolated and cardiac cells were dissociated. Dead cells were removed from the final cell isolate by FACs sorting in PBS without xxx and Magnesium and with 0.04% BSA. Each sample was run separately on a lane in a Chromium controller with Chromium Next GEM Single Cell 3ʹ Reagent Kits v3 1 10xGenomics. scRNA seq library preparation was done using a standard protocol and sequencing was done on a Nextseq2000 | tissue:heart|genotype:wild type|age:50hpf | GSM7764481 | GSM7764481: 50hpf; Danio rerio; RNA Seq | GSM7764481 r1 | GSM7764481 | 1 | Whole hearts were isolated and cardiac cells were dissociated. Dead cells were removed from the final cell isolate by FACs sorting in PBS without xxx and Magnesium and with 0.04% BSA. Each sample was run separately on a lane in a Chromium controller with Chromium Next GEM Single Cell 3ʹ Reagent Kits v3 1 10xGenomics. scRNA seq library preparation was done using a standard protocol and sequencing was done on a Nextseq2000 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 2000 | SRP458853 | Giulia_50hpf_S1_R2_001.fastq.gz Giulia_50hpf_S1_R1_001.fastq.gz | fastq fastq | 19874763820.0 | 237988724.0 | GSM7764481 r1 | 0:28 1:55.51 | A:5320257914;C:4424267230;G:4320623789;T:5708249185;N:101365702 | 28 | 55 | 5320257914 | 4424267230 | 4320623789 | 5708249185 | 101365702 | SRX21649988 | SRS18818460 | SRA1706674 | Bioinformatics, Max-Planck-Institute for Heart and Lung Research | Bioinformatics, Max-Planck-Institute for Heart and Lung Research | 2 | 0.00185 | 0.94414 | 0.00087 | 0.13397 | 0.99675 | 0.80172 | 0.41142 | 0.51985 | 28 | 56 | T | B | sc-like readlen | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | Germany | 2023-09-06 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||
| 29089 | 29089 | SRR27015253 | SRX22707797 | SRS19700098 | SRP475323 | PRJNA1047551 | Identification of genes important during atrial myocardial morphogenesis | GSE249149 | Transcriptome Analysis | Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes. | pubmed:39289341 | Wild type zebrafish atrial cardiomyocytes 48 hpf rep 3 | GSM7927518 | source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf loc name:missing|collection date:missing | Wild type zebrafish atrial cardiomyocytes 48 hpf rep 3 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix | embryonic heart | miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio. | tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf | GSM7927518 | GSM7927518: Wild type zebrafish atrial cardiomyocytes 48 hpf rep 3; Danio rerio; RNA Seq | GSM7927518 r1 | GSM7927518 | 1 | miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP475323 | loader:fastq load.py | dst226_zbrf_clt___ACrdmct-age___48h_b03_t01_m01_R1.fastq.gz | fastq | 2161847345.0 | 35921817.0 | GSM7927518 r1 | 0:60.18 | A:505467877;C:418329045;G:416403136;T:483063599;N:338583688 | 60 | 505467877 | 418329045 | 416403136 | 483063599 | 338583688 | SRX22707797 | SRS19700098 | SRA1761360 | MPI for heart and lung research | MPI for heart and lung research | 1 | 0.89532 | 0.08355 | 0.82012 | 0.68413 | 35 | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Germany | 2023-12-01 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 29090 | 29090 | SRR27015254 | SRX22707796 | SRS19700097 | SRP475323 | PRJNA1047551 | Identification of genes important during atrial myocardial morphogenesis | GSE249149 | Transcriptome Analysis | Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes. | pubmed:39289341 | Wild type zebrafish atrial cardiomyocytes 48 hpf rep 2 | GSM7927517 | source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf loc name:missing|collection date:missing | Wild type zebrafish atrial cardiomyocytes 48 hpf rep 2 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix | embryonic heart | miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio. | tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf | GSM7927517 | GSM7927517: Wild type zebrafish atrial cardiomyocytes 48 hpf rep 2; Danio rerio; RNA Seq | GSM7927517 r1 | GSM7927517 | 1 | miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP475323 | loader:fastq load.py | dst226_zbrf_clt___ACrdmct-age___48h_b02_t01_m01_R1.fastq.gz | fastq | 2065547064.0 | 31863833.0 | GSM7927517 r1 | 0:64.82 | A:530497695;C:434164388;G:434118538;T:518043928;N:148722515 | 64 | 530497695 | 434164388 | 434118538 | 518043928 | 148722515 | SRX22707796 | SRS19700097 | SRA1761360 | MPI for heart and lung research | MPI for heart and lung research | 1 | 0.91772 | 0.17863 | 0.76828 | 0.49567 | 72 | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Germany | 2023-12-01 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 29091 | 29091 | SRR27015255 | SRX22707795 | SRS19700096 | SRP475323 | PRJNA1047551 | Identification of genes important during atrial myocardial morphogenesis | GSE249149 | Transcriptome Analysis | Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes. | pubmed:39289341 | Wild type zebrafish atrial cardiomyocytes 48 hpf rep 1 | GSM7927516 | source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf loc name:missing|collection date:missing | Wild type zebrafish atrial cardiomyocytes 48 hpf rep 1 | Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix | embryonic heart | miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio. | tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf | GSM7927516 | GSM7927516: Wild type zebrafish atrial cardiomyocytes 48 hpf rep 1; Danio rerio; RNA Seq | GSM7927516 r1 | GSM7927516 | 1 | miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP475323 | loader:fastq load.py | dst226_zbrf_clt___ACrdmct-age___48h_b01_t01_m01_R1.fastq.gz | fastq | 1619268089.0 | 24941754.0 | GSM7927516 r1 | 0:64.92 | A:410578311;C:344485123;G:343852178;T:401558739;N:118793738 | 64 | 410578311 | 344485123 | 343852178 | 401558739 | 118793738 | SRX22707795 | SRS19700096 | SRA1761360 | MPI for heart and lung research | MPI for heart and lung research | 1 | 0.91693 | 0.13175 | 0.77082 | 0.47511 | 72 | B | usable mapping rate | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Germany | 2023-12-01 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 32609 | 32609 | SRR29325925 | SRX24842084 | SRS21553259 | SRP512516 | PRJNA1121299 | Gene expression profile of single endocardial cells in 48 hpf and 72 hpf zebrafish embryos/larvae. In the study "The heart is a niche for hematopoietic stem and progenitor cells in zebrafish." | GSE269378 | Transcriptome Analysis | We used single cell RNA expression to uncover the cellular and molecular heterogeneity of isolated endocardial cells in the heart. From this study we uncovered the presence of an endocardial hematopoietic cluster along with other significant clusters including valve endocardial and interstitial cells and non valve cells. Overall design: Endocardial cells were isolated using FACS from physically extracted Tgkdrl:nls mCherry and Tgcd41:GFP hearts according to presence of mCherry positive cells and further analyzed using scRNAseq. | pubmed:39217144 | EC 2d | GSM8314110 | source name:Heart|tissue:Heart|cell type:Endocardial cells|genotype:Tgkdrl:nls mCherry; Tgcd41:GFP|developmental stage:48 hpf loc name:missing|collection date:missing | EC 2d | Sequencing was done on Nextseq2000 and raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Preprocessed counts were further analysed using Scanpy ollowed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 5 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 5%. Furthermore we filtered 24259 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance. We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection were based on the initial PCA. Final data visualization was done by scanpy and cellxgene packages. Assembly: danRer11 Supplementary files format and content: starsolo outputs | Heart | Embryos were raised in a solution composed of 0.33 Danieau's medium containing the following concentrations: 17.4 mM NaCl 0.21 mM KCl 0.12 mM MgSO4·H2O and 0.18 mM CaNO32 while being maintained at a stable temperature of 28°C. To isolate EdCs for the single cell RNA sequencing experiment hearts from 48 and 72 hpf Tgkdrl:nls mCherry; Tgcd41:GFP larvae were manually dissected in DMEM + 10% FBS. Hearts were then centrifuged for 60 seconds at 3000 rpm washed with 1 mL Hanks’ Balanced Salt Solution and dissociated into single cells by incubating in 100 μl Enzyme 1 and 5 μl Enzyme 2 Pierce Cardiomyocyte Dissociation Kit Thermo Fisher Scientific Cat#88281 for 20 minutes at 300 rpm in a 30°C shaker 79. The samples were centrifuged for 5 minutes at 3000 rpm the supernatant was discarded and fresh medium was added to the dissociated cells and passed through 40 μM filter polystyrene 5ml tubes. Negative controls of non fluorescent hearts or single color fluorescent hearts were prepared to define the sorting gates. Cells were sorted using the BD FACSAria™ III BD Biosciences instrument. Live cells were selected by exclusion of DAPI using 30mW 405nm excitation paired with 450/50 nm band pass filter. The software used for sorting and analysis is BD FACSDiva v8.0.1. Single positive Tgkdrl:nls mCherry+ cells and double positive Tgkdrl:nls mCherry+; Tgcd41:GFP+ cells were sorted and collected into tubes with DMEM + 10% FBS. Cells from both collected samples were immediately combined and processed for the single cell RNA sequencing. mCherry fluorescence was measured with 50mW 561nm excitation paired with 610/20nm band pass filter. GFP fluorescence was measured with 50mW 488nm excitation paired with 530/30 band pass filter. The cell suspensions were counted with Moxi cell counter and diluted according to manufacturer’s protocol to obtain 4.000 2d HC and 8.000 3d 10.497 EC 1.569 HC single cell data points per sample respectively. Each sample was run separately on a lane in Chromium controller with Chromium Ne… | Embryos/larvae were grown in 28 degree incubator until extraction at 48 or 72 hpf | tissue:Heart|cell type:Endocardial cells|genotype:Tgkdrl:nls mCherry; Tgcd41:GFP|developmental stage:48 hpf | GSM8314110 | GSM8314110: EC 2d; Danio rerio; RNA Seq | GSM8314110 r1 | GSM8314110 | 1 | Embryos were raised in a solution composed of 0.33 Danieau's medium containing the following concentrations: 17.4 mM NaCl 0.21 mM KCl 0.12 mM MgSO4·H2O and 0.18 mM CaNO32 while being maintained at a stable temperature of 28°C. To isolate EdCs for the single cell RNA sequencing experiment hearts from 48 and 72 hpf Tgkdrl:nls mCherry; Tgcd41:GFP larvae were manually dissected in DMEM + 10% FBS. Hearts were then centrifuged for 60 seconds at 3000 rpm washed with 1 mL Hanks' Balanced Salt Solution and dissociated into single cells by incubating in 100 μl Enzyme 1 and 5 μl Enzyme 2 Pierce Cardiomyocyte Dissociation Kit Thermo Fisher Scientific Cat#88281 for 20 minutes at 300 rpm in a 30°C shaker 79. The samples were centrifuged for 5 minutes at 3000 rpm the supernatant was discarded and fresh medium was added to the dissociated cells and passed through 40 μM filter polystyrene 5ml tubes. Negative controls of non fluorescent hearts or single color fluorescent hearts were prepared to define the sorting gates. Cells were sorted using the BD FACSAria™ III BD Biosciences instrument. Live cells were selected by exclusion of DAPI using 30mW 405nm excitation paired with 450/50 nm band pass filter. The software used for sorting and analysis is BD FACSDiva v8.0.1. Single positive Tgkdrl:nls mCherry+ cells and double positive Tgkdrl:nls mCherry+; Tgcd41:GFP+ cells were sorted and collected into tubes with DMEM + 10% FBS. Cells from both collected samples were immediately combined and processed for the single cell RNA sequencing. mCherry fluorescence was measured with 50mW 561nm excitation paired with 610/20nm band pass filter. GFP fluorescence was measured with 50mW 488nm excitation paired with 530/30 band pass filter. The cell suspensions were counted with Moxi cell counter and diluted according to manufacturer's protocol to obtain 4.000 2d HC and 8.000 3d 10.497 EC 1.569 HC single cell data points per sample respectively. Each sample was run separately on a lane in Chromium controller with Chromium Ne… | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 2000 | SRP512516 | Felix_10x_Lib_EC-2d_R1.fastq.gz Felix_10x_Lib_EC-2d_R2.fastq.gz | fastq fastq | 37849382027.0 | 476135961.0 | GSM8314110 r1 | 0:28 1:51.49 | A:10212120425;C:8162504214;G:8573129268;T:10704929378;N:196698742 | 28 | 51 | 10212120425 | 8162504214 | 8573129268 | 10704929378 | 196698742 | SRX24842084 | SRS21553259 | SRA1892449 | MPI for heart and lung research | MPI for heart and lung research | T | B | mate1 technical by mapping diff | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | Germany | 2024-06-07 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33805 | 33805 | SRR30670312 | SRX26088984 | SRS22655387 | SRP532815 | PRJNA1161406 | Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations | GSE277234 | Transcriptome Analysis | Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi… | pubmed:39402138 | DKOwBF 4 | GSM8516797 | source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing | DKOwBF 4 | base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample | heart | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | 2 dpf zebrafish embryo | tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62 | GSM8516797 | GSM8516797: DKOwBF 4; Danio rerio; RNA Seq | GSM8516797 r1 | GSM8516797 | 1 | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 550 | SRP532815 | DKOwBF_4_R1_val_1.fq.gz DKOwBF_4_R2_val_2.fq.gz | fastq fastq | 2631656843.0 | 35135298.0 | GSM8516797 r1 | 0:37.47 1:37.43 | A:693207862;C:610024232;G:611701090;T:716593105;N:130554 | 37 | 37 | 693207862 | 610024232 | 611701090 | 716593105 | 130554 | SRX26088984 | SRS22655387 | SRA1972600 | University of Potsdam | University of Potsdam | B | B | biological fallback assumption | illumina | nextseq | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2024-09-15 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33806 | 33806 | SRR30670313 | SRX26088983 | SRS22655386 | SRP532815 | PRJNA1161406 | Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations | GSE277234 | Transcriptome Analysis | Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi… | pubmed:39402138 | DKOwBF 3 | GSM8516796 | source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing | DKOwBF 3 | base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample | heart | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | 2 dpf zebrafish embryo | tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62 | GSM8516796 | GSM8516796: DKOwBF 3; Danio rerio; RNA Seq | GSM8516796 r1 | GSM8516796 | 1 | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 550 | SRP532815 | DKOwBF_3_R1_val_1.fq.gz DKOwBF_3_R2_val_2.fq.gz | fastq fastq | 2307127989.0 | 30809808.0 | GSM8516796 r1 | 0:37.48 1:37.40 | A:604817176;C:534788281;G:546273175;T:621136766;N:112591 | 37 | 37 | 604817176 | 534788281 | 546273175 | 621136766 | 112591 | SRX26088983 | SRS22655386 | SRA1972600 | University of Potsdam | University of Potsdam | B | B | biological fallback assumption | illumina | nextseq | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2024-09-15 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33807 | 33807 | SRR30670314 | SRX26088982 | SRS22655385 | SRP532815 | PRJNA1161406 | Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations | GSE277234 | Transcriptome Analysis | Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi… | pubmed:39402138 | DKOwBF 2 | GSM8516795 | source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing | DKOwBF 2 | base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample | heart | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | 2 dpf zebrafish embryo | tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62 | GSM8516795 | GSM8516795: DKOwBF 2; Danio rerio; RNA Seq | GSM8516795 r1 | GSM8516795 | 1 | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 550 | SRP532815 | DKOwBF_2_R1_val_1.fq.gz DKOwBF_2_R2_val_2.fq.gz | fastq fastq | 2359951661.0 | 31500054.0 | GSM8516795 r1 | 0:37.48 1:37.44 | A:616053500;C:552042916;G:552098980;T:639639620;N:116645 | 37 | 37 | 616053500 | 552042916 | 552098980 | 639639620 | 116645 | SRX26088982 | SRS22655385 | SRA1972600 | University of Potsdam | University of Potsdam | B | B | biological fallback assumption | illumina | nextseq | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2024-09-15 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33808 | 33808 | SRR30670315 | SRX26088981 | SRS22655384 | SRP532815 | PRJNA1161406 | Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations | GSE277234 | Transcriptome Analysis | Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi… | pubmed:39402138 | DKOwBF 1 | GSM8516794 | source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing | DKOwBF 1 | base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample | heart | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | 2 dpf zebrafish embryo | tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62 | GSM8516794 | GSM8516794: DKOwBF 1; Danio rerio; RNA Seq | GSM8516794 r1 | GSM8516794 | 1 | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 550 | SRP532815 | DKOwBF_1_R1_val_1.fq.gz DKOwBF_1_R2_val_2.fq.gz | fastq fastq | 2279765098.0 | 30432486.0 | GSM8516794 r1 | 0:37.48 1:37.43 | A:593961620;C:534035377;G:534433858;T:617220513;N:113730 | 37 | 37 | 593961620 | 534035377 | 534433858 | 617220513 | 113730 | SRX26088981 | SRS22655384 | SRA1972600 | University of Potsdam | University of Potsdam | B | B | biological fallback assumption | illumina | nextseq | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2024-09-15 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33809 | 33809 | SRR30670316 | SRX26088980 | SRS22655383 | SRP532815 | PRJNA1161406 | Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations | GSE277234 | Transcriptome Analysis | Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi… | pubmed:39402138 | ccm2 4 | GSM8516793 | source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing | ccm2 4 | base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample | heart | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | 2 dpf zebrafish embryo | tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201 | GSM8516793 | GSM8516793: ccm2 4; Danio rerio; RNA Seq | GSM8516793 r1 | GSM8516793 | 1 | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 550 | SRP532815 | ccm2_4_R1_val_1.fq.gz ccm2_4_R2_val_2.fq.gz | fastq fastq | 1774723235.0 | 23698743.0 | GSM8516793 r1 | 0:37.48 1:37.40 | A:458133535;C:421770768;G:424339889;T:470391262;N:87781 | 37 | 37 | 458133535 | 421770768 | 424339889 | 470391262 | 87781 | SRX26088980 | SRS22655383 | SRA1972600 | University of Potsdam | University of Potsdam | B | B | biological fallback assumption | illumina | nextseq | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2024-09-15 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33810 | 33810 | SRR30670317 | SRX26088979 | SRS22655382 | SRP532815 | PRJNA1161406 | Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations | GSE277234 | Transcriptome Analysis | Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi… | pubmed:39402138 | ccm2 3 | GSM8516792 | source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing | ccm2 3 | base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample | heart | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | 2 dpf zebrafish embryo | tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201 | GSM8516792 | GSM8516792: ccm2 3; Danio rerio; RNA Seq | GSM8516792 r1 | GSM8516792 | 1 | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 550 | SRP532815 | ccm2_3_R1_val_1.fq.gz ccm2_3_R2_val_2.fq.gz | fastq fastq | 2785670574.0 | 37207625.0 | GSM8516792 r1 | 0:37.47 1:37.39 | A:733595813;C:647190941;G:651896211;T:752851756;N:135853 | 37 | 37 | 733595813 | 647190941 | 651896211 | 752851756 | 135853 | SRX26088979 | SRS22655382 | SRA1972600 | University of Potsdam | University of Potsdam | B | B | biological fallback assumption | illumina | nextseq | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2024-09-15 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33811 | 33811 | SRR30670318 | SRX26088978 | SRS22655381 | SRP532815 | PRJNA1161406 | Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations | GSE277234 | Transcriptome Analysis | Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi… | pubmed:39402138 | ccm2 2 | GSM8516791 | source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing | ccm2 2 | base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample | heart | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | 2 dpf zebrafish embryo | tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201 | GSM8516791 | GSM8516791: ccm2 2; Danio rerio; RNA Seq | GSM8516791 r1 | GSM8516791 | 1 | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 550 | SRP532815 | ccm2_2_R1_val_1.fq.gz ccm2_2_R2_val_2.fq.gz | fastq fastq | 1710862794.0 | 22847832.0 | GSM8516791 r1 | 0:37.48 1:37.40 | A:451866074;C:396308875;G:397143039;T:465461428;N:83378 | 37 | 37 | 451866074 | 396308875 | 397143039 | 465461428 | 83378 | SRX26088978 | SRS22655381 | SRA1972600 | University of Potsdam | University of Potsdam | B | B | biological fallback assumption | illumina | nextseq | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2024-09-15 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33812 | 33812 | SRR30670319 | SRX26088977 | SRS22655380 | SRP532815 | PRJNA1161406 | Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations | GSE277234 | Transcriptome Analysis | Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi… | pubmed:39402138 | ccm2 1 | GSM8516790 | source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing | ccm2 1 | base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample | heart | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | 2 dpf zebrafish embryo | tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201 | GSM8516790 | GSM8516790: ccm2 1; Danio rerio; RNA Seq | GSM8516790 r1 | GSM8516790 | 1 | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 550 | SRP532815 | ccm2_1_R1_val_1.fq.gz ccm2_1_R2_val_2.fq.gz | fastq fastq | 2152186897.0 | 28739460.0 | GSM8516790 r1 | 0:37.48 1:37.40 | A:565328171;C:501524678;G:502042276;T:583186005;N:105767 | 37 | 37 | 565328171 | 501524678 | 502042276 | 583186005 | 105767 | SRX26088977 | SRS22655380 | SRA1972600 | University of Potsdam | University of Potsdam | B | B | biological fallback assumption | illumina | nextseq | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2024-09-15 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33813 | 33813 | SRR30670320 | SRX26088976 | SRS22655379 | SRP532815 | PRJNA1161406 | Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations | GSE277234 | Transcriptome Analysis | Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi… | pubmed:39402138 | wt 4 | GSM8516789 | source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing | wt 4 | base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample | heart | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | 2 dpf zebrafish embryo | tissue:heart|cell type:enriched endothelial cells|genotype:wild type | GSM8516789 | GSM8516789: wt 4; Danio rerio; RNA Seq | GSM8516789 r1 | GSM8516789 | 1 | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 550 | SRP532815 | wt_4_R1_val_1.fq.gz wt_4_R2_val_2.fq.gz | fastq fastq | 2115730283.0 | 28251845.0 | GSM8516789 r1 | 0:37.48 1:37.40 | A:554039480;C:497170515;G:497588268;T:566828365;N:103655 | 37 | 37 | 554039480 | 497170515 | 497588268 | 566828365 | 103655 | SRX26088976 | SRS22655379 | SRA1972600 | University of Potsdam | University of Potsdam | B | B | biological fallback assumption | illumina | nextseq | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2024-09-15 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33814 | 33814 | SRR30670321 | SRX26088975 | SRS22655378 | SRP532815 | PRJNA1161406 | Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations | GSE277234 | Transcriptome Analysis | Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi… | pubmed:39402138 | wt 3 | GSM8516788 | source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing | wt 3 | base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample | heart | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | 2 dpf zebrafish embryo | tissue:heart|cell type:enriched endothelial cells|genotype:wild type | GSM8516788 | GSM8516788: wt 3; Danio rerio; RNA Seq | GSM8516788 r1 | GSM8516788 | 1 | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 550 | SRP532815 | wt_3_R1_val_1.fq.gz wt_3_R2_val_2.fq.gz | fastq fastq | 1222858943.0 | 16325477.0 | GSM8516788 r1 | 0:37.47 1:37.44 | A:319777234;C:285362000;G:288524099;T:329135216;N:60394 | 37 | 37 | 319777234 | 285362000 | 288524099 | 329135216 | 60394 | SRX26088975 | SRS22655378 | SRA1972600 | University of Potsdam | University of Potsdam | B | B | biological fallback assumption | illumina | nextseq | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2024-09-15 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33815 | 33815 | SRR30670322 | SRX26088974 | SRS22655377 | SRP532815 | PRJNA1161406 | Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations | GSE277234 | Transcriptome Analysis | Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi… | pubmed:39402138 | wt 2 | GSM8516787 | source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing | wt 2 | base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample | heart | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | 2 dpf zebrafish embryo | tissue:heart|cell type:enriched endothelial cells|genotype:wild type | GSM8516787 | GSM8516787: wt 2; Danio rerio; RNA Seq | GSM8516787 r1 | GSM8516787 | 1 | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 550 | SRP532815 | wt_2_R1_val_1.fq.gz wt_2_R2_val_2.fq.gz | fastq fastq | 2264925518.0 | 30237170.0 | GSM8516787 r1 | 0:37.48 1:37.43 | A:593545435;C:529227225;G:529813966;T:612227538;N:111354 | 37 | 37 | 593545435 | 529227225 | 529813966 | 612227538 | 111354 | SRX26088974 | SRS22655377 | SRA1972600 | University of Potsdam | University of Potsdam | B | B | biological fallback assumption | illumina | nextseq | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2024-09-15 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||
| 33816 | 33816 | SRR30670323 | SRX26088973 | SRS22655376 | SRP532815 | PRJNA1161406 | Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations | GSE277234 | Transcriptome Analysis | Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit wi… | pubmed:39402138 | wt 1 | GSM8516786 | source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing | wt 1 | base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample | heart | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | 2 dpf zebrafish embryo | tissue:heart|cell type:enriched endothelial cells|genotype:wild type | GSM8516786 | GSM8516786: wt 1; Danio rerio; RNA Seq | GSM8516786 r1 | GSM8516786 | 1 | RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 550 | SRP532815 | wt_1_R1_val_1.fq.gz wt_1_R2_val_2.fq.gz | fastq fastq | 2171991020.0 | 29008519.0 | GSM8516786 r1 | 0:37.49 1:37.39 | A:564449762;C:511917485;G:512535386;T:582980181;N:108206 | 37 | 37 | 564449762 | 511917485 | 512535386 | 582980181 | 108206 | SRX26088973 | SRS22655376 | SRA1972600 | University of Potsdam | University of Potsdam | B | B | biological fallback assumption | illumina | nextseq | full_length | random_priming | nebnext | bulk | unknown | unknown | Germany | 2024-09-15 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||
| 37255 | 37255 | SRR1043688 | SRX387598 | SRS511498 | SRP033532 | PRJNA230686 | Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae | GSE53022 | Transcriptome Analysis | We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant. | pubmed:24430697 | kctd10 mut zebrafish heart | GSM1280516 | source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:kctd10 / kctd10 mutant|tissue:heart | kctd10 mut zebrafish heart | sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant. | heart | Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol | strain background:AB|development stage:48 hpf|genotype/variation:kctd10 / kctd10 mutant|tissue:heart | GSM1280516 | GSM1280516: kctd10 mut zebrafish heart; Danio rerio; RNA Seq | GSM1280516 | 1 | Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol | GEO Accession:GSM1280516 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033532 | s_8_1_1101_qseq.txt.gz | Illumina native | 159161750.0 | 3183235.0 | GSM1280516 r1 | 0:50 | A:40560849;C:38239286;G:38051715;T:41572492;N:737408 | 50 | 40560849 | 38239286 | 38051715 | 41572492 | 737408 | SRX387598 | SRS511498 | SRA115339 | GEO | College of Life Sciences, Peking University | 1 | 0.93678 | 0.06225 | 0.68834 | 0.44699 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | China | 2013-12-05 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||||
| 37256 | 37256 | SRR1104059 | SRX387598 | SRS511498 | SRP033532 | PRJNA230686 | Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae | GSE53022 | Transcriptome Analysis | We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant. | pubmed:24430697 | kctd10 mut zebrafish heart | GSM1280516 | source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:kctd10 / kctd10 mutant|tissue:heart | kctd10 mut zebrafish heart | sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant. | heart | Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol | strain background:AB|development stage:48 hpf|genotype/variation:kctd10 / kctd10 mutant|tissue:heart | GSM1280516 | GSM1280516: kctd10 mut zebrafish heart; Danio rerio; RNA Seq | GSM1280516 | 1 | Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol | GEO Accession:GSM1280516 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033532 | 10053590150.0 | 201071803.0 | GSM1280516 r2 | 0:50 | A:2588651143;C:2370219438;G:2396055158;T:2650913003;N:47751408 | 50 | 2588651143 | 2370219438 | 2396055158 | 2650913003 | 47751408 | SRX387598 | SRS511498 | SRA115339 | GEO | College of Life Sciences, Peking University | 1 | 0.92227 | 0.06457 | 0.69367 | 0.45203 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | China | 2013-12-05 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||||||
| 37257 | 37257 | SRR1043687 | SRX387597 | SRS511497 | SRP033532 | PRJNA230686 | Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae | GSE53022 | Transcriptome Analysis | We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant. | pubmed:24430697 | wt zebrafish heart | GSM1280515 | source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart | wt zebrafish heart | sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant. | heart | Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol | strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart | GSM1280515 | GSM1280515: wt zebrafish heart; Danio rerio; RNA Seq | GSM1280515 | 1 | Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol | GEO Accession:GSM1280515 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033532 | s_6_1_1101_qseq.txt.gz | Illumina native | 155968450.0 | 3119369.0 | GSM1280515 r1 | 0:50 | A:40015379;C:37108086;G:37319547;T:41209982;N:315456 | 50 | 40015379 | 37108086 | 37319547 | 41209982 | 315456 | SRX387597 | SRS511497 | SRA115339 | GEO | College of Life Sciences, Peking University | 1 | 0.92288 | 0.06296 | 0.69209 | 0.4533 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | China | 2013-12-05 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||||
| 37258 | 37258 | SRR1104058 | SRX387597 | SRS511497 | SRP033532 | PRJNA230686 | Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae | GSE53022 | Transcriptome Analysis | We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant. | pubmed:24430697 | wt zebrafish heart | GSM1280515 | source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart | wt zebrafish heart | sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant. | heart | Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol | strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart | GSM1280515 | GSM1280515: wt zebrafish heart; Danio rerio; RNA Seq | GSM1280515 | 1 | Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol | GEO Accession:GSM1280515 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033532 | 10404769750.0 | 208095395.0 | GSM1280515 r2 | 0:50 | A:2661715782;C:2489013308;G:2484808257;T:2727159333;N:42073070 | 50 | 2661715782 | 2489013308 | 2484808257 | 2727159333 | 42073070 | SRX387597 | SRS511497 | SRA115339 | GEO | College of Life Sciences, Peking University | 1 | 0.93515 | 0.0656 | 0.68986 | 0.45312 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | China | 2013-12-05 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||||||
| 40737 | 40737 | SRR3290613 | SRX1660379 | SRS1360338 | SRP072298 | PRJNA316318 | Analysis of gene expression during the early stages of zebrafish heart valve development | GSE79585 | Transcriptome Analysis | We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing | pubmed:27221222 | 56hpf con3 ESD 21 N1 | GSM2098629 | source name:heart|line:AB|tissue:heart|developmental stage:56hpf | 56hpf con3 ESD 21 N1 | Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts. | heart | Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. | Embryos were collected staged and grown under standard conditions | line:AB|tissue:heart|developmental stage:56hpf | GSM2098629 | GSM2098629: 56hpf con3 ESD 21 N1; Danio rerio; RNA Seq | GSM2098629 | 1 | Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. | GEO Accession:GSM2098629 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP072298 | ESD-21_N1.fastq.gz | fastq | 2561571150.0 | 51231423.0 | GSM2098629 r1 | 0:50 | A:738531563;C:525473156;G:523941846;T:773278863;N:345722 | 50 | 738531563 | 525473156 | 523941846 | 773278863 | 345722 | SRX1660379 | SRS1360338 | SRA395278 | GEO | IGBMC | 1 | 0.90421 | 0.28766 | 0.74312 | 0.52751 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | France | 2016-03-24 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 40738 | 40738 | SRR3290612 | SRX1660378 | SRS1360339 | SRP072298 | PRJNA316318 | Analysis of gene expression during the early stages of zebrafish heart valve development | GSE79585 | Transcriptome Analysis | We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing | pubmed:27221222 | 56hpf con2 ESD 20 N8 | GSM2098628 | source name:heart|line:AB|tissue:heart|developmental stage:56hpf | 56hpf con2 ESD 20 N8 | Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts. | heart | Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. | Embryos were collected staged and grown under standard conditions | line:AB|tissue:heart|developmental stage:56hpf | GSM2098628 | GSM2098628: 56hpf con2 ESD 20 N8; Danio rerio; RNA Seq | GSM2098628 | 1 | Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. | GEO Accession:GSM2098628 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP072298 | ESD-20_N8.fastq.gz | fastq | 2243358450.0 | 44867169.0 | GSM2098628 r1 | 0:50 | A:653175386;C:451218310;G:450082444;T:688620234;N:262076 | 50 | 653175386 | 451218310 | 450082444 | 688620234 | 262076 | SRX1660378 | SRS1360339 | SRA395278 | GEO | IGBMC | 1 | 0.90525 | 0.27718 | 0.74915 | 0.53438 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | France | 2016-03-24 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 40739 | 40739 | SRR3290611 | SRX1660377 | SRS1360340 | SRP072298 | PRJNA316318 | Analysis of gene expression during the early stages of zebrafish heart valve development | GSE79585 | Transcriptome Analysis | We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing | pubmed:27221222 | 56hpf con1 ESD 19 N6 | GSM2098627 | source name:heart|line:AB|tissue:heart|developmental stage:56hpf | 56hpf con1 ESD 19 N6 | Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts. | heart | Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. | Embryos were collected staged and grown under standard conditions | line:AB|tissue:heart|developmental stage:56hpf | GSM2098627 | GSM2098627: 56hpf con1 ESD 19 N6; Danio rerio; RNA Seq | GSM2098627 | 1 | Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. | GEO Accession:GSM2098627 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP072298 | ESD-19_N6.fastq.gz | fastq | 2100229600.0 | 42004592.0 | GSM2098627 r1 | 0:50 | A:601981170;C:436442080;G:439494399;T:622070663;N:241288 | 50 | 601981170 | 436442080 | 439494399 | 622070663 | 241288 | SRX1660377 | SRS1360340 | SRA395278 | GEO | IGBMC | 1 | 0.87598 | 0.32196 | 0.74146 | 0.58008 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | France | 2016-03-24 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 40740 | 40740 | SRR3290610 | SRX1660376 | SRS1360341 | SRP072298 | PRJNA316318 | Analysis of gene expression during the early stages of zebrafish heart valve development | GSE79585 | Transcriptome Analysis | We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing | pubmed:27221222 | 48hpf con3 ESD 15 N5 | GSM2098626 | source name:heart|line:AB|tissue:heart|developmental stage:48hpf | 48hpf con3 ESD 15 N5 | Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts. | heart | Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. | Embryos were collected staged and grown under standard conditions | line:AB|tissue:heart|developmental stage:48hpf | GSM2098626 | GSM2098626: 48hpf con3 ESD 15 N5; Danio rerio; RNA Seq | GSM2098626 | 1 | Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. | GEO Accession:GSM2098626 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP072298 | ESD-15_N5.fastq.gz | fastq | 1677511000.0 | 33550220.0 | GSM2098626 r1 | 0:50 | A:515769850;C:312578723;G:314926898;T:534106645;N:128884 | 50 | 515769850 | 312578723 | 314926898 | 534106645 | 128884 | SRX1660376 | SRS1360341 | SRA395278 | GEO | IGBMC | 1 | 0.88227 | 0.34705 | 0.74905 | 0.40306 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | France | 2016-03-24 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 40741 | 40741 | SRR3290609 | SRX1660375 | SRS1360342 | SRP072298 | PRJNA316318 | Analysis of gene expression during the early stages of zebrafish heart valve development | GSE79585 | Transcriptome Analysis | We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing | pubmed:27221222 | 48hpf con2 ESD 14 N3 | GSM2098625 | source name:heart|line:AB|tissue:heart|developmental stage:48hpf | 48hpf con2 ESD 14 N3 | Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts. | heart | Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. | Embryos were collected staged and grown under standard conditions | line:AB|tissue:heart|developmental stage:48hpf | GSM2098625 | GSM2098625: 48hpf con2 ESD 14 N3; Danio rerio; RNA Seq | GSM2098625 | 1 | Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. | GEO Accession:GSM2098625 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP072298 | ESD-14_N3.fastq.gz | fastq | 3262822450.0 | 65256449.0 | GSM2098625 r1 | 0:50 | A:1003248923;C:599408057;G:606959271;T:1052958480;N:247719 | 50 | 1003248923 | 599408057 | 606959271 | 1052958480 | 247719 | SRX1660375 | SRS1360342 | SRA395278 | GEO | IGBMC | 1 | 0.8699 | 0.34134 | 0.75848 | 0.48365 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | France | 2016-03-24 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 40742 | 40742 | SRR3290608 | SRX1660374 | SRS1360343 | SRP072298 | PRJNA316318 | Analysis of gene expression during the early stages of zebrafish heart valve development | GSE79585 | Transcriptome Analysis | We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing | pubmed:27221222 | 48hpf con1 ESD 13 N1 | GSM2098624 | source name:heart|line:AB|tissue:heart|developmental stage:48hpf | 48hpf con1 ESD 13 N1 | Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts. | heart | Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. | Embryos were collected staged and grown under standard conditions | line:AB|tissue:heart|developmental stage:48hpf | GSM2098624 | GSM2098624: 48hpf con1 ESD 13 N1; Danio rerio; RNA Seq | GSM2098624 | 1 | Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions. | GEO Accession:GSM2098624 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP072298 | ESD-13_N1.fastq.gz | fastq | 1560642600.0 | 31212852.0 | GSM2098624 r1 | 0:50 | A:451261879;C:320132595;G:321545848;T:467582692;N:119586 | 50 | 451261879 | 320132595 | 321545848 | 467582692 | 119586 | SRX1660374 | SRS1360343 | SRA395278 | GEO | IGBMC | 1 | 0.8654 | 0.30695 | 0.74286 | 0.54249 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | France | 2016-03-24 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 42936 | 42936 | SRR5855244 | SRX3024526 | SRS2373779 | SRP113255 | PRJNA395216 | mRNA sequencing of larval zebrafish heart tissue | PRJNA395216 | Other | Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions. | Zebrafish 48hpf heart mRNA sequencing bbs6 over expression | bbs6 over expression 4 | strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal | zebrafish mRNA seq of heart tissue bbs6 over expression | bbs6 overexpression 4 | bbs6 overexpression 4 | hearts encriched from whole animal tissue and mRNA isolated | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP113255 | 12_lane5_20161102000_S92_L005_R2_001.fastq.gz 12_lane5_20161102000_S92_L005_R1_001.fastq.gz | fastq fastq | 4734224072.0 | 31146211.0 | 12 lane5 20161102000 S92 L005 R2 001.fastq.gz | 0:76 1:76 | A:1191205496;C:1178247460;G:1168255635;T:1196060624;N:454857 | 76 | 76 | 1191205496 | 1178247460 | 1168255635 | 1196060624 | 454857 | SRX3024526 | SRS2373779 | SRA589703 | University of Iowa|Biology | University of Iowa | 2 | 0.95177 | 0.95131 | 0.0383 | 0.03726 | 0.72243 | 0.72243 | 0.42289 | 0.42266 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2017-07-20 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 42937 | 42937 | SRR5855245 | SRX3024525 | SRS2373778 | SRP113255 | PRJNA395216 | mRNA sequencing of larval zebrafish heart tissue | PRJNA395216 | Other | Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions. | Zebrafish 48hpf heart mRNA sequencing bbs6 over expression | bbs6 over expression 2 | strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal | zebrafish mRNA seq of heart tissue bbs6 over expression | bbs6 overexpression 3 | bbs6 overexpression 3 | hearts encriched from whole animal tissue and mRNA isolated | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP113255 | 11_lane5_20161102000_S91_L005_R1_001.fastq.gz 11_lane5_20161102000_S91_L005_R2_001.fastq.gz | fastq fastq | 5015265232.0 | 32995166.0 | 11 lane5 20161102000 S91 L005 R1 001.fastq.gz | 0:76 1:76 | A:1267139647;C:1242816272;G:1232034679;T:1272800227;N:474407 | 76 | 76 | 1267139647 | 1242816272 | 1232034679 | 1272800227 | 474407 | SRX3024525 | SRS2373778 | SRA589703 | University of Iowa|Biology | University of Iowa | 2 | 0.95103 | 0.95218 | 0.04923 | 0.04847 | 0.69402 | 0.69518 | 0.45437 | 0.44772 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2017-07-20 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 42938 | 42938 | SRR5855246 | SRX3024524 | SRS2373777 | SRP113255 | PRJNA395216 | mRNA sequencing of larval zebrafish heart tissue | PRJNA395216 | Other | Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions. | Zebrafish 48hpf heart mRNA sequencing smarcc1a knockdown | smarcc1a knockdown 3 | strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal | zebrafish mRNA seq of heart tissue smarcc1a knockdown | smarcc1a knockdown 4 | smarcc1a knockdown 4 | hearts encriched from whole animal tissue and mRNA isolated | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP113255 | 8_lane5_20161102000_S88_L005_R1_001.fastq.gz 8_lane5_20161102000_S88_L005_R2_001.fastq.gz | fastq fastq | 4324972280.0 | 28453765.0 | 8 lane5 20161102000 S88 L005 R2 001.fastq.gz | 0:76 1:76 | A:1070408444;C:1094152744;G:1085295832;T:1074702140;N:413120 | 76 | 76 | 1070408444 | 1094152744 | 1085295832 | 1074702140 | 413120 | SRX3024524 | SRS2373777 | SRA589703 | University of Iowa|Biology | University of Iowa | 2 | 0.95733 | 0.95767 | 0.03174 | 0.0306 | 0.72028 | 0.72072 | 0.44362 | 0.45159 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2017-07-20 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 42939 | 42939 | SRR5855247 | SRX3024523 | SRS2373776 | SRP113255 | PRJNA395216 | mRNA sequencing of larval zebrafish heart tissue | PRJNA395216 | Other | Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions. | Zebrafish 48hpf heart mRNA sequencing smarcc1a knockdown | smarcc1a knockdown 4 | strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal | zebrafish mRNA seq of heart tissue smarcc1a knockdown | smarcc1a knockdown 3 | smarcc1a knockdown 3 | hearts encriched from whole animal tissue and mRNA isolated | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP113255 | 7_lane5_20161102000_S87_L005_R1_001.fastq.gz 7_lane5_20161102000_S87_L005_R2_001.fastq.gz | fastq fastq | 4491938656.0 | 29552228.0 | 7 lane5 20161102000 S87 L005 R1 001.fastq.gz | 0:76 1:76 | A:1116707304;C:1130163592;G:1126483942;T:1118152345;N:431473 | 76 | 76 | 1116707304 | 1130163592 | 1126483942 | 1118152345 | 431473 | SRX3024523 | SRS2373776 | SRA589703 | University of Iowa|Biology | University of Iowa | 2 | 0.95348 | 0.95449 | 0.03796 | 0.03772 | 0.72529 | 0.72618 | 0.46052 | 0.46096 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2017-07-20 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 42940 | 42940 | SRR5855248 | SRX3024522 | SRS2373775 | SRP113255 | PRJNA395216 | mRNA sequencing of larval zebrafish heart tissue | PRJNA395216 | Other | Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions. | Zebrafish 48hpf heart mRNA sequencing smarcc1a knockdown | smarcc1a knockdown 2 | strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal | zebrafish mRNA seq of heart tissue smarcc1a knockdown | smarcc1a knockdown 2 | smarcc1a knockdown 2 | hearts encriched from whole animal tissue and mRNA isolated | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP113255 | 6_lane5_20161102000_S86_L005_R1_001.fastq.gz 6_lane5_20161102000_S86_L005_R2_001.fastq.gz | fastq fastq | 4303477960.0 | 28312355.0 | 6 lane5 20161102000 S86 L005 R1 001.fastq.gz | 0:76 1:76 | A:1060357621;C:1096114267;G:1081075677;T:1065519253;N:411142 | 76 | 76 | 1060357621 | 1096114267 | 1081075677 | 1065519253 | 411142 | SRX3024522 | SRS2373775 | SRA589703 | University of Iowa|Biology | University of Iowa | 2 | 0.95716 | 0.95787 | 0.03128 | 0.03077 | 0.7304 | 0.73097 | 0.43343 | 0.4406 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2017-07-20 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 42941 | 42941 | SRR5855249 | SRX3024521 | SRS2373774 | SRP113255 | PRJNA395216 | mRNA sequencing of larval zebrafish heart tissue | PRJNA395216 | Other | Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions. | Zebrafish 48hpf heart mRNA sequencing smarcc1a knockdown | smarcc1a knockdown 1 | strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal | zebrafish mRNA seq of heart tissue smarcc1a knockdown | smarcc1a knockdown 1 | smarcc1a knockdown 1 | hearts encriched from whole animal tissue and mRNA isolated | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP113255 | 5_lane5_20161102000_S85_L005_R1_001.fastq.gz 5_lane5_20161102000_S85_L005_R2_001.fastq.gz | fastq fastq | 4299406944.0 | 28285572.0 | 5 lane5 20161102000 S85 L005 R2 001.fastq.gz | 0:76 1:76 | A:1055648741;C:1094443792;G:1091483902;T:1057416779;N:413730 | 76 | 76 | 1055648741 | 1094443792 | 1091483902 | 1057416779 | 413730 | SRX3024521 | SRS2373774 | SRA589703 | University of Iowa|Biology | University of Iowa | 2 | 0.95809 | 0.95937 | 0.02908 | 0.02878 | 0.732 | 0.7321 | 0.44577 | 0.44584 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2017-07-20 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 42942 | 42942 | SRR5855250 | SRX3024520 | SRS2373773 | SRP113255 | PRJNA395216 | mRNA sequencing of larval zebrafish heart tissue | PRJNA395216 | Other | Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions. | Zebrafish 48hpf heart mRNA sequencing control | wildtype control 4 | strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal | zebrafish mRNA seq of heart tissue control | wildtype control 4 | wildtype control 4 | hearts encriched from whole animal tissue and mRNA isolated | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP113255 | 4_lane5_20161102000_S84_L005_R1_001.fastq.gz 4_lane5_20161102000_S84_L005_R2_001.fastq.gz | fastq fastq | 4018059352.0 | 26434601.0 | 4 lane5 20161102000 S84 L005 R2 001.fastq.gz | 0:76 1:76 | A:1008156233;C:1001737182;G:997296042;T:1010483320;N:386575 | 76 | 76 | 1008156233 | 1001737182 | 997296042 | 1010483320 | 386575 | SRX3024520 | SRS2373773 | SRA589703 | University of Iowa|Biology | University of Iowa | 2 | 0.95095 | 0.95159 | 0.04934 | 0.04855 | 0.6858 | 0.68676 | 0.47468 | 0.47043 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2017-07-20 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 42943 | 42943 | SRR5855251 | SRX3024519 | SRS2373772 | SRP113255 | PRJNA395216 | mRNA sequencing of larval zebrafish heart tissue | PRJNA395216 | Other | Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions. | Zebrafish 48hpf heart mRNA sequencing control | wildtype control 3 | strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal | zebrafish mRNA seq of heart tissue control | wildtype control 3 | wildtype control 3 | hearts encriched from whole animal tissue and mRNA isolated | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP113255 | 3_lane5_20161102000_S83_L005_R2_001.fastq.gz 3_lane5_20161102000_S83_L005_R1_001.fastq.gz | fastq fastq | 4233495032.0 | 27851941.0 | 3 lane5 20161102000 S83 L005 R1 001.fastq.gz | 0:76 1:76 | A:1061234768;C:1061677848;G:1044744764;T:1065439420;N:398232 | 76 | 76 | 1061234768 | 1061677848 | 1044744764 | 1065439420 | 398232 | SRX3024519 | SRS2373772 | SRA589703 | University of Iowa|Biology | University of Iowa | 2 | 0.95404 | 0.95547 | 0.04316 | 0.04198 | 0.70741 | 0.70717 | 0.43949 | 0.44585 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2017-07-20 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 42944 | 42944 | SRR5855252 | SRX3024518 | SRS2373771 | SRP113255 | PRJNA395216 | mRNA sequencing of larval zebrafish heart tissue | PRJNA395216 | Other | Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions. | Zebrafish 48hpf heart mRNA sequencing control | wildtype control 2 | strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal | zebrafish mRNA seq of heart tissue control | wildtype control 2 | wildtype control 2 | hearts encriched from whole animal tissue and mRNA isolated | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP113255 | 2_lane5_20161102000_S82_L005_R1_001.fastq.gz 2_lane5_20161102000_S82_L005_R2_001.fastq.gz | fastq fastq | 4865250352.0 | 32008226.0 | 2 lane5 20161102000 S82 L005 R2 001.fastq.gz | 0:76 1:76 | A:1217698162;C:1217336292;G:1210023632;T:1219728654;N:463612 | 76 | 76 | 1217698162 | 1217336292 | 1210023632 | 1219728654 | 463612 | SRX3024518 | SRS2373771 | SRA589703 | University of Iowa|Biology | University of Iowa | 2 | 0.95521 | 0.95457 | 0.03943 | 0.0382 | 0.70285 | 0.7037 | 0.45131 | 0.45255 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2017-07-20 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 42945 | 42945 | SRR5855253 | SRX3024517 | SRS2373769 | SRP113255 | PRJNA395216 | mRNA sequencing of larval zebrafish heart tissue | PRJNA395216 | Other | Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions. | Zebrafish 48hpf heart mRNA sequencing control | wildtype control 1 | strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal | zebrafish mRNA seq of heart tissue control | wildtype control 1 | wildtype control 1 | hearts encriched from whole animal tissue and mRNA isolated | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP113255 | 1_lane5_20161102000_S81_L005_R1_001.fastq.gz 1_lane5_20161102000_S81_L005_R2_001.fastq.gz | fastq fastq | 3946454432.0 | 25963516.0 | 1 lane5 20161102000 S81 L005 R2 001.fastq.gz | 0:76 1:76 | A:991404923;C:986313010;G:975620653;T:992743977;N:371869 | 76 | 76 | 991404923 | 986313010 | 975620653 | 992743977 | 371869 | SRX3024517 | SRS2373769 | SRA589703 | University of Iowa|Biology | University of Iowa | 2 | 0.95282 | 0.95458 | 0.05035 | 0.04915 | 0.69702 | 0.6967 | 0.4678 | 0.46722 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2017-07-20 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 42946 | 42946 | SRR5855254 | SRX3024516 | SRS2373770 | SRP113255 | PRJNA395216 | mRNA sequencing of larval zebrafish heart tissue | PRJNA395216 | Other | Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions. | Zebrafish 48hpf heart mRNA sequencing bbs6 over expression | bbs6 over expression 3 | strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal | zebrafish mRNA seq of heart tissue bbs6 over expression | bbs6 overexpression 2 | bbs6 overexpression 2 | hearts encriched from whole animal tissue and mRNA isolated | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP113255 | 10_lane5_20161102000_S90_L005_R1_001.fastq.gz 10_lane5_20161102000_S90_L005_R2_001.fastq.gz | fastq fastq | 4315321344.0 | 28390272.0 | 10 lane5 20161102000 S90 L005 R2 001.fastq.gz | 0:76 1:76 | A:1086545039;C:1075002584;G:1059308862;T:1094053688;N:411171 | 76 | 76 | 1086545039 | 1075002584 | 1059308862 | 1094053688 | 411171 | SRX3024516 | SRS2373770 | SRA589703 | University of Iowa|Biology | University of Iowa | 2 | 0.95328 | 0.95349 | 0.04449 | 0.04409 | 0.69546 | 0.69641 | 0.44932 | 0.44783 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2017-07-20 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 42947 | 42947 | SRR5855255 | SRX3024515 | SRS2373768 | SRP113255 | PRJNA395216 | mRNA sequencing of larval zebrafish heart tissue | PRJNA395216 | Other | Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions. | Zebrafish 48hpf heart mRNA sequencing bbs6 over expression | bbs6 over expression 1 | strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal | zebrafish mRNA seq of heart tissue bbs6 over expression | bbs6 overexpression 1 | bbs6 overexpression 1 | hearts encriched from whole animal tissue and mRNA isolated | RNA-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP113255 | 9_lane5_20161102000_S89_L005_R1_001.fastq.gz 9_lane5_20161102000_S89_L005_R2_001.fastq.gz | fastq fastq | 3745789808.0 | 24643354.0 | 9 lane5 20161102000 S89 L005 R2 001.fastq.gz | 0:76 1:76 | A:935401240;C:938927873;G:932061106;T:939042073;N:357516 | 76 | 76 | 935401240 | 938927873 | 932061106 | 939042073 | 357516 | SRX3024515 | SRS2373768 | SRA589703 | University of Iowa|Biology | University of Iowa | 2 | 0.95454 | 0.955 | 0.03772 | 0.03653 | 0.71001 | 0.71052 | 0.43385 | 0.43347 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | other | unknown | bulk | unknown | unknown | United States | 2017-07-20 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||
| 43654 | 43654 | SRR5984242 | SRX3140238 | SRS2473002 | SRP116311 | PRJNA400391 | Multiple roles for Wwtr1 in cardiac wall maturation | GSE103169 | Transcriptome Analysis | Cardiac trabeculation is a highly regulated process that starts with the delamination of cardiomyocytes from the compact wall to form stereotypical muscular ridges in the developing ventricle. The Hippo signaling pathway has been implicated in cardiac development but many questions remain. We investigated the role of Wwtr1 a nuclear effector of the Hippo pathway in zebrafish and find that its loss results in hearts with reduced trabeculation. However in mosaic animals wwtr1 / cardiomyocytes contribute more frequently than wwtr1+/ cardiomyocytes to the trabecular layer of wild type hearts. To investigate this paradox we examined the myocardial wall at early stages and find that loss of Wwtr1 leads to disruption of the compact wall architecture as evidenced by the disorganized cortical actin structure and abnormal cell cell junctions. The mutant compact wall is not able to support trabeculation as in mosaic animals wild type cardiomyocytes are more frequently in the compact layer of mutant than heterozygous hearts. Therefore we propose that Wwtr1 establishes the compact wall architecture necessary for trabeculation and that it also modulates a cardiomyocyte's decision to enter the trabecular layer. Overall design: larval hearts from mutants and WT siblings were manuall dissected out at 57 hpf 59 hpf. A total of 23 hearts per biological replicate was collected. RNA sequencing was performed on three biological replicates for each genotype. | pubmed:29773645 | mutant3 | GSM2756549 | source name:larval hearts|developmental stage:57 hpf 59 hpf|tissue:whole hearts | mutant3 | Basecalls with RTA v2 Illumina Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides. Only reads between 30 and 150 nucleotides were cleared for further analyses. Mapping: alignment versus the Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “ outFilterMismatchNoverLmax 0.1" The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers. Genome build: DanRer10 Supplementary files format and content: library size normalized counts per sample | larval hearts | RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly 6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry resulting in minimum of 30M reads per library with 1x75bp single end setup. | developmental stage:57 hpf 59 hpf|tissue:whole hearts | GSM2756549 | GSM2756549: mutant3; Danio rerio; RNA Seq | GSM2756549 | 1 | RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly 6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry resulting in minimum of 30M reads per library with 1x75bp single end setup. | GEO Accession:GSM2756549 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP116311 | jason_heart_Mut3_R1.fastq.gz | fastq | 2318935255.0 | 32714908.0 | GSM2756549 r1 | 0:70.88 1:0 | A:531252689;C:641587621;G:685109185;T:460794150;N:191610 | 70 | 0 | 531252689 | 641587621 | 685109185 | 460794150 | 191610 | SRX3140238 | SRS2473002 | SRA603246 | GEO | MPI for heart and lung research | 1 | 0.91412 | 0.26371 | 0.81046 | 0.70894 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Germany | 2017-08-28 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 43655 | 43655 | SRR5984241 | SRX3140237 | SRS2473000 | SRP116311 | PRJNA400391 | Multiple roles for Wwtr1 in cardiac wall maturation | GSE103169 | Transcriptome Analysis | Cardiac trabeculation is a highly regulated process that starts with the delamination of cardiomyocytes from the compact wall to form stereotypical muscular ridges in the developing ventricle. The Hippo signaling pathway has been implicated in cardiac development but many questions remain. We investigated the role of Wwtr1 a nuclear effector of the Hippo pathway in zebrafish and find that its loss results in hearts with reduced trabeculation. However in mosaic animals wwtr1 / cardiomyocytes contribute more frequently than wwtr1+/ cardiomyocytes to the trabecular layer of wild type hearts. To investigate this paradox we examined the myocardial wall at early stages and find that loss of Wwtr1 leads to disruption of the compact wall architecture as evidenced by the disorganized cortical actin structure and abnormal cell cell junctions. The mutant compact wall is not able to support trabeculation as in mosaic animals wild type cardiomyocytes are more frequently in the compact layer of mutant than heterozygous hearts. Therefore we propose that Wwtr1 establishes the compact wall architecture necessary for trabeculation and that it also modulates a cardiomyocyte's decision to enter the trabecular layer. Overall design: larval hearts from mutants and WT siblings were manuall dissected out at 57 hpf 59 hpf. A total of 23 hearts per biological replicate was collected. RNA sequencing was performed on three biological replicates for each genotype. | pubmed:29773645 | mutant2 | GSM2756548 | source name:larval hearts|developmental stage:57 hpf 59 hpf|tissue:whole hearts | mutant2 | Basecalls with RTA v2 Illumina Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides. Only reads between 30 and 150 nucleotides were cleared for further analyses. Mapping: alignment versus the Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “ outFilterMismatchNoverLmax 0.1" The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers. Genome build: DanRer10 Supplementary files format and content: library size normalized counts per sample | larval hearts | RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly 6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry resulting in minimum of 30M reads per library with 1x75bp single end setup. | developmental stage:57 hpf 59 hpf|tissue:whole hearts | GSM2756548 | GSM2756548: mutant2; Danio rerio; RNA Seq | GSM2756548 | 1 | RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly 6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry resulting in minimum of 30M reads per library with 1x75bp single end setup. | GEO Accession:GSM2756548 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP116311 | jason_heart_Mut2_R1.fastq.gz | fastq | 2276667269.0 | 31589401.0 | GSM2756548 r1 | 0:72.07 1:0 | A:523522795;C:629721285;G:668815033;T:454506503;N:101653 | 72 | 0 | 523522795 | 629721285 | 668815033 | 454506503 | 101653 | SRX3140237 | SRS2473000 | SRA603246 | GEO | MPI for heart and lung research | 1 | 0.93959 | 0.27725 | 0.81213 | 0.72099 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Germany | 2017-08-28 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 43656 | 43656 | SRR5984240 | SRX3140236 | SRS2473001 | SRP116311 | PRJNA400391 | Multiple roles for Wwtr1 in cardiac wall maturation | GSE103169 | Transcriptome Analysis | Cardiac trabeculation is a highly regulated process that starts with the delamination of cardiomyocytes from the compact wall to form stereotypical muscular ridges in the developing ventricle. The Hippo signaling pathway has been implicated in cardiac development but many questions remain. We investigated the role of Wwtr1 a nuclear effector of the Hippo pathway in zebrafish and find that its loss results in hearts with reduced trabeculation. However in mosaic animals wwtr1 / cardiomyocytes contribute more frequently than wwtr1+/ cardiomyocytes to the trabecular layer of wild type hearts. To investigate this paradox we examined the myocardial wall at early stages and find that loss of Wwtr1 leads to disruption of the compact wall architecture as evidenced by the disorganized cortical actin structure and abnormal cell cell junctions. The mutant compact wall is not able to support trabeculation as in mosaic animals wild type cardiomyocytes are more frequently in the compact layer of mutant than heterozygous hearts. Therefore we propose that Wwtr1 establishes the compact wall architecture necessary for trabeculation and that it also modulates a cardiomyocyte's decision to enter the trabecular layer. Overall design: larval hearts from mutants and WT siblings were manuall dissected out at 57 hpf 59 hpf. A total of 23 hearts per biological replicate was collected. RNA sequencing was performed on three biological replicates for each genotype. | pubmed:29773645 | mutant1 | GSM2756547 | source name:larval hearts|developmental stage:57 hpf 59 hpf|tissue:whole hearts | mutant1 | Basecalls with RTA v2 Illumina Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides. Only reads between 30 and 150 nucleotides were cleared for further analyses. Mapping: alignment versus the Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “ outFilterMismatchNoverLmax 0.1" The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers. Genome build: DanRer10 Supplementary files format and content: library size normalized counts per sample | larval hearts | RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly 6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry resulting in minimum of 30M reads per library with 1x75bp single end setup. | developmental stage:57 hpf 59 hpf|tissue:whole hearts | GSM2756547 | GSM2756547: mutant1; Danio rerio; RNA Seq | GSM2756547 | 1 | RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly 6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry resulting in minimum of 30M reads per library with 1x75bp single end setup. | GEO Accession:GSM2756547 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP116311 | jason_heart_Mut1_R1.fastq.gz | fastq | 2433699187.0 | 33884585.0 | GSM2756547 r1 | 0:71.82 1:0 | A:566703318;C:666284055;G:710377903;T:490161679;N:172232 | 71 | 0 | 566703318 | 666284055 | 710377903 | 490161679 | 172232 | SRX3140236 | SRS2473001 | SRA603246 | GEO | MPI for heart and lung research | 1 | 0.92785 | 0.26891 | 0.80848 | 0.71469 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Germany | 2017-08-28 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 43657 | 43657 | SRR5984239 | SRX3140235 | SRS2473003 | SRP116311 | PRJNA400391 | Multiple roles for Wwtr1 in cardiac wall maturation | GSE103169 | Transcriptome Analysis | Cardiac trabeculation is a highly regulated process that starts with the delamination of cardiomyocytes from the compact wall to form stereotypical muscular ridges in the developing ventricle. The Hippo signaling pathway has been implicated in cardiac development but many questions remain. We investigated the role of Wwtr1 a nuclear effector of the Hippo pathway in zebrafish and find that its loss results in hearts with reduced trabeculation. However in mosaic animals wwtr1 / cardiomyocytes contribute more frequently than wwtr1+/ cardiomyocytes to the trabecular layer of wild type hearts. To investigate this paradox we examined the myocardial wall at early stages and find that loss of Wwtr1 leads to disruption of the compact wall architecture as evidenced by the disorganized cortical actin structure and abnormal cell cell junctions. The mutant compact wall is not able to support trabeculation as in mosaic animals wild type cardiomyocytes are more frequently in the compact layer of mutant than heterozygous hearts. Therefore we propose that Wwtr1 establishes the compact wall architecture necessary for trabeculation and that it also modulates a cardiomyocyte's decision to enter the trabecular layer. Overall design: larval hearts from mutants and WT siblings were manuall dissected out at 57 hpf 59 hpf. A total of 23 hearts per biological replicate was collected. RNA sequencing was performed on three biological replicates for each genotype. | pubmed:29773645 | WT3 | GSM2756546 | source name:larval hearts|developmental stage:57 hpf 59 hpf|tissue:whole hearts | WT3 | Basecalls with RTA v2 Illumina Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides. Only reads between 30 and 150 nucleotides were cleared for further analyses. Mapping: alignment versus the Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “ outFilterMismatchNoverLmax 0.1" The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers. Genome build: DanRer10 Supplementary files format and content: library size normalized counts per sample | larval hearts | RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly 6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry resulting in minimum of 30M reads per library with 1x75bp single end setup. | developmental stage:57 hpf 59 hpf|tissue:whole hearts | GSM2756546 | GSM2756546: WT3; Danio rerio; RNA Seq | GSM2756546 | 1 | RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly 6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry resulting in minimum of 30M reads per library with 1x75bp single end setup. | GEO Accession:GSM2756546 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP116311 | jason_heart_WT3_R1.fastq.gz | fastq | 2595563546.0 | 36205665.0 | GSM2756546 r1 | 0:71.69 1:0 | A:596821525;C:717114315;G:763367649;T:518112169;N:147888 | 71 | 0 | 596821525 | 717114315 | 763367649 | 518112169 | 147888 | SRX3140235 | SRS2473003 | SRA603246 | GEO | MPI for heart and lung research | 1 | 0.94302 | 0.26879 | 0.80732 | 0.68295 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Germany | 2017-08-28 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 43658 | 43658 | SRR5984238 | SRX3140234 | SRS2472998 | SRP116311 | PRJNA400391 | Multiple roles for Wwtr1 in cardiac wall maturation | GSE103169 | Transcriptome Analysis | Cardiac trabeculation is a highly regulated process that starts with the delamination of cardiomyocytes from the compact wall to form stereotypical muscular ridges in the developing ventricle. The Hippo signaling pathway has been implicated in cardiac development but many questions remain. We investigated the role of Wwtr1 a nuclear effector of the Hippo pathway in zebrafish and find that its loss results in hearts with reduced trabeculation. However in mosaic animals wwtr1 / cardiomyocytes contribute more frequently than wwtr1+/ cardiomyocytes to the trabecular layer of wild type hearts. To investigate this paradox we examined the myocardial wall at early stages and find that loss of Wwtr1 leads to disruption of the compact wall architecture as evidenced by the disorganized cortical actin structure and abnormal cell cell junctions. The mutant compact wall is not able to support trabeculation as in mosaic animals wild type cardiomyocytes are more frequently in the compact layer of mutant than heterozygous hearts. Therefore we propose that Wwtr1 establishes the compact wall architecture necessary for trabeculation and that it also modulates a cardiomyocyte's decision to enter the trabecular layer. Overall design: larval hearts from mutants and WT siblings were manuall dissected out at 57 hpf 59 hpf. A total of 23 hearts per biological replicate was collected. RNA sequencing was performed on three biological replicates for each genotype. | pubmed:29773645 | WT2 | GSM2756545 | source name:larval hearts|developmental stage:57 hpf 59 hpf|tissue:whole hearts | WT2 | Basecalls with RTA v2 Illumina Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides. Only reads between 30 and 150 nucleotides were cleared for further analyses. Mapping: alignment versus the Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “ outFilterMismatchNoverLmax 0.1" The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers. Genome build: DanRer10 Supplementary files format and content: library size normalized counts per sample | larval hearts | RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly 6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry resulting in minimum of 30M reads per library with 1x75bp single end setup. | developmental stage:57 hpf 59 hpf|tissue:whole hearts | GSM2756545 | GSM2756545: WT2; Danio rerio; RNA Seq | GSM2756545 | 1 | RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly 6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry resulting in minimum of 30M reads per library with 1x75bp single end setup. | GEO Accession:GSM2756545 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP116311 | jason_heart_WT2_R1.fastq.gz | fastq | 2428761873.0 | 34256225.0 | GSM2756545 r1 | 0:70.90 1:0 | A:548982414;C:680177405;G:725438417;T:473983208;N:180429 | 70 | 0 | 548982414 | 680177405 | 725438417 | 473983208 | 180429 | SRX3140234 | SRS2472998 | SRA603246 | GEO | MPI for heart and lung research | 1 | 0.92891 | 0.26633 | 0.81742 | 0.68958 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Germany | 2017-08-28 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 43659 | 43659 | SRR5984237 | SRX3140233 | SRS2472997 | SRP116311 | PRJNA400391 | Multiple roles for Wwtr1 in cardiac wall maturation | GSE103169 | Transcriptome Analysis | Cardiac trabeculation is a highly regulated process that starts with the delamination of cardiomyocytes from the compact wall to form stereotypical muscular ridges in the developing ventricle. The Hippo signaling pathway has been implicated in cardiac development but many questions remain. We investigated the role of Wwtr1 a nuclear effector of the Hippo pathway in zebrafish and find that its loss results in hearts with reduced trabeculation. However in mosaic animals wwtr1 / cardiomyocytes contribute more frequently than wwtr1+/ cardiomyocytes to the trabecular layer of wild type hearts. To investigate this paradox we examined the myocardial wall at early stages and find that loss of Wwtr1 leads to disruption of the compact wall architecture as evidenced by the disorganized cortical actin structure and abnormal cell cell junctions. The mutant compact wall is not able to support trabeculation as in mosaic animals wild type cardiomyocytes are more frequently in the compact layer of mutant than heterozygous hearts. Therefore we propose that Wwtr1 establishes the compact wall architecture necessary for trabeculation and that it also modulates a cardiomyocyte's decision to enter the trabecular layer. Overall design: larval hearts from mutants and WT siblings were manuall dissected out at 57 hpf 59 hpf. A total of 23 hearts per biological replicate was collected. RNA sequencing was performed on three biological replicates for each genotype. | pubmed:29773645 | WT1 | GSM2756544 | source name:larval hearts|developmental stage:57 hpf 59 hpf|tissue:whole hearts | WT1 | Basecalls with RTA v2 Illumina Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides. Only reads between 30 and 150 nucleotides were cleared for further analyses. Mapping: alignment versus the Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “ outFilterMismatchNoverLmax 0.1" The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers. Genome build: DanRer10 Supplementary files format and content: library size normalized counts per sample | larval hearts | RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly 6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry resulting in minimum of 30M reads per library with 1x75bp single end setup. | developmental stage:57 hpf 59 hpf|tissue:whole hearts | GSM2756544 | GSM2756544: WT1; Danio rerio; RNA Seq | GSM2756544 | 1 | RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly 6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry resulting in minimum of 30M reads per library with 1x75bp single end setup. | GEO Accession:GSM2756544 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP116311 | jason_heart_WT1_R1.fastq.gz | fastq | 2421918694.0 | 33333637.0 | GSM2756544 r1 | 0:72.66 1:0 | A:575214961;C:656270777;G:695610013;T:494755729;N:67214 | 72 | 0 | 575214961 | 656270777 | 695610013 | 494755729 | 67214 | SRX3140233 | SRS2472997 | SRA603246 | GEO | MPI for heart and lung research | 1 | 0.93965 | 0.26938 | 0.80415 | 0.70681 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Germany | 2017-08-28 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 43725 | 43725 | SRR6039671 | SRX3187843 | SRS2515291 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | C60 | time point hpf group:C|multiplex group:4|strain:cmlc2::gfp reporter line|dev stage:60 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | C60 | C60 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X22_130410_SN141_0670_AD228RACXX_8.txt.gz | fastq | 1364849650.0 | 27296993.0 | 9499X22 130410 SN141 0670 AD228RACXX 8.txt.gz | 0:50 | A:348009842;C:323199527;G:329155973;T:364266750;N:217558 | 50 | 348009842 | 323199527 | 329155973 | 364266750 | 217558 | SRX3187843 | SRS2515291 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.86007 | 0.19896 | 0.76869 | 0.64585 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43726 | 43726 | SRR6039672 | SRX3187842 | SRS2515290 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | C54 | time point hpf group:C|multiplex group:4|strain:cmlc2::gfp reporter line|dev stage:54 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | C54 | C54 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X21_130410_SN141_0670_AD228RACXX_8.txt.gz | fastq | 1605351050.0 | 32107021.0 | 9499X21 130410 SN141 0670 AD228RACXX 8.txt.gz | 0:50 | A:417861250;C:375199783;G:380695354;T:431338259;N:256404 | 50 | 417861250 | 375199783 | 380695354 | 431338259 | 256404 | SRX3187842 | SRS2515290 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.85615 | 0.205 | 0.75268 | 0.68959 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43728 | 43728 | SRR6039674 | SRX3187840 | SRS2515288 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | C66 | time point hpf group:C|multiplex group:4|strain:cmlc2::gfp reporter line|dev stage:66 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | C66 | C66 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X23_130410_SN141_0670_AD228RACXX_8.txt.gz | fastq | 1223124200.0 | 24462484.0 | 9499X23 130410 SN141 0670 AD228RACXX 8.txt.gz | 0:50 | A:314863383;C:287048667;G:292205645;T:328811745;N:194760 | 50 | 314863383 | 287048667 | 292205645 | 328811745 | 194760 | SRX3187840 | SRS2515288 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.87141 | 0.18418 | 0.76167 | 0.70405 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43734 | 43734 | SRR6039680 | SRX3187834 | SRS2515282 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | A48 | time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:48 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | A48 | A48 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X4_130405_SN141_0668_AD2154ACXX_7.txt.gz | fastq | 1163964850.0 | 23279297.0 | 9499X4 130405 SN141 0668 AD2154ACXX 7.txt.gz | 0:50 | A:267571170;C:307087585;G:308621634;T:280598211;N:86250 | 50 | 267571170 | 307087585 | 308621634 | 280598211 | 86250 | SRX3187834 | SRS2515282 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.59745 | 0.16497 | 0.85563 | 0.71862 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43735 | 43735 | SRR6039681 | SRX3187833 | SRS2515281 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | A54 | time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:54 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | A54 | A54 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X5_130405_SN141_0668_AD2154ACXX_7.txt.gz | fastq | 1655394200.0 | 33107884.0 | 9499X5 130405 SN141 0668 AD2154ACXX 7.txt.gz | 0:50 | A:385028150;C:432655363;G:431802199;T:405785458;N:123030 | 50 | 385028150 | 432655363 | 431802199 | 405785458 | 123030 | SRX3187833 | SRS2515281 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.29511 | 0.0811 | 0.90873 | 0.74416 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43736 | 43736 | SRR6039682 | SRX3187832 | SRS2515280 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | A60 | time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:60 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | A60 | A60 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X6_130405_SN141_0668_AD2154ACXX_7.txt.gz | fastq | 1644194800.0 | 32883896.0 | 9499X6 130405 SN141 0668 AD2154ACXX 7.txt.gz | 0:50 | A:384925336;C:429204709;G:426105707;T:403838669;N:120379 | 50 | 384925336 | 429204709 | 426105707 | 403838669 | 120379 | SRX3187832 | SRS2515280 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.21132 | 0.06222 | 0.92161 | 0.73478 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43737 | 43737 | SRR6039683 | SRX3187831 | SRS2515279 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | A66 | time point hpf group:A|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:66 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | A66 | A66 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X7_130405_SN141_0668_AD2154ACXX_8.txt.gz | fastq | 1263286950.0 | 25265739.0 | 9499X7 130405 SN141 0668 AD2154ACXX 8.txt.gz | 0:50 | A:295405537;C:327487531;G:330022830;T:310260331;N:110721 | 50 | 295405537 | 327487531 | 330022830 | 310260331 | 110721 | SRX3187831 | SRS2515279 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.26001 | 0.08486 | 0.89751 | 0.68587 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43740 | 43740 | SRR6039686 | SRX3187828 | SRS2515276 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | C48 | time point hpf group:C|multiplex group:4|strain:cmlc2::gfp reporter line|dev stage:48 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | C48 | C48 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X20_130410_SN141_0670_AD228RACXX_8.txt.gz | fastq | 1667261150.0 | 33345223.0 | 9499X20 130410 SN141 0670 AD228RACXX 8.txt.gz | 0:50 | A:435179346;C:386019872;G:392704941;T:453092337;N:264654 | 50 | 435179346 | 386019872 | 392704941 | 453092337 | 264654 | SRX3187828 | SRS2515276 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.84372 | 0.18152 | 0.76112 | 0.69534 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43741 | 43741 | SRR6039687 | SRX3187827 | SRS2515274 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | B66 | time point hpf group:B|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:66 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | B66 | B66 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X15_130410_SN141_0670_AD228RACXX_7.txt.gz | fastq | 1736299000.0 | 34725980.0 | 9499X15 130410 SN141 0670 AD228RACXX 7.txt.gz | 0:50 | A:408694669;C:446311098;G:454700615;T:426319811;N:272807 | 50 | 408694669 | 446311098 | 454700615 | 426319811 | 272807 | SRX3187827 | SRS2515274 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.86249 | 0.21214 | 0.81184 | 0.74585 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43746 | 43746 | SRR6039692 | SRX3187822 | SRS2515270 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | B48 | time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:48 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | B48 | B48 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X12_130405_SN141_0668_AD2154ACXX_8.txt.gz | fastq | 1343863300.0 | 26877266.0 | 9499X12 130405 SN141 0668 AD2154ACXX 8.txt.gz | 0:50 | A:332436047;C:330255043;G:335051133;T:346001738;N:119339 | 50 | 332436047 | 330255043 | 335051133 | 346001738 | 119339 | SRX3187822 | SRS2515270 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.86424 | 0.22149 | 0.77348 | 0.69794 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43747 | 43747 | SRR6039693 | SRX3187821 | SRS2515269 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | B54 | time point hpf group:B|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:54 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | B54 | B54 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X13_130410_SN141_0670_AD228RACXX_7.txt.gz | fastq | 1430967650.0 | 28619353.0 | 9499X13 130410 SN141 0670 AD228RACXX 7.txt.gz | 0:50 | A:337603977;C:367587663;G:373587156;T:351960226;N:228628 | 50 | 337603977 | 367587663 | 373587156 | 351960226 | 228628 | SRX3187821 | SRS2515269 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.86614 | 0.25063 | 0.81061 | 0.71973 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43748 | 43748 | SRR6039694 | SRX3187820 | SRS2515268 | SRP117696 | PRJNA407368 | RNA seq timecourse analysis during zebrafish heart looping morphogenesis | PRJNA407368 | Other | During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development during which many congenital heart disease malformations likely arise we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern identified transcription factor binding motifs enriched in each cluster and generated a model GRN for the major gene batteries in heart morphogenesis. | B60 | time point hpf group:B|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:60 hpf organism or animal | RNA Seq of Danio rerio heart tissue: Time series during heart looping 30 72 hpf | B60 | B60 | For each replicate approximately 1600 zebrafish embryos were collected 200 each at 30 36 42 48 54 60 66 72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at 80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP117696 | 9499X14_130410_SN141_0670_AD228RACXX_7.txt.gz | fastq | 1746861850.0 | 34937237.0 | 9499X14 130410 SN141 0670 AD228RACXX 7.txt.gz | 0:50 | A:414399803;C:445933587;G:454277059;T:431977310;N:274091 | 50 | 414399803 | 445933587 | 454277059 | 431977310 | 274091 | SRX3187820 | SRS2515268 | SRA608458 | University of Utah|Neurobiology and Anatomy | University of Utah | 1 | 0.85546 | 0.23134 | 0.80521 | 0.73018 | 50 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2017-09-14 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||||||||||||
| 43755 | 43755 | SRR6054093 | SRX3201032 | SRS2528004 | SRP118319 | PRJNA408129 | Spatially resolved RNA sequencing of the embryonic zebrafish heart | GSE104057 | Transcriptome Analysis | Development of specialized cell types and structures in the vertebrate heart is regulated by spatially restricted molecular pathways. Disruptions in these pathways can cause severe congenital cardiac malformations or functional defects. To better understand these pathways and how they regulate cardiac development and function we used tomo seq combining high throughput RNA sequencing with tissue sectioning to establish a genome wide expression dataset with high spatial resolution for the developing zebrafish heart. Analysis of the dataset revealed over 1100 genes differentially expressed in sub compartments. Pacemaker cells in the sinoatrial region induce heart contractions but little is known about the mechanisms underlying their development and function. Using our transcriptome map we identified spatially restricted Wnt/ß catenin signaling activity in pacemaker cells which was controlled by Islet 1 activity. Moreover Wnt/ß catenin signaling at a specific developmental stage in the myocardium controls heart rate by regulating pacemaker cellular response to parasympathetic stimuli. Thus this high resolution transcriptome map incorporating all cell types in the embryonic heart can expose spatially restricted molecular pathways critical for specific cardiac functions. Overall design: To generate spatially resolved RNA seq data for the developing zebrafish hearts 2 dpf we cryosectioned 3 hearts extracted RNA from the individual sections amplified and barcoded mRNA using the CEL seq protocol Hashimshony et al. Cell Reports 2012 with a few modifications. Libraries were sequenced on Illumina NextSeq using 75bp paired end sequencing. Sample Heart #1 is the primary sample. Heart #2 and #3 are biological replicates used for comparison. | pubmed:29400650 | heart3 2dpf wt | GSM2788520 | source name:isolated embryonic heart|tissue:embryonic heart|developmental stage:48 hpf direction:posterior/inflow tract to anterior/outflow tract; located in sections #11 #39|section thickness:10µm sections | heart3 2dpf wt | Paired end reads were aligned to the transcriptome using bwa version 0.6.2 with default parameters. The zebrafish transcriptome was based on genome release zv9 and contained improved gene annotations as described in Junker et al. 2014 Cell. The right mate of each read pair was mapped to the ensemble of all transcripts and to the set of 92 ERCC spike ins in sense direction. Reads mapping equally to multiple loci were discarded. Mapped reads were assigned to sections based on barcodes according to the CEL seq protocol Hashimshony et al. Cell Reports 2012 processed data files contain transcript read counts normalized against spike in read count and total read count per section Genome build: zv9 with improved three prime annotation see Junker et al 2014 Cell Supplementary files format and content: csv file containing transcript counts per gene rows and section columns | isolated embryonic heart | Unfixed embryonic hearts were dissected and embedded in tissue freezing medium. Blocks were cryosectioned and individual sections were transferred to Eppendorf tubes on dry ice. For extended experimental procedure see also Junker et al. 2014 Cell. | Total RNA was isolated by TRIzol extraction. mRNA was barcoded and amplified using the CEL seq protocol Hashimshony et al. Cell Reports 2012 see also: Junker et al. 2014 Cell CEL seq protocol Hashimshony et al. Cell Reports 2012; also see: Junker et al. 2014 Cell | tissue:embryonic heart|developmental stage:48 hpf direction:posterior/inflow tract to anterior/outflow tract; located in sections #11 #39|section thickness:10µm sections | GSM2788520 | GSM2788520: heart3 2dpf wt; Danio rerio; RNA Seq | GSM2788520 | 1 | Total RNA was isolated by TRIzol extraction. mRNA was barcoded and amplified using the CEL seq protocol Hashimshony et al. Cell Reports 2012 see also: Junker et al. 2014 Cell CEL seq protocol Hashimshony et al. Cell Reports 2012; also see: Junker et al. 2014 Cell | GEO Accession:GSM2788520 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP118319 | heart_03_SB032dpfwt_R1.fastq.gz heart_03_SB032dpfwt_R2.fastq.gz | fastq fastq | 2662906147.0 | 17670214.0 | GSM2788520 r1 | 0:75.39 1:75.31 | A:828280216;C:376671462;G:437493213;T:1019745554;N:715702 | 75 | 75 | 828280216 | 376671462 | 437493213 | 1019745554 | 715702 | SRX3201032 | SRS2528004 | SRA610777 | GEO | Jeroen Bakkers lab, Cardiac Development and Genetics, Hubrecht Institute | 2 | 0.04145 | 0.36579 | 0.03839 | 0.09603 | 0.99912 | 0.89623 | 0.41379 | 0.5674 | 76 | 75 | T | B | mate1 technical by mapping diff | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_plate | celseq | Netherlands | 2017-09-20 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||
| 43756 | 43756 | SRR6054092 | SRX3201031 | SRS2528003 | SRP118319 | PRJNA408129 | Spatially resolved RNA sequencing of the embryonic zebrafish heart | GSE104057 | Transcriptome Analysis | Development of specialized cell types and structures in the vertebrate heart is regulated by spatially restricted molecular pathways. Disruptions in these pathways can cause severe congenital cardiac malformations or functional defects. To better understand these pathways and how they regulate cardiac development and function we used tomo seq combining high throughput RNA sequencing with tissue sectioning to establish a genome wide expression dataset with high spatial resolution for the developing zebrafish heart. Analysis of the dataset revealed over 1100 genes differentially expressed in sub compartments. Pacemaker cells in the sinoatrial region induce heart contractions but little is known about the mechanisms underlying their development and function. Using our transcriptome map we identified spatially restricted Wnt/ß catenin signaling activity in pacemaker cells which was controlled by Islet 1 activity. Moreover Wnt/ß catenin signaling at a specific developmental stage in the myocardium controls heart rate by regulating pacemaker cellular response to parasympathetic stimuli. Thus this high resolution transcriptome map incorporating all cell types in the embryonic heart can expose spatially restricted molecular pathways critical for specific cardiac functions. Overall design: To generate spatially resolved RNA seq data for the developing zebrafish hearts 2 dpf we cryosectioned 3 hearts extracted RNA from the individual sections amplified and barcoded mRNA using the CEL seq protocol Hashimshony et al. Cell Reports 2012 with a few modifications. Libraries were sequenced on Illumina NextSeq using 75bp paired end sequencing. Sample Heart #1 is the primary sample. Heart #2 and #3 are biological replicates used for comparison. | pubmed:29400650 | heart2 2dpf wt | GSM2788519 | source name:isolated embryonic heart|tissue:embryonic heart|developmental stage:48 hpf direction:posterior/inflow tract to anterior/outflow tract; located in sections #49 #96|section thickness:10µm sections | heart2 2dpf wt | Paired end reads were aligned to the transcriptome using bwa version 0.6.2 with default parameters. The zebrafish transcriptome was based on genome release zv9 and contained improved gene annotations as described in Junker et al. 2014 Cell. The right mate of each read pair was mapped to the ensemble of all transcripts and to the set of 92 ERCC spike ins in sense direction. Reads mapping equally to multiple loci were discarded. Mapped reads were assigned to sections based on barcodes according to the CEL seq protocol Hashimshony et al. Cell Reports 2012 processed data files contain transcript read counts normalized against spike in read count and total read count per section Genome build: zv9 with improved three prime annotation see Junker et al 2014 Cell Supplementary files format and content: csv file containing transcript counts per gene rows and section columns | isolated embryonic heart | Unfixed embryonic hearts were dissected and embedded in tissue freezing medium. Blocks were cryosectioned and individual sections were transferred to Eppendorf tubes on dry ice. For extended experimental procedure see also Junker et al. 2014 Cell. | Total RNA was isolated by TRIzol extraction. mRNA was barcoded and amplified using the CEL seq protocol Hashimshony et al. Cell Reports 2012 see also: Junker et al. 2014 Cell CEL seq protocol Hashimshony et al. Cell Reports 2012; also see: Junker et al. 2014 Cell | tissue:embryonic heart|developmental stage:48 hpf direction:posterior/inflow tract to anterior/outflow tract; located in sections #49 #96|section thickness:10µm sections | GSM2788519 | GSM2788519: heart2 2dpf wt; Danio rerio; RNA Seq | GSM2788519 | 1 | Total RNA was isolated by TRIzol extraction. mRNA was barcoded and amplified using the CEL seq protocol Hashimshony et al. Cell Reports 2012 see also: Junker et al. 2014 Cell CEL seq protocol Hashimshony et al. Cell Reports 2012; also see: Junker et al. 2014 Cell | GEO Accession:GSM2788519 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP118319 | heart_02_SB-150707_R1.fastq.gz heart_02_SB-150707_R2.fastq.gz | fastq fastq | 5482437730.0 | 36337096.0 | GSM2788519 r1 | 0:75.41 1:75.47 | A:1859596349;C:686627791;G:950285046;T:1980208127;N:5720417 | 75 | 75 | 1859596349 | 686627791 | 950285046 | 1980208127 | 5720417 | SRX3201031 | SRS2528003 | SRA610777 | GEO | Jeroen Bakkers lab, Cardiac Development and Genetics, Hubrecht Institute | 2 | 0.14301 | 0.55835 | 0.12504 | 0.16935 | 0.99285 | 0.86334 | 0.46837 | 0.58661 | 76 | 74 | T | B | mate1 technical by mapping diff | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_plate | celseq | Netherlands | 2017-09-20 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||
| 43757 | 43757 | SRR6054091 | SRX3201030 | SRS2528002 | SRP118319 | PRJNA408129 | Spatially resolved RNA sequencing of the embryonic zebrafish heart | GSE104057 | Transcriptome Analysis | Development of specialized cell types and structures in the vertebrate heart is regulated by spatially restricted molecular pathways. Disruptions in these pathways can cause severe congenital cardiac malformations or functional defects. To better understand these pathways and how they regulate cardiac development and function we used tomo seq combining high throughput RNA sequencing with tissue sectioning to establish a genome wide expression dataset with high spatial resolution for the developing zebrafish heart. Analysis of the dataset revealed over 1100 genes differentially expressed in sub compartments. Pacemaker cells in the sinoatrial region induce heart contractions but little is known about the mechanisms underlying their development and function. Using our transcriptome map we identified spatially restricted Wnt/ß catenin signaling activity in pacemaker cells which was controlled by Islet 1 activity. Moreover Wnt/ß catenin signaling at a specific developmental stage in the myocardium controls heart rate by regulating pacemaker cellular response to parasympathetic stimuli. Thus this high resolution transcriptome map incorporating all cell types in the embryonic heart can expose spatially restricted molecular pathways critical for specific cardiac functions. Overall design: To generate spatially resolved RNA seq data for the developing zebrafish hearts 2 dpf we cryosectioned 3 hearts extracted RNA from the individual sections amplified and barcoded mRNA using the CEL seq protocol Hashimshony et al. Cell Reports 2012 with a few modifications. Libraries were sequenced on Illumina NextSeq using 75bp paired end sequencing. Sample Heart #1 is the primary sample. Heart #2 and #3 are biological replicates used for comparison. | pubmed:29400650 | heart1 2dpf wt | GSM2788518 | source name:isolated embryonic heart|tissue:embryonic heart|developmental stage:48 hpf direction:anterior/outflow tract to posterior/inflow tract; located in sections #2 #41|section thickness:10µm sections | heart1 2dpf wt | Paired end reads were aligned to the transcriptome using bwa version 0.6.2 with default parameters. The zebrafish transcriptome was based on genome release zv9 and contained improved gene annotations as described in Junker et al. 2014 Cell. The right mate of each read pair was mapped to the ensemble of all transcripts and to the set of 92 ERCC spike ins in sense direction. Reads mapping equally to multiple loci were discarded. Mapped reads were assigned to sections based on barcodes according to the CEL seq protocol Hashimshony et al. Cell Reports 2012 processed data files contain transcript read counts normalized against spike in read count and total read count per section Genome build: zv9 with improved three prime annotation see Junker et al 2014 Cell Supplementary files format and content: csv file containing transcript counts per gene rows and section columns | isolated embryonic heart | Unfixed embryonic hearts were dissected and embedded in tissue freezing medium. Blocks were cryosectioned and individual sections were transferred to Eppendorf tubes on dry ice. For extended experimental procedure see also Junker et al. 2014 Cell. | Total RNA was isolated by TRIzol extraction. mRNA was barcoded and amplified using the CEL seq protocol Hashimshony et al. Cell Reports 2012 see also: Junker et al. 2014 Cell CEL seq protocol Hashimshony et al. Cell Reports 2012; also see: Junker et al. 2014 Cell | tissue:embryonic heart|developmental stage:48 hpf direction:anterior/outflow tract to posterior/inflow tract; located in sections #2 #41|section thickness:10µm sections | GSM2788518 | GSM2788518: heart1 2dpf wt; Danio rerio; RNA Seq | GSM2788518 | 1 | Total RNA was isolated by TRIzol extraction. mRNA was barcoded and amplified using the CEL seq protocol Hashimshony et al. Cell Reports 2012 see also: Junker et al. 2014 Cell CEL seq protocol Hashimshony et al. Cell Reports 2012; also see: Junker et al. 2014 Cell | GEO Accession:GSM2788518 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP118319 | heart_01_SB-06-2dpf_wt_R2.fastq.gz heart_01_SB-06-2dpf_wt_R1.fastq.gz | fastq fastq | 8152229052.0 | 54104958.0 | GSM2788518 r1 | 0:75.41 1:75.27 | A:2955268830;C:1118145970;G:1152323290;T:2924136690;N:2354272 | 75 | 75 | 2955268830 | 1118145970 | 1152323290 | 2924136690 | 2354272 | SRX3201030 | SRS2528002 | SRA610777 | GEO | Jeroen Bakkers lab, Cardiac Development and Genetics, Hubrecht Institute | 2 | 0.02706 | 0.26955 | 0.01984 | 0.05871 | 0.99675 | 0.93194 | 0.37979 | 0.63172 | 76 | 76 | T | B | mate1 technical by mapping diff | illumina | nextseq | unknown | cdna_unspecified | unknown | sc | single_cell_plate | celseq | Netherlands | 2017-09-20 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||
| 48199 | 48199 | SRR7119866 | SRX4041509 | SRS3258988 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf mut 35 | GSM3131257 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 2dpf mut 35 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | GSM3131257 | GSM3131257: Danio rerio RNAseq singleHeart 2dpf mut 35; Danio rerio; RNA Seq | GSM3131257 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131257 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_35_NDCII_sample_0035.fastq.gz | fastq | 137582100.0 | 1834428.0 | GSM3131257 r1 | 0:75 | A:42420010;C:23366189;G:30187957;T:41528798;N:79146 | 75 | 42420010 | 23366189 | 30187957 | 41528798 | 79146 | SRX4041509 | SRS3258988 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.69634 | 0.15154 | 0.85827 | 0.50259 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48200 | 48200 | SRR7119865 | SRX4041508 | SRS3258987 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf mut 34 | GSM3131256 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 2dpf mut 34 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | GSM3131256 | GSM3131256: Danio rerio RNAseq singleHeart 2dpf mut 34; Danio rerio; RNA Seq | GSM3131256 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131256 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_34_NDCII_sample_0034.fastq.gz | fastq | 115231725.0 | 1536423.0 | GSM3131256 r1 | 0:75 | A:36189151;C:19748534;G:25280516;T:33944039;N:69485 | 75 | 36189151 | 19748534 | 25280516 | 33944039 | 69485 | SRX4041508 | SRS3258987 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.65755 | 0.14147 | 0.8635 | 0.53314 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48201 | 48201 | SRR7119864 | SRX4041507 | SRS3258986 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf mut 33 | GSM3131255 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 2dpf mut 33 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | GSM3131255 | GSM3131255: Danio rerio RNAseq singleHeart 2dpf mut 33; Danio rerio; RNA Seq | GSM3131255 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131255 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_33_NDCII_sample_0033.fastq.gz | fastq | 86985525.0 | 1159807.0 | GSM3131255 r1 | 0:75 | A:27397325;C:14512545;G:19080050;T:25941403;N:54202 | 75 | 27397325 | 14512545 | 19080050 | 25941403 | 54202 | SRX4041507 | SRS3258986 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.63426 | 0.16676 | 0.87568 | 0.5457 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48202 | 48202 | SRR7119863 | SRX4041506 | SRS3258985 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf mut 32 | GSM3131254 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 2dpf mut 32 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | GSM3131254 | GSM3131254: Danio rerio RNAseq singleHeart 2dpf mut 32; Danio rerio; RNA Seq | GSM3131254 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131254 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_32_NDCII_sample_0032.fastq.gz | fastq | 64224375.0 | 856325.0 | GSM3131254 r1 | 0:75 | A:20154725;C:11180349;G:13983116;T:18869397;N:36788 | 75 | 20154725 | 11180349 | 13983116 | 18869397 | 36788 | SRX4041506 | SRS3258985 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.65978 | 0.16164 | 0.8775 | 0.54741 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48203 | 48203 | SRR7119862 | SRX4041505 | SRS3258984 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf mut 31 | GSM3131253 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 2dpf mut 31 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | GSM3131253 | GSM3131253: Danio rerio RNAseq singleHeart 2dpf mut 31; Danio rerio; RNA Seq | GSM3131253 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131253 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_31_NDCII_sample_0031.fastq.gz | fastq | 159901350.0 | 2132018.0 | GSM3131253 r1 | 0:75 | A:50993443;C:26156045;G:34865968;T:47792042;N:93852 | 75 | 50993443 | 26156045 | 34865968 | 47792042 | 93852 | SRX4041505 | SRS3258984 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.6343 | 0.22382 | 0.84707 | 0.44037 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48204 | 48204 | SRR7119861 | SRX4041504 | SRS3258983 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf mut 29 | GSM3131252 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 2dpf mut 29 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | GSM3131252 | GSM3131252: Danio rerio RNAseq singleHeart 2dpf mut 29; Danio rerio; RNA Seq | GSM3131252 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131252 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_29_NDCII_sample_0029.fastq.gz | fastq | 205405950.0 | 2738746.0 | GSM3131252 r1 | 0:75 | A:64163069;C:34538013;G:45210194;T:61373525;N:121149 | 75 | 64163069 | 34538013 | 45210194 | 61373525 | 121149 | SRX4041504 | SRS3258983 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.65436 | 0.20449 | 0.84831 | 0.52226 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48205 | 48205 | SRR7119860 | SRX4041503 | SRS3258982 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf mut 28 | GSM3131251 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 2dpf mut 28 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | GSM3131251 | GSM3131251: Danio rerio RNAseq singleHeart 2dpf mut 28; Danio rerio; RNA Seq | GSM3131251 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131251 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_28_NDCII_sample_0028.fastq.gz | fastq | 88773525.0 | 1183647.0 | GSM3131251 r1 | 0:75 | A:27560501;C:15646178;G:19351624;T:26163900;N:51322 | 75 | 27560501 | 15646178 | 19351624 | 26163900 | 51322 | SRX4041503 | SRS3258982 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.67182 | 0.16278 | 0.86527 | 0.53604 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48206 | 48206 | SRR7119859 | SRX4041502 | SRS3258981 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf mut 27 | GSM3131250 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 2dpf mut 27 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | GSM3131250 | GSM3131250: Danio rerio RNAseq singleHeart 2dpf mut 27; Danio rerio; RNA Seq | GSM3131250 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131250 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_27_NDCII_sample_0027.fastq.gz | fastq | 135825300.0 | 1811004.0 | GSM3131250 r1 | 0:75 | A:42874929;C:23016416;G:29588893;T:40267147;N:77915 | 75 | 42874929 | 23016416 | 29588893 | 40267147 | 77915 | SRX4041502 | SRS3258981 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.64606 | 0.13997 | 0.86401 | 0.53196 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48207 | 48207 | SRR7119858 | SRX4041501 | SRS3258980 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf mut 26 | GSM3131249 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | Danio rerio RNAseq singleHeart 2dpf mut 26 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / | GSM3131249 | GSM3131249: Danio rerio RNAseq singleHeart 2dpf mut 26; Danio rerio; RNA Seq | GSM3131249 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131249 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_26_NDCII_sample_0026.fastq.gz | fastq | 70861500.0 | 944820.0 | GSM3131249 r1 | 0:75 | A:22209781;C:12313683;G:15411508;T:20885853;N:40675 | 75 | 22209781 | 12313683 | 15411508 | 20885853 | 40675 | SRX4041501 | SRS3258980 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.65979 | 0.17285 | 0.8687 | 0.51907 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48218 | 48218 | SRR7119847 | SRX4041490 | SRS3258968 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf wt 14 | GSM3131238 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 2dpf wt 14 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | GSM3131238 | GSM3131238: Danio rerio RNAseq singleHeart 2dpf wt 14; Danio rerio; RNA Seq | GSM3131238 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131238 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_14_NDCII_sample_0014.fastq.gz | fastq | 81736125.0 | 1089815.0 | GSM3131238 r1 | 0:75 | A:25374411;C:14225355;G:17601172;T:24489651;N:45536 | 75 | 25374411 | 14225355 | 17601172 | 24489651 | 45536 | SRX4041490 | SRS3258968 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.68142 | 0.17857 | 0.86965 | 0.53118 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48219 | 48219 | SRR7119846 | SRX4041489 | SRS3258967 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf wt 13 | GSM3131237 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 2dpf wt 13 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | GSM3131237 | GSM3131237: Danio rerio RNAseq singleHeart 2dpf wt 13; Danio rerio; RNA Seq | GSM3131237 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131237 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_13_NDCII_sample_0013.fastq.gz | fastq | 62250900.0 | 830012.0 | GSM3131237 r1 | 0:75 | A:19221325;C:10606446;G:13851770;T:18535596;N:35763 | 75 | 19221325 | 10606446 | 13851770 | 18535596 | 35763 | SRX4041489 | SRS3258967 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.67033 | 0.16463 | 0.88669 | 0.52197 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48220 | 48220 | SRR7119845 | SRX4041488 | SRS3258966 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf wt 12 | GSM3131236 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 2dpf wt 12 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | GSM3131236 | GSM3131236: Danio rerio RNAseq singleHeart 2dpf wt 12; Danio rerio; RNA Seq | GSM3131236 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131236 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_12_NDCII_sample_0012.fastq.gz | fastq | 65079975.0 | 867733.0 | GSM3131236 r1 | 0:75 | A:20574087;C:11008240;G:14305699;T:19155761;N:36188 | 75 | 20574087 | 11008240 | 14305699 | 19155761 | 36188 | SRX4041488 | SRS3258966 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.65516 | 0.23525 | 0.87227 | 0.55436 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48221 | 48221 | SRR7119844 | SRX4041487 | SRS3258965 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf wt 11 | GSM3131235 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 2dpf wt 11 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | GSM3131235 | GSM3131235: Danio rerio RNAseq singleHeart 2dpf wt 11; Danio rerio; RNA Seq | GSM3131235 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131235 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_11_NDCII_sample_0011.fastq.gz | fastq | 56312400.0 | 750832.0 | GSM3131235 r1 | 0:75 | A:17682751;C:9499488;G:12398396;T:16701718;N:30047 | 75 | 17682751 | 9499488 | 12398396 | 16701718 | 30047 | SRX4041487 | SRS3258965 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.66642 | 0.21243 | 0.87868 | 0.52403 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48222 | 48222 | SRR7119843 | SRX4041486 | SRS3258964 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf wt 10 | GSM3131234 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 2dpf wt 10 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | GSM3131234 | GSM3131234: Danio rerio RNAseq singleHeart 2dpf wt 10; Danio rerio; RNA Seq | GSM3131234 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131234 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_10_NDCII_sample_0010.fastq.gz | fastq | 51364950.0 | 684866.0 | GSM3131234 r1 | 0:75 | A:16163832;C:8838505;G:11290003;T:15043422;N:29188 | 75 | 16163832 | 8838505 | 11290003 | 15043422 | 29188 | SRX4041486 | SRS3258964 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.65278 | 0.18749 | 0.87722 | 0.53824 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48223 | 48223 | SRR7119842 | SRX4041485 | SRS3258963 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf wt 9 | GSM3131233 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 2dpf wt 9 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | GSM3131233 | GSM3131233: Danio rerio RNAseq singleHeart 2dpf wt 9; Danio rerio; RNA Seq | GSM3131233 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131233 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_9_NDCII_sample_0009.fastq.gz | fastq | 149036325.0 | 1987151.0 | GSM3131233 r1 | 0:75 | A:47706695;C:23942760;G:33072602;T:44228491;N:85777 | 75 | 47706695 | 23942760 | 33072602 | 44228491 | 85777 | SRX4041485 | SRS3258963 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.56223 | 0.19674 | 0.87079 | 0.52559 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48224 | 48224 | SRR7119841 | SRX4041484 | SRS3258962 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf wt 8 | GSM3131232 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 2dpf wt 8 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | GSM3131232 | GSM3131232: Danio rerio RNAseq singleHeart 2dpf wt 8; Danio rerio; RNA Seq | GSM3131232 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131232 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_8_NDCII_sample_0008.fastq.gz | fastq | 61857375.0 | 824765.0 | GSM3131232 r1 | 0:75 | A:19180813;C:10701206;G:13569705;T:18368818;N:36833 | 75 | 19180813 | 10701206 | 13569705 | 18368818 | 36833 | SRX4041484 | SRS3258962 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.68869 | 0.14177 | 0.86722 | 0.50808 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48225 | 48225 | SRR7119840 | SRX4041483 | SRS3258960 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf wt 7 | GSM3131231 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 2dpf wt 7 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | GSM3131231 | GSM3131231: Danio rerio RNAseq singleHeart 2dpf wt 7; Danio rerio; RNA Seq | GSM3131231 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131231 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_7_NDCII_sample_0007.fastq.gz | fastq | 34999125.0 | 466655.0 | GSM3131231 r1 | 0:75 | A:10839927;C:6031095;G:7710789;T:10397147;N:20167 | 75 | 10839927 | 6031095 | 7710789 | 10397147 | 20167 | SRX4041483 | SRS3258960 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.67853 | 0.1345 | 0.89727 | 0.42905 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48226 | 48226 | SRR7119839 | SRX4041482 | SRS3258959 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf wt 6 | GSM3131230 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 2dpf wt 6 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | GSM3131230 | GSM3131230: Danio rerio RNAseq singleHeart 2dpf wt 6; Danio rerio; RNA Seq | GSM3131230 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131230 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_6_NDCII_sample_0006.fastq.gz | fastq | 53258025.0 | 710107.0 | GSM3131230 r1 | 0:75 | A:16706696;C:9150576;G:11345601;T:16024331;N:30821 | 75 | 16706696 | 9150576 | 11345601 | 16024331 | 30821 | SRX4041482 | SRS3258959 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.6829 | 0.14834 | 0.87799 | 0.49352 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48227 | 48227 | SRR7119838 | SRX4041481 | SRS3258958 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf wt 5 | GSM3131229 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 2dpf wt 5 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | GSM3131229 | GSM3131229: Danio rerio RNAseq singleHeart 2dpf wt 5; Danio rerio; RNA Seq | GSM3131229 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131229 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_5_NDCII_sample_0005.fastq.gz | fastq | 46391850.0 | 618558.0 | GSM3131229 r1 | 0:75 | A:14186549;C:7964105;G:10302794;T:13910329;N:28073 | 75 | 14186549 | 7964105 | 10302794 | 13910329 | 28073 | SRX4041481 | SRS3258958 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.67937 | 0.14832 | 0.88274 | 0.51203 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48228 | 48228 | SRR7119837 | SRX4041480 | SRS3258957 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf wt 4 | GSM3131228 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 2dpf wt 4 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | GSM3131228 | GSM3131228: Danio rerio RNAseq singleHeart 2dpf wt 4; Danio rerio; RNA Seq | GSM3131228 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131228 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_4_NDCII_sample_0004.fastq.gz | fastq | 119548650.0 | 1593982.0 | GSM3131228 r1 | 0:75 | A:37089578;C:20710248;G:25820048;T:35861658;N:67118 | 75 | 37089578 | 20710248 | 25820048 | 35861658 | 67118 | SRX4041480 | SRS3258957 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.67925 | 0.18634 | 0.84431 | 0.49844 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48229 | 48229 | SRR7119836 | SRX4041479 | SRS3258956 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf wt 3 | GSM3131227 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 2dpf wt 3 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | GSM3131227 | GSM3131227: Danio rerio RNAseq singleHeart 2dpf wt 3; Danio rerio; RNA Seq | GSM3131227 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131227 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_3_NDCII_sample_0003.fastq.gz | fastq | 52534500.0 | 700460.0 | GSM3131227 r1 | 0:75 | A:16258360;C:8995544;G:11338397;T:15914972;N:27227 | 75 | 16258360 | 8995544 | 11338397 | 15914972 | 27227 | SRX4041479 | SRS3258956 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.68677 | 0.14664 | 0.87541 | 0.49296 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 48230 | 48230 | SRR7119835 | SRX4041478 | SRS3258955 | SRP144601 | PRJNA459724 | The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis | GSE114038 | Other | Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1 2 3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos wild types and rnf2 mutants 8 and 7 replicates respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1 2 dpf and 3 dpf Danio rerio dissected hearts wild types 9 13 and 10 replicates respectively and rnf2 mutants 8 9 and 9 replicates respectively | pubmed:30867528 | Danio rerio RNAseq singleHeart 2dpf wt 2 | GSM3131226 | tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | Danio rerio RNAseq singleHeart 2dpf wt 2 | RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format | heart | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | Zebrafish Danio rerio were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al. 1995. | strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2+/+ | GSM3131226 | GSM3131226: Danio rerio RNAseq singleHeart 2dpf wt 2; Danio rerio; RNA Seq | GSM3131226 | 1 | RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation cDNA synthesis and KAPA HYPERprep library preparation | GEO Accession:GSM3131226 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP144601 | NDCII_1_2_NDCII_sample_0002.fastq.gz | fastq | 27282075.0 | 363761.0 | GSM3131226 r1 | 0:75 | A:8540828;C:4756416;G:5793210;T:8176534;N:15087 | 75 | 8540828 | 4756416 | 5793210 | 8176534 | 15087 | SRX4041478 | SRS3258955 | SRA699717 | GEO | Molecular Biology, Radboud University | 1 | 0.689 | 0.16716 | 0.89512 | 0.51016 | 75 | B | usable mapping rate | illumina | nextseq | unknown | rrna_depletion | ribozero | sc | single_cell_plate | celseq | Netherlands | 2018-05-04 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 51326 | 51326 | SRR8749828 | SRX5540806 | SRS4506468 | SRP188811 | PRJNA527965 | Loss of Pitx2c predisposes to arrhythmia and atrial fibrillation pathologies via structural and metabolic dysfunction | GSE128511 | Transcriptome Analysis | RNAseq profiling of embryonic zebrafish hearts was performed to identify differentially expressed genes downstream of Pitx2c. Overall design: Embryonic hearts were dissected from wild type pitx2c mutants and pitx2c gain of function OE embryos at 56 hpf | pubmed:31704768 | WT 2: wild type | GSM3678230 | source name:pools of 56 hpf hearts|tissue:embryonic heart|Stage:56 hpf|genotype/variation:wild type | WT 2: wild type | Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides Davis et al. Kraken: A set of tools for quality control and analysis of high throughput sequence data. Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “ outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10% The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers Activities at the Universal Protein Resource UniProt. Genome build: DanRer10 GRCz10.87 Supplementary files format and content: tab delimited text files include library size normlized counts per peak | pools of 56 hpf hearts | Hearts were dissected from embryos in HBSS. RNA was isolated using miRNeasy micro kit QIAGEN with on column DNase digestion 5ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | Embryos were grown at 28C until 56 hpf | tissue:embryonic heart|Stage:56 hpf|genotype/variation:wild type | GSM3678230 | GSM3678230: WT 2: wild type; Danio rerio; RNA Seq | GSM3678230 | 1 | Hearts were dissected from embryos in HBSS. RNA was isolated using miRNeasy micro kit QIAGEN with on column DNase digestion 5ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | GEO Accession:GSM3678230 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP188811 | Collins_WT_2_R1.fastq | fastq | 2390404958.0 | 32822627.0 | GSM3678230 r1 | 0:72.83 1:0 | A:552325647;C:659838666;G:697513393;T:480649608;N:77644 | 72 | 0 | 552325647 | 659838666 | 697513393 | 480649608 | 77644 | SRX5540806 | SRS4506468 | SRA861990 | GEO | MPI for heart and lung research | 1 | 0.94464 | 0.29455 | 0.80945 | 0.66009 | 75 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | Germany | 2019-03-19 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||
| 51327 | 51327 | SRR8749827 | SRX5540805 | SRS4506467 | SRP188811 | PRJNA527965 | Loss of Pitx2c predisposes to arrhythmia and atrial fibrillation pathologies via structural and metabolic dysfunction | GSE128511 | Transcriptome Analysis | RNAseq profiling of embryonic zebrafish hearts was performed to identify differentially expressed genes downstream of Pitx2c. Overall design: Embryonic hearts were dissected from wild type pitx2c mutants and pitx2c gain of function OE embryos at 56 hpf | pubmed:31704768 | WT 1: wild type | GSM3678229 | source name:pools of 56 hpf hearts|tissue:embryonic heart|Stage:56 hpf|genotype/variation:wild type | WT 1: wild type | Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides Davis et al. Kraken: A set of tools for quality control and analysis of high throughput sequence data. Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “ outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10% The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers Activities at the Universal Protein Resource UniProt. Genome build: DanRer10 GRCz10.87 Supplementary files format and content: tab delimited text files include library size normlized counts per peak | pools of 56 hpf hearts | Hearts were dissected from embryos in HBSS. RNA was isolated using miRNeasy micro kit QIAGEN with on column DNase digestion 5ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | Embryos were grown at 28C until 56 hpf | tissue:embryonic heart|Stage:56 hpf|genotype/variation:wild type | GSM3678229 | GSM3678229: WT 1: wild type; Danio rerio; RNA Seq | GSM3678229 | 1 | Hearts were dissected from embryos in HBSS. RNA was isolated using miRNeasy micro kit QIAGEN with on column DNase digestion 5ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | GEO Accession:GSM3678229 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP188811 | Collins_WT_1_R1.fastq | fastq | 2611972794.0 | 35734636.0 | GSM3678229 r1 | 0:73.09 1:0 | A:626940885;C:701243949;G:741441019;T:542275683;N:71258 | 73 | 0 | 626940885 | 701243949 | 741441019 | 542275683 | 71258 | SRX5540805 | SRS4506467 | SRA861990 | GEO | MPI for heart and lung research | 1 | 0.91014 | 0.26179 | 0.80547 | 0.70064 | 47 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | Germany | 2019-03-19 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||
| 51328 | 51328 | SRR8749826 | SRX5540804 | SRS4506466 | SRP188811 | PRJNA527965 | Loss of Pitx2c predisposes to arrhythmia and atrial fibrillation pathologies via structural and metabolic dysfunction | GSE128511 | Transcriptome Analysis | RNAseq profiling of embryonic zebrafish hearts was performed to identify differentially expressed genes downstream of Pitx2c. Overall design: Embryonic hearts were dissected from wild type pitx2c mutants and pitx2c gain of function OE embryos at 56 hpf | pubmed:31704768 | pitx2 OE 2: Tgmyl7:pitx2c P2A H2B GFP hearts pool2 | GSM3678228 | source name:pools of 56 hpf hearts|tissue:embryonic heart|Stage:56 hpf|genotype/variation:pitx2c gain of function OE | pitx2 OE 2: Tgmyl7:pitx2c P2A H2B GFP hearts pool2 | Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides Davis et al. Kraken: A set of tools for quality control and analysis of high throughput sequence data. Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “ outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10% The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers Activities at the Universal Protein Resource UniProt. Genome build: DanRer10 GRCz10.87 Supplementary files format and content: tab delimited text files include library size normlized counts per peak | pools of 56 hpf hearts | Hearts were dissected from embryos in HBSS. RNA was isolated using miRNeasy micro kit QIAGEN with on column DNase digestion 5ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | Embryos were grown at 28C until 56 hpf | tissue:embryonic heart|Stage:56 hpf|genotype/variation:pitx2c gain of function OE | GSM3678228 | GSM3678228: pitx2 OE 2: Tgmyl7:pitx2c P2A H2B GFP hearts pool2; Danio rerio; RNA Seq | GSM3678228 | 1 | Hearts were dissected from embryos in HBSS. RNA was isolated using miRNeasy micro kit QIAGEN with on column DNase digestion 5ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | GEO Accession:GSM3678228 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP188811 | Collins_OE_2_R1.fastq | fastq | 2321032444.0 | 33821461.0 | GSM3678228 r1 | 0:68.63 1:0 | A:563412800;C:620166045;G:657114821;T:480084057;N:254721 | 68 | 0 | 563412800 | 620166045 | 657114821 | 480084057 | 254721 | SRX5540804 | SRS4506466 | SRA861990 | GEO | MPI for heart and lung research | 1 | 0.89708 | 0.30156 | 0.79093 | 0.7089 | 61 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | Germany | 2019-03-19 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||
| 51329 | 51329 | SRR8749825 | SRX5540803 | SRS4506465 | SRP188811 | PRJNA527965 | Loss of Pitx2c predisposes to arrhythmia and atrial fibrillation pathologies via structural and metabolic dysfunction | GSE128511 | Transcriptome Analysis | RNAseq profiling of embryonic zebrafish hearts was performed to identify differentially expressed genes downstream of Pitx2c. Overall design: Embryonic hearts were dissected from wild type pitx2c mutants and pitx2c gain of function OE embryos at 56 hpf | pubmed:31704768 | pitx2 OE 1: Tgmyl7:pitx2c P2A H2B GFP hearts pool1 | GSM3678227 | source name:pools of 56 hpf hearts|tissue:embryonic heart|Stage:56 hpf|genotype/variation:pitx2c gain of function OE | pitx2 OE 1: Tgmyl7:pitx2c P2A H2B GFP hearts pool1 | Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides Davis et al. Kraken: A set of tools for quality control and analysis of high throughput sequence data. Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “ outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10% The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers Activities at the Universal Protein Resource UniProt. Genome build: DanRer10 GRCz10.87 Supplementary files format and content: tab delimited text files include library size normlized counts per peak | pools of 56 hpf hearts | Hearts were dissected from embryos in HBSS. RNA was isolated using miRNeasy micro kit QIAGEN with on column DNase digestion 5ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | Embryos were grown at 28C until 56 hpf | tissue:embryonic heart|Stage:56 hpf|genotype/variation:pitx2c gain of function OE | GSM3678227 | GSM3678227: pitx2 OE 1: Tgmyl7:pitx2c P2A H2B GFP hearts pool1; Danio rerio; RNA Seq | GSM3678227 | 1 | Hearts were dissected from embryos in HBSS. RNA was isolated using miRNeasy micro kit QIAGEN with on column DNase digestion 5ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | GEO Accession:GSM3678227 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP188811 | Collins_OE_1_R1.fastq | fastq | 2478620369.0 | 34144926.0 | GSM3678227 r1 | 0:72.59 1:0 | A:576478807;C:678567598;G:723814977;T:499663199;N:95788 | 72 | 0 | 576478807 | 678567598 | 723814977 | 499663199 | 95788 | SRX5540803 | SRS4506465 | SRA861990 | GEO | MPI for heart and lung research | 1 | 0.90288 | 0.27227 | 0.80373 | 0.63866 | 75 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | Germany | 2019-03-19 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||
| 51330 | 51330 | SRR8749824 | SRX5540802 | SRS4506464 | SRP188811 | PRJNA527965 | Loss of Pitx2c predisposes to arrhythmia and atrial fibrillation pathologies via structural and metabolic dysfunction | GSE128511 | Transcriptome Analysis | RNAseq profiling of embryonic zebrafish hearts was performed to identify differentially expressed genes downstream of Pitx2c. Overall design: Embryonic hearts were dissected from wild type pitx2c mutants and pitx2c gain of function OE embryos at 56 hpf | pubmed:31704768 | pitx2 Mut 2: pitx2c mutant hearts pool2 | GSM3678226 | source name:pools of 56 hpf hearts|tissue:embryonic heart|Stage:56 hpf|genotype/variation:pitx2c mutant | pitx2 Mut 2: pitx2c mutant hearts pool2 | Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides Davis et al. Kraken: A set of tools for quality control and analysis of high throughput sequence data. Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “ outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10% The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers Activities at the Universal Protein Resource UniProt. Genome build: DanRer10 GRCz10.87 Supplementary files format and content: tab delimited text files include library size normlized counts per peak | pools of 56 hpf hearts | Hearts were dissected from embryos in HBSS. RNA was isolated using miRNeasy micro kit QIAGEN with on column DNase digestion 5ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | Embryos were grown at 28C until 56 hpf | tissue:embryonic heart|Stage:56 hpf|genotype/variation:pitx2c mutant | GSM3678226 | GSM3678226: pitx2 Mut 2: pitx2c mutant hearts pool2; Danio rerio; RNA Seq | GSM3678226 | 1 | Hearts were dissected from embryos in HBSS. RNA was isolated using miRNeasy micro kit QIAGEN with on column DNase digestion 5ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | GEO Accession:GSM3678226 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP188811 | Collins_Mut_2_R1.fastq | fastq | 2584103696.0 | 35478208.0 | GSM3678226 r1 | 0:72.84 1:0 | A:618665618;C:698132416;G:731922652;T:535325796;N:57214 | 72 | 0 | 618665618 | 698132416 | 731922652 | 535325796 | 57214 | SRX5540802 | SRS4506464 | SRA861990 | GEO | MPI for heart and lung research | 1 | 0.94355 | 0.31073 | 0.80631 | 0.70865 | 75 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | Germany | 2019-03-19 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||
| 51331 | 51331 | SRR8749823 | SRX5540801 | SRS4506463 | SRP188811 | PRJNA527965 | Loss of Pitx2c predisposes to arrhythmia and atrial fibrillation pathologies via structural and metabolic dysfunction | GSE128511 | Transcriptome Analysis | RNAseq profiling of embryonic zebrafish hearts was performed to identify differentially expressed genes downstream of Pitx2c. Overall design: Embryonic hearts were dissected from wild type pitx2c mutants and pitx2c gain of function OE embryos at 56 hpf | pubmed:31704768 | pitx2 Mut 1: pitx2c mutant hearts pool1 | GSM3678225 | source name:pools of 56 hpf hearts|tissue:embryonic heart|Stage:56 hpf|genotype/variation:pitx2c mutant | pitx2 Mut 1: pitx2c mutant hearts pool1 | Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides Davis et al. Kraken: A set of tools for quality control and analysis of high throughput sequence data. Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “ outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10% The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers Activities at the Universal Protein Resource UniProt. Genome build: DanRer10 GRCz10.87 Supplementary files format and content: tab delimited text files include library size normlized counts per peak | pools of 56 hpf hearts | Hearts were dissected from embryos in HBSS. RNA was isolated using miRNeasy micro kit QIAGEN with on column DNase digestion 5ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | Embryos were grown at 28C until 56 hpf | tissue:embryonic heart|Stage:56 hpf|genotype/variation:pitx2c mutant | GSM3678225 | GSM3678225: pitx2 Mut 1: pitx2c mutant hearts pool1; Danio rerio; RNA Seq | GSM3678225 | 1 | Hearts were dissected from embryos in HBSS. RNA was isolated using miRNeasy micro kit QIAGEN with on column DNase digestion 5ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | GEO Accession:GSM3678225 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP188811 | Collins_Mut_1_R1.fastq | fastq | 2274651284.0 | 31338489.0 | GSM3678225 r1 | 0:72.58 1:0 | A:533818294;C:618635240;G:662923918;T:459213631;N:60201 | 72 | 0 | 533818294 | 618635240 | 662923918 | 459213631 | 60201 | SRX5540801 | SRS4506463 | SRA861990 | GEO | MPI for heart and lung research | 1 | 0.87353 | 0.27508 | 0.82016 | 0.73338 | 34 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | smarter | bulk | unknown | unknown | Germany | 2019-03-19 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||
| 56287 | 56287 | SRR10902601 | SRX7570775 | SRS6006445 | SRP242182 | PRJNA601645 | Identification of TGF b targets in the cardiac outflow tract by transcriptomic analysis | GSE143770 | Transcriptome Analysis | Purpose: identifying with RNA seq genes targets of Alk5 during the development of the cardiac outflow tract in zebrafish. Results: we identified several differential expressed genes with an enrichment in ECM component genes. As a proof of concept many TGFb known targets also appeared downregulated. Overall design: Zebrafish embryos were treated with Alk5 inhibitor E 616452 or DMSO and hearts were manually extracted at 56 hpf. | pubmed:32990594 | Hearts Inhibitor 2 | GSM4274436 | source name:Hearts|age:56 hpf|genotype:Tgkdrl:eGFP|treatment:Alk5 inhibitor|tissue:Hearts | Hearts Inhibitor 2 | The resulting raw reads were assessed for quality adapter content and duplication rates with FastQC Reaper version 13 100 was used to trim reads with a quality drop below a mean of Q20 in a window of 10 nucleotides Davis et al. 2013. Only reads between 30 and 150 nucleotides were used in subsequent analyses. Trimmed and filtered reads were aligned versus the Ensembl Zebrafish genome version DanRer11 GRCz11.92 using STAR 2.4.0a with the parameter “outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10% The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package Liao et al. 2014. Only reads mapping at least partially inside exons were admitted and aggregated per gene while reads overlapping multiple genes or aligning to multiple regions were excluded from further analyses. Differentially expressed genes were identified using DESeq2 version 1.18.1Love et al. 2014. To remove a batch effect from the comparison the replicates were presented to DESeq2 as covariates DMSO 1/Inhib 1 = 1 DMSO 2/Inhib 2 = 2. The raw count matrix was batch corrected using CountClust Dey et al. 2017 and then normalized with DESeq2. Genome build: DanRer11 Supplementary files format and content: library size normalized counts | Hearts | Hearts from 56 hpf Tgkdrl:EGFP control and Alk5 inhibitor treated embryos were manually dissected using forceps. Approximately 20 hearts per replicate were pooled and total RNA was isolated using the miRNeasy micro kit Qiagen combined with on column DNase digestion 100 ng of total RNA was used as input for VAHTS Stranded mRNA seq Library Vazyme preparation following manufacture’s protocol Vazyme. | age:56 hpf|genotype:Tgkdrl:eGFP|treatment:Alk5 inhibitor|tissue:Hearts | GSM4274436 | GSM4274436: Hearts Inhibitor 2; Danio rerio; RNA Seq | GSM4274436 | 1 | Hearts from 56 hpf Tgkdrl:EGFP control and Alk5 inhibitor treated embryos were manually dissected using forceps. Approximately 20 hearts per replicate were pooled and total RNA was isolated using the miRNeasy micro kit Qiagen combined with on column DNase digestion 100 ng of total RNA was used as input for VAHTS Stranded mRNA seq Library Vazyme preparation following manufacture's protocol Vazyme. | GEO Accession:GSM4274436 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP242182 | Giulia_Inhibitor_2_R1.fastq.gz | fastq | 3042440414.0 | 40841128.0 | GSM4274436 r1 | 0:74.49 1:0 | A:750770857;C:686106365;G:725401121;T:879970334;N:191737 | 74 | 0 | 750770857 | 686106365 | 725401121 | 879970334 | 191737 | SRX7570775 | SRS6006445 | SRA1027132 | GEO | MPI for heart and lung research | 1 | 0.93428 | 0.0876 | 0.72523 | 0.47048 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Germany | 2020-01-16 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 56288 | 56288 | SRR10902600 | SRX7570774 | SRS6006444 | SRP242182 | PRJNA601645 | Identification of TGF b targets in the cardiac outflow tract by transcriptomic analysis | GSE143770 | Transcriptome Analysis | Purpose: identifying with RNA seq genes targets of Alk5 during the development of the cardiac outflow tract in zebrafish. Results: we identified several differential expressed genes with an enrichment in ECM component genes. As a proof of concept many TGFb known targets also appeared downregulated. Overall design: Zebrafish embryos were treated with Alk5 inhibitor E 616452 or DMSO and hearts were manually extracted at 56 hpf. | pubmed:32990594 | Hearts Inhibitor 1 | GSM4274435 | source name:Hearts|age:56 hpf|genotype:Tgkdrl:eGFP|treatment:Alk5 inhibitor|tissue:Hearts | Hearts Inhibitor 1 | The resulting raw reads were assessed for quality adapter content and duplication rates with FastQC Reaper version 13 100 was used to trim reads with a quality drop below a mean of Q20 in a window of 10 nucleotides Davis et al. 2013. Only reads between 30 and 150 nucleotides were used in subsequent analyses. Trimmed and filtered reads were aligned versus the Ensembl Zebrafish genome version DanRer11 GRCz11.92 using STAR 2.4.0a with the parameter “outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10% The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package Liao et al. 2014. Only reads mapping at least partially inside exons were admitted and aggregated per gene while reads overlapping multiple genes or aligning to multiple regions were excluded from further analyses. Differentially expressed genes were identified using DESeq2 version 1.18.1Love et al. 2014. To remove a batch effect from the comparison the replicates were presented to DESeq2 as covariates DMSO 1/Inhib 1 = 1 DMSO 2/Inhib 2 = 2. The raw count matrix was batch corrected using CountClust Dey et al. 2017 and then normalized with DESeq2. Genome build: DanRer11 Supplementary files format and content: library size normalized counts | Hearts | Hearts from 56 hpf Tgkdrl:EGFP control and Alk5 inhibitor treated embryos were manually dissected using forceps. Approximately 20 hearts per replicate were pooled and total RNA was isolated using the miRNeasy micro kit Qiagen combined with on column DNase digestion 100 ng of total RNA was used as input for VAHTS Stranded mRNA seq Library Vazyme preparation following manufacture’s protocol Vazyme. | age:56 hpf|genotype:Tgkdrl:eGFP|treatment:Alk5 inhibitor|tissue:Hearts | GSM4274435 | GSM4274435: Hearts Inhibitor 1; Danio rerio; RNA Seq | GSM4274435 | 1 | Hearts from 56 hpf Tgkdrl:EGFP control and Alk5 inhibitor treated embryos were manually dissected using forceps. Approximately 20 hearts per replicate were pooled and total RNA was isolated using the miRNeasy micro kit Qiagen combined with on column DNase digestion 100 ng of total RNA was used as input for VAHTS Stranded mRNA seq Library Vazyme preparation following manufacture's protocol Vazyme. | GEO Accession:GSM4274435 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP242182 | Giulia_Inhibitor_1_R1.fastq.gz | fastq | 2564227372.0 | 34412109.0 | GSM4274435 r1 | 0:74.52 1:0 | A:650232837;C:568744485;G:599321840;T:745827687;N:100523 | 74 | 0 | 650232837 | 568744485 | 599321840 | 745827687 | 100523 | SRX7570774 | SRS6006444 | SRA1027132 | GEO | MPI for heart and lung research | 1 | 0.93067 | 0.09475 | 0.71792 | 0.48381 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Germany | 2020-01-16 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 56289 | 56289 | SRR10902599 | SRX7570773 | SRS6006443 | SRP242182 | PRJNA601645 | Identification of TGF b targets in the cardiac outflow tract by transcriptomic analysis | GSE143770 | Transcriptome Analysis | Purpose: identifying with RNA seq genes targets of Alk5 during the development of the cardiac outflow tract in zebrafish. Results: we identified several differential expressed genes with an enrichment in ECM component genes. As a proof of concept many TGFb known targets also appeared downregulated. Overall design: Zebrafish embryos were treated with Alk5 inhibitor E 616452 or DMSO and hearts were manually extracted at 56 hpf. | pubmed:32990594 | Hearts DMSO 2 | GSM4274434 | source name:Hearts|age:56 hpf|genotype:Tgkdrl:eGFP|treatment:DMSO|tissue:Hearts | Hearts DMSO 2 | The resulting raw reads were assessed for quality adapter content and duplication rates with FastQC Reaper version 13 100 was used to trim reads with a quality drop below a mean of Q20 in a window of 10 nucleotides Davis et al. 2013. Only reads between 30 and 150 nucleotides were used in subsequent analyses. Trimmed and filtered reads were aligned versus the Ensembl Zebrafish genome version DanRer11 GRCz11.92 using STAR 2.4.0a with the parameter “outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10% The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package Liao et al. 2014. Only reads mapping at least partially inside exons were admitted and aggregated per gene while reads overlapping multiple genes or aligning to multiple regions were excluded from further analyses. Differentially expressed genes were identified using DESeq2 version 1.18.1Love et al. 2014. To remove a batch effect from the comparison the replicates were presented to DESeq2 as covariates DMSO 1/Inhib 1 = 1 DMSO 2/Inhib 2 = 2. The raw count matrix was batch corrected using CountClust Dey et al. 2017 and then normalized with DESeq2. Genome build: DanRer11 Supplementary files format and content: library size normalized counts | Hearts | Hearts from 56 hpf Tgkdrl:EGFP control and Alk5 inhibitor treated embryos were manually dissected using forceps. Approximately 20 hearts per replicate were pooled and total RNA was isolated using the miRNeasy micro kit Qiagen combined with on column DNase digestion 100 ng of total RNA was used as input for VAHTS Stranded mRNA seq Library Vazyme preparation following manufacture’s protocol Vazyme. | age:56 hpf|genotype:Tgkdrl:eGFP|treatment:DMSO|tissue:Hearts | GSM4274434 | GSM4274434: Hearts DMSO 2; Danio rerio; RNA Seq | GSM4274434 | 1 | Hearts from 56 hpf Tgkdrl:EGFP control and Alk5 inhibitor treated embryos were manually dissected using forceps. Approximately 20 hearts per replicate were pooled and total RNA was isolated using the miRNeasy micro kit Qiagen combined with on column DNase digestion 100 ng of total RNA was used as input for VAHTS Stranded mRNA seq Library Vazyme preparation following manufacture's protocol Vazyme. | GEO Accession:GSM4274434 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP242182 | Giulia_DMSO_2_R1.fastq.gz | fastq | 2662704304.0 | 35727854.0 | GSM4274434 r1 | 0:74.53 1:0 | A:669181180;C:594346008;G:625182662;T:773912591;N:81863 | 74 | 0 | 669181180 | 594346008 | 625182662 | 773912591 | 81863 | SRX7570773 | SRS6006443 | SRA1027132 | GEO | MPI for heart and lung research | 1 | 0.93095 | 0.09862 | 0.72182 | 0.4889 | 75 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Germany | 2020-01-16 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 56290 | 56290 | SRR10902598 | SRX7570772 | SRS6006442 | SRP242182 | PRJNA601645 | Identification of TGF b targets in the cardiac outflow tract by transcriptomic analysis | GSE143770 | Transcriptome Analysis | Purpose: identifying with RNA seq genes targets of Alk5 during the development of the cardiac outflow tract in zebrafish. Results: we identified several differential expressed genes with an enrichment in ECM component genes. As a proof of concept many TGFb known targets also appeared downregulated. Overall design: Zebrafish embryos were treated with Alk5 inhibitor E 616452 or DMSO and hearts were manually extracted at 56 hpf. | pubmed:32990594 | Hearts DMSO 1 | GSM4274433 | source name:Hearts|age:56 hpf|genotype:Tgkdrl:eGFP|treatment:DMSO|tissue:Hearts | Hearts DMSO 1 | The resulting raw reads were assessed for quality adapter content and duplication rates with FastQC Reaper version 13 100 was used to trim reads with a quality drop below a mean of Q20 in a window of 10 nucleotides Davis et al. 2013. Only reads between 30 and 150 nucleotides were used in subsequent analyses. Trimmed and filtered reads were aligned versus the Ensembl Zebrafish genome version DanRer11 GRCz11.92 using STAR 2.4.0a with the parameter “outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10% The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package Liao et al. 2014. Only reads mapping at least partially inside exons were admitted and aggregated per gene while reads overlapping multiple genes or aligning to multiple regions were excluded from further analyses. Differentially expressed genes were identified using DESeq2 version 1.18.1Love et al. 2014. To remove a batch effect from the comparison the replicates were presented to DESeq2 as covariates DMSO 1/Inhib 1 = 1 DMSO 2/Inhib 2 = 2. The raw count matrix was batch corrected using CountClust Dey et al. 2017 and then normalized with DESeq2. Genome build: DanRer11 Supplementary files format and content: library size normalized counts | Hearts | Hearts from 56 hpf Tgkdrl:EGFP control and Alk5 inhibitor treated embryos were manually dissected using forceps. Approximately 20 hearts per replicate were pooled and total RNA was isolated using the miRNeasy micro kit Qiagen combined with on column DNase digestion 100 ng of total RNA was used as input for VAHTS Stranded mRNA seq Library Vazyme preparation following manufacture’s protocol Vazyme. | age:56 hpf|genotype:Tgkdrl:eGFP|treatment:DMSO|tissue:Hearts | GSM4274433 | GSM4274433: Hearts DMSO 1; Danio rerio; RNA Seq | GSM4274433 | 1 | Hearts from 56 hpf Tgkdrl:EGFP control and Alk5 inhibitor treated embryos were manually dissected using forceps. Approximately 20 hearts per replicate were pooled and total RNA was isolated using the miRNeasy micro kit Qiagen combined with on column DNase digestion 100 ng of total RNA was used as input for VAHTS Stranded mRNA seq Library Vazyme preparation following manufacture's protocol Vazyme. | GEO Accession:GSM4274433 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP242182 | Giulia_DMSO_1_R1.fastq.gz | fastq | 2944080336.0 | 39517261.0 | GSM4274433 r1 | 0:74.50 1:0 | A:744739630;C:657305747;G:685128071;T:856804215;N:102673 | 74 | 0 | 744739630 | 657305747 | 685128071 | 856804215 | 102673 | SRX7570772 | SRS6006442 | SRA1027132 | GEO | MPI for heart and lung research | 1 | 0.93221 | 0.09799 | 0.71443 | 0.46971 | 74 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Germany | 2020-01-16 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||||
| 58969 | 58969 | SRR11575113 | SRX8143233 | SRS6506144 | SRP257532 | PRJNA626621 | Identification of target genes in tie1 mutant zebrafish heart by transcriptomic analysis | GSE148957 | Transcriptome Analysis | Purpose: identifying with RNA seq genes targets of Tie1 during the cardiac development in zebrafish. Results: we identified several differential expressed genes with an enrichment in ECM modulator genes. Overall design: Hearts were manually extracted at 48 hpf from tie1 mutants and wild type and heterozygous siblings. | tie1 WT 2 | GSM4486659 | source name:Tgkdrl:eGFP|tissue:Hearts|developmental stage:48 hpf|genotype:tie1 WT | tie1 WT 2 | The resulting raw reads were assessed for quality adapter content and duplication rates with FastQC available online at http://www.bioinformatics.babraham.ac.uk/ projects/fastqc. Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides 6. Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus the Ensembl Zebrafish genome version DanRer11 GRCz11.92 using STAR 2.4.0a with the parameter “outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package 8. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Genome build: DanRer11 Supplementary files format and content: library size normalized counts | Tgkdrl:eGFP | Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles pooled in 1.5 ml tubes with TRIzol and frozen in 80°C. Total RNA was isolated using the miRNeasy micro kit Qiagen. For exclusion of genomic DNA contamination the samples were treated by on column DNase digestion DNase Free DNase Set Qiagen. Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | tissue:Hearts|developmental stage:48 hpf|genotype:tie1 WT | GSM4486659 | GSM4486659: tie1 WT 2; Danio rerio; RNA Seq | GSM4486659 | 1 | Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles pooled in 1.5 ml tubes with TRIzol and frozen in 80°C. Total RNA was isolated using the miRNeasy micro kit Qiagen. For exclusion of genomic DNA contamination the samples were treated by on column DNase digestion DNase Free DNase Set Qiagen. Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | GEO Accession:GSM4486659 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP257532 | Carlantoni_RNA_WT_2.fastq.gz | fastq | 1305381389.0 | 17502572.0 | GSM4486659 r1 | 0:74.58 1:0 | A:237331428;C:438050630;G:373885000;T:256109188;N:5143 | 74 | 0 | 237331428 | 438050630 | 373885000 | 256109188 | 5143 | SRX8143233 | SRS6506144 | SRA1067178 | GEO | MPI for heart and lung research | 1 | 0.9611 | 0.16835 | 0.89919 | 0.79231 | 75 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | smarter | bulk | bulk | bulk | Germany | 2020-04-20 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||||
| 58970 | 58970 | SRR11575112 | SRX8143232 | SRS6506143 | SRP257532 | PRJNA626621 | Identification of target genes in tie1 mutant zebrafish heart by transcriptomic analysis | GSE148957 | Transcriptome Analysis | Purpose: identifying with RNA seq genes targets of Tie1 during the cardiac development in zebrafish. Results: we identified several differential expressed genes with an enrichment in ECM modulator genes. Overall design: Hearts were manually extracted at 48 hpf from tie1 mutants and wild type and heterozygous siblings. | tie1 WT 1 | GSM4486658 | source name:Tgkdrl:eGFP|tissue:Hearts|developmental stage:48 hpf|genotype:tie1 WT | tie1 WT 1 | The resulting raw reads were assessed for quality adapter content and duplication rates with FastQC available online at http://www.bioinformatics.babraham.ac.uk/ projects/fastqc. Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides 6. Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus the Ensembl Zebrafish genome version DanRer11 GRCz11.92 using STAR 2.4.0a with the parameter “outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package 8. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Genome build: DanRer11 Supplementary files format and content: library size normalized counts | Tgkdrl:eGFP | Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles pooled in 1.5 ml tubes with TRIzol and frozen in 80°C. Total RNA was isolated using the miRNeasy micro kit Qiagen. For exclusion of genomic DNA contamination the samples were treated by on column DNase digestion DNase Free DNase Set Qiagen. Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | tissue:Hearts|developmental stage:48 hpf|genotype:tie1 WT | GSM4486658 | GSM4486658: tie1 WT 1; Danio rerio; RNA Seq | GSM4486658 | 1 | Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles pooled in 1.5 ml tubes with TRIzol and frozen in 80°C. Total RNA was isolated using the miRNeasy micro kit Qiagen. For exclusion of genomic DNA contamination the samples were treated by on column DNase digestion DNase Free DNase Set Qiagen. Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | GEO Accession:GSM4486658 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP257532 | Carlantoni_RNA_WT_1.fastq.gz | fastq | 1494085887.0 | 20050038.0 | GSM4486658 r1 | 0:74.52 1:0 | A:282811923;C:486533537;G:414513849;T:310220539;N:6039 | 74 | 0 | 282811923 | 486533537 | 414513849 | 310220539 | 6039 | SRX8143232 | SRS6506143 | SRA1067178 | GEO | MPI for heart and lung research | 1 | 0.9512 | 0.17902 | 0.89757 | 0.79881 | 75 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | smarter | bulk | bulk | bulk | Germany | 2020-04-20 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||||
| 58971 | 58971 | SRR11575111 | SRX8143231 | SRS6506142 | SRP257532 | PRJNA626621 | Identification of target genes in tie1 mutant zebrafish heart by transcriptomic analysis | GSE148957 | Transcriptome Analysis | Purpose: identifying with RNA seq genes targets of Tie1 during the cardiac development in zebrafish. Results: we identified several differential expressed genes with an enrichment in ECM modulator genes. Overall design: Hearts were manually extracted at 48 hpf from tie1 mutants and wild type and heterozygous siblings. | tie1 KO 2 | GSM4486657 | source name:Tgkdrl:eGFP|tissue:Hearts|developmental stage:48 hpf|genotype:tie1 KO | tie1 KO 2 | The resulting raw reads were assessed for quality adapter content and duplication rates with FastQC available online at http://www.bioinformatics.babraham.ac.uk/ projects/fastqc. Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides 6. Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus the Ensembl Zebrafish genome version DanRer11 GRCz11.92 using STAR 2.4.0a with the parameter “outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package 8. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Genome build: DanRer11 Supplementary files format and content: library size normalized counts | Tgkdrl:eGFP | Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles pooled in 1.5 ml tubes with TRIzol and frozen in 80°C. Total RNA was isolated using the miRNeasy micro kit Qiagen. For exclusion of genomic DNA contamination the samples were treated by on column DNase digestion DNase Free DNase Set Qiagen. Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | tissue:Hearts|developmental stage:48 hpf|genotype:tie1 KO | GSM4486657 | GSM4486657: tie1 KO 2; Danio rerio; RNA Seq | GSM4486657 | 1 | Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles pooled in 1.5 ml tubes with TRIzol and frozen in 80°C. Total RNA was isolated using the miRNeasy micro kit Qiagen. For exclusion of genomic DNA contamination the samples were treated by on column DNase digestion DNase Free DNase Set Qiagen. Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | GEO Accession:GSM4486657 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP257532 | Carlantoni_RNA_KO_2.fastq.gz | fastq | 1398062637.0 | 18750921.0 | GSM4486657 r1 | 0:74.56 1:0 | A:245160828;C:482535020;G:414010795;T:256350606;N:5388 | 74 | 0 | 245160828 | 482535020 | 414010795 | 256350606 | 5388 | SRX8143231 | SRS6506142 | SRA1067178 | GEO | MPI for heart and lung research | 1 | 0.96112 | 0.17097 | 0.9263 | 0.81149 | 75 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | smarter | bulk | bulk | bulk | Germany | 2020-04-20 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||||
| 58972 | 58972 | SRR11575110 | SRX8143230 | SRS6506141 | SRP257532 | PRJNA626621 | Identification of target genes in tie1 mutant zebrafish heart by transcriptomic analysis | GSE148957 | Transcriptome Analysis | Purpose: identifying with RNA seq genes targets of Tie1 during the cardiac development in zebrafish. Results: we identified several differential expressed genes with an enrichment in ECM modulator genes. Overall design: Hearts were manually extracted at 48 hpf from tie1 mutants and wild type and heterozygous siblings. | tie1 KO 1 | GSM4486656 | source name:Tgkdrl:eGFP|tissue:Hearts|developmental stage:48 hpf|genotype:tie1 KO | tie1 KO 1 | The resulting raw reads were assessed for quality adapter content and duplication rates with FastQC available online at http://www.bioinformatics.babraham.ac.uk/ projects/fastqc. Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides 6. Only reads between 30 and 150 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned versus the Ensembl Zebrafish genome version DanRer11 GRCz11.92 using STAR 2.4.0a with the parameter “outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package 8. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Genome build: DanRer11 Supplementary files format and content: library size normalized counts | Tgkdrl:eGFP | Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles pooled in 1.5 ml tubes with TRIzol and frozen in 80°C. Total RNA was isolated using the miRNeasy micro kit Qiagen. For exclusion of genomic DNA contamination the samples were treated by on column DNase digestion DNase Free DNase Set Qiagen. Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | tissue:Hearts|developmental stage:48 hpf|genotype:tie1 KO | GSM4486656 | GSM4486656: tie1 KO 1; Danio rerio; RNA Seq | GSM4486656 | 1 | Hearts from 48 hpf tie mutant embryos and siblings were manually dissected using insulin needles pooled in 1.5 ml tubes with TRIzol and frozen in 80°C. Total RNA was isolated using the miRNeasy micro kit Qiagen. For exclusion of genomic DNA contamination the samples were treated by on column DNase digestion DNase Free DNase Set Qiagen. Total RNA and library integrity were verified with LabChip Gx Touch 24 Perkin Elmer. 2 ng of total RNA was used as input for SMARTer® Stranded Total RNA Seq Kit Pico Input Mammalian Takara Clontech. | GEO Accession:GSM4486656 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP257532 | Carlantoni_RNA_KO_1.fastq.gz | fastq | 1236313899.0 | 16596670.0 | GSM4486656 r1 | 0:74.49 1:0 | A:227398977;C:410185357;G:353761139;T:244963695;N:4731 | 74 | 0 | 227398977 | 410185357 | 353761139 | 244963695 | 4731 | SRX8143230 | SRS6506141 | SRA1067178 | GEO | MPI for heart and lung research | 1 | 0.95313 | 0.17078 | 0.90723 | 0.82365 | 75 | B | usable mapping rate | illumina | nextseq | full_length | cdna_unspecified | smarter | bulk | bulk | bulk | Germany | 2020-04-20 | Hatching | Embryo | Heart | Cardiovascular System | |||||||||||||||||||
| 59363 | 59363 | SRR11869114 | SRX8419211 | SRS6730783 | SRP265148 | PRJNA635675 | Transcriptome comparison of wild type and tnnt2a MO zebrafish hearts | GSE151398 | Transcriptome Analysis | We performed RNA seq analyses to characterize transcriptomic changes in non beating tnnt2a morphant compared to wild type hearts. Overall design: Cardiac mRNA profile of wild type and tnnt2a morphant zebrafish hearts at 54 hpf. | pubmed:32668254 | tnnt2aMO zebrafish heart rep3 | GSM4577250 | source name:Hearts|genotype/variation:tnnt2a morpholino injection|tissue:Cardiac tissue|developmental stage:54 hpf | tnnt2aMO zebrafish heart rep3 | BCL files were converted to FASTQ files using bcl2fastq Conversion Software version Illumina. The FASTQ files were adapter and quality trimmed using Trim Galore! version 0.4.1 with default settings as described in the User Guide except for the setting of the quality cutoff q/ quality which was set to a Phred score of 15. Trim Galore! used Cutadapt version 1.9.1 as subroutine. Quality control of FASTQ files was performed by FastQC version 0.11.4 before and post trimming. post trimming FASTQ files were mapped against a reference genome with the splice aware aligner STAR version 2.5.0c to generate BAM files. The BAM files were built in a 2 pass Mapping twopassMode Basic and were finally sorted outSAMtype BAM SortedByCoordinate. All other settings have been left as default as described in the manual. Genome build: The genome index files were created by STAR with default settings using Danio rerio sequence and annotation data Ensembl build GRCz10 available on Illumina’s iGenome site http://support.illumina.com/sequencing/sequencing software/igenome.html. Supplementary files format and content: The mapped data was assembled and quantified per sample with the Cufflinks suite version 2.2.1. The Cufflinks assemblies were merged with Cuffmerge and differential expression analysis was performed with Cuffdiff setting up labels 'control' 'sih' for the two conditions and the bam files of samples S1 S2 S3 condition 1 and S4 S5 S6 condition 2 respectively Supplementary files format and content: Excel file generated as output indicates the mean value for each gene of 'control' and 'sih'; P value and Q value. | Hearts | tnnt2a morphant hearts were obtained by injecting tnnt2a morpholino 5’ CATGTTTGCTCTGATCTGACACGCA 3’ 1 ng/1 cell stage embryo | ∼100 hearts/replicate were extracted from 54 hpf WT and tnnt2a morphant embryos as previously described Lombardo et al. 2015. Hearts were pooled for each condition three biological replicates and total RNA was extracted with Trizol Sigma Aldrich using Phase Lock Gel Heavy tubes 1.5 mL Prime 5. cDNA libraries were prepared starting from 100 ng of RNA/replicate using “TruSeq Stranded Total RNA Sample Preparation Kit” Low Sample Protocol Ilumina. The fragment length distribution of generated libraries was monitored and the quantification was performed using the D1000 ScreenTape System Agilent Technologies. Equal molar amounts of individual libraries were pooled denatured with NaOH and diluted to 1.5pM. | Zebrafish embryos were kept under standard conditions 28°C temperature in E3 medium until 54 hpf | genotype/variation:tnnt2a morpholino injection|tissue:Cardiac tissue|developmental stage:54 hpf | GSM4577250 | GSM4577250: tnnt2aMO zebrafish heart rep3; Danio rerio; RNA Seq | GSM4577250 | 1 | ∼100 hearts/replicate were extracted from 54 hpf WT and tnnt2a morphant embryos as previously described Lombardo et al. 2015. Hearts were pooled for each condition three biological replicates and total RNA was extracted with Trizol Sigma Aldrich using Phase Lock Gel Heavy tubes 1.5 mL Prime 5. cDNA libraries were prepared starting from 100 ng of RNA/replicate using “TruSeq Stranded Total RNA Sample Preparation Kit” Low Sample Protocol Ilumina. The fragment length distribution of generated libraries was monitored and the quantification was performed using the D1000 ScreenTape System Agilent Technologies. Equal molar amounts of individual libraries were pooled denatured with NaOH and diluted to 1.5pM. | GEO Accession:GSM4577250 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP265148 | 6-sih-_S6_L001_R1_001.fastq.gz | fastq | 1247812004.0 | 16418579.0 | GSM4577250 r1 | 0:76 1:0 | A:274962956;C:222410755;G:449925631;T:300488475;N:24187 | 76 | 0 | 274962956 | 222410755 | 449925631 | 300488475 | 24187 | SRX8419211 | SRS6730783 | SRA1080949 | GEO | University of Potsdam | 1 | 0.87122 | 0.18371 | 0.75692 | 0.61687 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | Germany | 2020-05-28 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||
| 59364 | 59364 | SRR11869115 | SRX8419211 | SRS6730783 | SRP265148 | PRJNA635675 | Transcriptome comparison of wild type and tnnt2a MO zebrafish hearts | GSE151398 | Transcriptome Analysis | We performed RNA seq analyses to characterize transcriptomic changes in non beating tnnt2a morphant compared to wild type hearts. Overall design: Cardiac mRNA profile of wild type and tnnt2a morphant zebrafish hearts at 54 hpf. | pubmed:32668254 | tnnt2aMO zebrafish heart rep3 | GSM4577250 | source name:Hearts|genotype/variation:tnnt2a morpholino injection|tissue:Cardiac tissue|developmental stage:54 hpf | tnnt2aMO zebrafish heart rep3 | BCL files were converted to FASTQ files using bcl2fastq Conversion Software version Illumina. The FASTQ files were adapter and quality trimmed using Trim Galore! version 0.4.1 with default settings as described in the User Guide except for the setting of the quality cutoff q/ quality which was set to a Phred score of 15. Trim Galore! used Cutadapt version 1.9.1 as subroutine. Quality control of FASTQ files was performed by FastQC version 0.11.4 before and post trimming. post trimming FASTQ files were mapped against a reference genome with the splice aware aligner STAR version 2.5.0c to generate BAM files. The BAM files were built in a 2 pass Mapping twopassMode Basic and were finally sorted outSAMtype BAM SortedByCoordinate. All other settings have been left as default as described in the manual. Genome build: The genome index files were created by STAR with default settings using Danio rerio sequence and annotation data Ensembl build GRCz10 available on Illumina’s iGenome site http://support.illumina.com/sequencing/sequencing software/igenome.html. Supplementary files format and content: The mapped data was assembled and quantified per sample with the Cufflinks suite version 2.2.1. The Cufflinks assemblies were merged with Cuffmerge and differential expression analysis was performed with Cuffdiff setting up labels 'control' 'sih' for the two conditions and the bam files of samples S1 S2 S3 condition 1 and S4 S5 S6 condition 2 respectively Supplementary files format and content: Excel file generated as output indicates the mean value for each gene of 'control' and 'sih'; P value and Q value. | Hearts | tnnt2a morphant hearts were obtained by injecting tnnt2a morpholino 5’ CATGTTTGCTCTGATCTGACACGCA 3’ 1 ng/1 cell stage embryo | ∼100 hearts/replicate were extracted from 54 hpf WT and tnnt2a morphant embryos as previously described Lombardo et al. 2015. Hearts were pooled for each condition three biological replicates and total RNA was extracted with Trizol Sigma Aldrich using Phase Lock Gel Heavy tubes 1.5 mL Prime 5. cDNA libraries were prepared starting from 100 ng of RNA/replicate using “TruSeq Stranded Total RNA Sample Preparation Kit” Low Sample Protocol Ilumina. The fragment length distribution of generated libraries was monitored and the quantification was performed using the D1000 ScreenTape System Agilent Technologies. Equal molar amounts of individual libraries were pooled denatured with NaOH and diluted to 1.5pM. | Zebrafish embryos were kept under standard conditions 28°C temperature in E3 medium until 54 hpf | genotype/variation:tnnt2a morpholino injection|tissue:Cardiac tissue|developmental stage:54 hpf | GSM4577250 | GSM4577250: tnnt2aMO zebrafish heart rep3; Danio rerio; RNA Seq | GSM4577250 | 1 | ∼100 hearts/replicate were extracted from 54 hpf WT and tnnt2a morphant embryos as previously described Lombardo et al. 2015. Hearts were pooled for each condition three biological replicates and total RNA was extracted with Trizol Sigma Aldrich using Phase Lock Gel Heavy tubes 1.5 mL Prime 5. cDNA libraries were prepared starting from 100 ng of RNA/replicate using “TruSeq Stranded Total RNA Sample Preparation Kit” Low Sample Protocol Ilumina. The fragment length distribution of generated libraries was monitored and the quantification was performed using the D1000 ScreenTape System Agilent Technologies. Equal molar amounts of individual libraries were pooled denatured with NaOH and diluted to 1.5pM. | GEO Accession:GSM4577250 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP265148 | 6-sih-_S6_L002_R1_001.fastq.gz | fastq | 1220685324.0 | 16061649.0 | GSM4577250 r2 | 0:76 1:0 | A:270547319;C:218463219;G:436529567;T:295102519;N:42700 | 76 | 0 | 270547319 | 218463219 | 436529567 | 295102519 | 42700 | SRX8419211 | SRS6730783 | SRA1080949 | GEO | University of Potsdam | 1 | 0.87747 | 0.18448 | 0.75737 | 0.61947 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | Germany | 2020-05-28 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||
| 59365 | 59365 | SRR11869116 | SRX8419211 | SRS6730783 | SRP265148 | PRJNA635675 | Transcriptome comparison of wild type and tnnt2a MO zebrafish hearts | GSE151398 | Transcriptome Analysis | We performed RNA seq analyses to characterize transcriptomic changes in non beating tnnt2a morphant compared to wild type hearts. Overall design: Cardiac mRNA profile of wild type and tnnt2a morphant zebrafish hearts at 54 hpf. | pubmed:32668254 | tnnt2aMO zebrafish heart rep3 | GSM4577250 | source name:Hearts|genotype/variation:tnnt2a morpholino injection|tissue:Cardiac tissue|developmental stage:54 hpf | tnnt2aMO zebrafish heart rep3 | BCL files were converted to FASTQ files using bcl2fastq Conversion Software version Illumina. The FASTQ files were adapter and quality trimmed using Trim Galore! version 0.4.1 with default settings as described in the User Guide except for the setting of the quality cutoff q/ quality which was set to a Phred score of 15. Trim Galore! used Cutadapt version 1.9.1 as subroutine. Quality control of FASTQ files was performed by FastQC version 0.11.4 before and post trimming. post trimming FASTQ files were mapped against a reference genome with the splice aware aligner STAR version 2.5.0c to generate BAM files. The BAM files were built in a 2 pass Mapping twopassMode Basic and were finally sorted outSAMtype BAM SortedByCoordinate. All other settings have been left as default as described in the manual. Genome build: The genome index files were created by STAR with default settings using Danio rerio sequence and annotation data Ensembl build GRCz10 available on Illumina’s iGenome site http://support.illumina.com/sequencing/sequencing software/igenome.html. Supplementary files format and content: The mapped data was assembled and quantified per sample with the Cufflinks suite version 2.2.1. The Cufflinks assemblies were merged with Cuffmerge and differential expression analysis was performed with Cuffdiff setting up labels 'control' 'sih' for the two conditions and the bam files of samples S1 S2 S3 condition 1 and S4 S5 S6 condition 2 respectively Supplementary files format and content: Excel file generated as output indicates the mean value for each gene of 'control' and 'sih'; P value and Q value. | Hearts | tnnt2a morphant hearts were obtained by injecting tnnt2a morpholino 5’ CATGTTTGCTCTGATCTGACACGCA 3’ 1 ng/1 cell stage embryo | ∼100 hearts/replicate were extracted from 54 hpf WT and tnnt2a morphant embryos as previously described Lombardo et al. 2015. Hearts were pooled for each condition three biological replicates and total RNA was extracted with Trizol Sigma Aldrich using Phase Lock Gel Heavy tubes 1.5 mL Prime 5. cDNA libraries were prepared starting from 100 ng of RNA/replicate using “TruSeq Stranded Total RNA Sample Preparation Kit” Low Sample Protocol Ilumina. The fragment length distribution of generated libraries was monitored and the quantification was performed using the D1000 ScreenTape System Agilent Technologies. Equal molar amounts of individual libraries were pooled denatured with NaOH and diluted to 1.5pM. | Zebrafish embryos were kept under standard conditions 28°C temperature in E3 medium until 54 hpf | genotype/variation:tnnt2a morpholino injection|tissue:Cardiac tissue|developmental stage:54 hpf | GSM4577250 | GSM4577250: tnnt2aMO zebrafish heart rep3; Danio rerio; RNA Seq | GSM4577250 | 1 | ∼100 hearts/replicate were extracted from 54 hpf WT and tnnt2a morphant embryos as previously described Lombardo et al. 2015. Hearts were pooled for each condition three biological replicates and total RNA was extracted with Trizol Sigma Aldrich using Phase Lock Gel Heavy tubes 1.5 mL Prime 5. cDNA libraries were prepared starting from 100 ng of RNA/replicate using “TruSeq Stranded Total RNA Sample Preparation Kit” Low Sample Protocol Ilumina. The fragment length distribution of generated libraries was monitored and the quantification was performed using the D1000 ScreenTape System Agilent Technologies. Equal molar amounts of individual libraries were pooled denatured with NaOH and diluted to 1.5pM. | GEO Accession:GSM4577250 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP265148 | 6-sih-_S6_L003_R1_001.fastq.gz | fastq | 1189718744.0 | 15654194.0 | GSM4577250 r3 | 0:76 1:0 | A:259692302;C:213063904;G:427687567;T:289266232;N:8739 | 76 | 0 | 259692302 | 213063904 | 427687567 | 289266232 | 8739 | SRX8419211 | SRS6730783 | SRA1080949 | GEO | University of Potsdam | 1 | 0.84402 | 0.17817 | 0.75939 | 0.61704 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | Germany | 2020-05-28 | Hatching | Embryo | Heart | Cardiovascular System | ||||||||||||||||
| 59366 | 59366 | SRR11869117 | SRX8419211 | SRS6730783 | SRP265148 | PRJNA635675 | Transcriptome comparison of wild type and tnnt2a MO zebrafish hearts | GSE151398 | Transcriptome Analysis | We performed RNA seq analyses to characterize transcriptomic changes in non beating tnnt2a morphant compared to wild type hearts. Overall design: Cardiac mRNA profile of wild type and tnnt2a morphant zebrafish hearts at 54 hpf. | pubmed:32668254 | tnnt2aMO zebrafish heart rep3 | GSM4577250 | source name:Hearts|genotype/variation:tnnt2a morpholino injection|tissue:Cardiac tissue|developmental stage:54 hpf | tnnt2aMO zebrafish heart rep3 | BCL files were converted to FASTQ files using bcl2fastq Conversion Software version Illumina. The FASTQ files were adapter and quality trimmed using Trim Galore! version 0.4.1 with default settings as described in the User Guide except for the setting of the quality cutoff q/ quality which was set to a Phred score of 15. Trim Galore! used Cutadapt version 1.9.1 as subroutine. Quality control of FASTQ files was performed by FastQC version 0.11.4 before and post trimming. post trimming FASTQ files were mapped against a reference genome with the splice aware aligner STAR version 2.5.0c to generate BAM files. The BAM files were built in a 2 pass Mapping twopassMode Basic and were finally sorted outSAMtype BAM SortedByCoordinate. All other settings have been left as default as described in the manual. Genome build: The genome index files were created by STAR with default settings using Danio rerio sequence and annotation data Ensembl build GRCz10 available on Illumina’s iGenome site http://support.illumina.com/sequencing/sequencing software/igenome.html. Supplementary files format and content: The mapped data was assembled and quantified per sample with the Cufflinks suite version 2.2.1. The Cufflinks assemblies were merged with Cuffmerge and differential expression analysis was performed with Cuffdiff setting up labels 'control' 'sih' for the two conditions and the bam files of samples S1 S2 S3 condition 1 and S4 S5 S6 condition 2 respectively Supplementary files format and content: Excel file generated as output indicates the mean value for each gene of 'control' and 'sih'; P value and Q value. | Hearts | tnnt2a morphant hearts were obtained by injecting tnnt2a morpholino 5’ CATGTTTGCTCTGATCTGACACGCA 3’ 1 ng/1 cell stage embryo | ∼100 hearts/replicate were extracted from 54 hpf WT and tnnt2a morphant embryos as previously described Lombardo et al. 2015. Hearts were pooled for each condition three biological replicates and total RNA was extracted with Trizol Sigma Aldrich using Phase Lock Gel Heavy tubes 1.5 mL Prime 5. cDNA libraries were prepared starting from 100 ng of RNA/replicate using “TruSeq Stranded Total RNA Sample Preparation Kit” Low Sample Protocol Ilumina. The fragment length distribution of generated libraries was monitored and the quantification was performed using the D1000 ScreenTape System Agilent Technologies. Equal molar amounts of individual libraries were pooled denatured with NaOH and diluted to 1.5pM. | Zebrafish embryos were kept under standard conditions 28°C temperature in E3 medium until 54 hpf | genotype/variation:tnnt2a morpholino injection|tissue:Cardiac tissue|developmental stage:54 hpf | GSM4577250 | GSM4577250: tnnt2aMO zebrafish heart rep3; Danio rerio; RNA Seq | GSM4577250 | 1 | ∼100 hearts/replicate were extracted from 54 hpf WT and tnnt2a morphant embryos as previously described Lombardo et al. 2015. Hearts were pooled for each condition three biological replicates and total RNA was extracted with Trizol Sigma Aldrich using Phase Lock Gel Heavy tubes 1.5 mL Prime 5. cDNA libraries were prepared starting from 100 ng of RNA/replicate using “TruSeq Stranded Total RNA Sample Preparation Kit” Low Sample Protocol Ilumina. The fragment length distribution of generated libraries was monitored and the quantification was performed using the D1000 ScreenTape System Agilent Technologies. Equal molar amounts of individual libraries were pooled denatured with NaOH and diluted to 1.5pM. | GEO Accession:GSM4577250 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP265148 | 6-sih-_S6_L004_R1_001.fastq.gz | fastq | 1154608188.0 | 15192213.0 | GSM4577250 r4 | 0:76 1:0 | A:258526979;C:209961925;G:400910247;T:285196669;N:12368 | 76 | 0 | 258526979 | 209961925 | 400910247 | 285196669 | 12368 | SRX8419211 | SRS6730783 | SRA1080949 | GEO | University of Potsdam | 1 | 0.86988 | 0.18417 | 0.7569 | 0.62074 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | Germany | 2020-05-28 | Hatching | Embryo | Heart | Cardiovascular System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;