metadata: run_metadata: 534 rows where devstage_curation = "Hatching" and tissue

534 rows where devstage_curation = "Hatching" and tissue_curation = "Embryo Imprecise"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
11245	11245	ERR10851251	ERX10296231	ERS14601258	ERP144652	PRJEB59599	Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	E-MTAB-12577	Transcriptome Analysis	Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17		Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified	WT3 cd41pflt1p48hpf	SAMEA112483908	Department of Hematology cancer institute ErasmusMC	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17\|External Id:SAMEA112483908\|INSDC center alias:Department of Hematology cancer institute ErasmusMC\|INSDC center name:Department of Hematology cancer institute ErasmusMC\|INSDC first public:2023 02 17T00:21:53Z\|INSDC last update:2023 02 17T00:21:53Z\|INSDC status:public\|Submitter Id:E MTAB 12577:WT3 cd41pflt1p48hpf\|age:48\|broker name:ArrayExpress\|cell type:hematopoietic stem cell\|common name:zebrafish\|developmental stage:embryo\|genotype:wild type genotype\|immunophenotype:CD41:GFP+ Flt1:RFP+\|individual:pools of 3 embryos 1\|organism part:liver\|sample name:E MTAB 12577:WT3 cd41pflt1p48hpf\|scientific name:Danio rerio\|strain:TgCD41:GFP TgFlt1:RFP WT								Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	E MTAB 12577:WT3 cd41pflt1p48hpf p	WT3 cd41pflt1p48hpf p	Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified	Experimental Factor: genotype:wild type genotype	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP144652	Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17	WT3_cd41pflt1p48hpf_R1.fastq.gz WT3_cd41pflt1p48hpf_R2.fastq.gz	fastq fastq	2865896816.0	14187608.0	E MTAB 12577:WT3 cd41pflt1p48hpf R	0:101 1:101	A:766433553;C:631932872;G:660672891;T:806849737;N:7763	101	101		766433553	631932872	660672891	806849737	7763	ERX10296231	ERS14601258	ERA20429817	Department of Hematology cancer institute ErasmusMC\|European Nucleotide Archive	Department of Hematology cancer institute ErasmusMC\|European Nucleotide Archive	2	0.90501	0.85042	0.09405	0.09335	0.87286	0.87943	0.48423	0.47904	101	101	B	B	biological fallback assumption	illumina	novaseq_era	full_length	cdna_unspecified	smarter	bulk	unknown	unknown	Netherlands	2023-02-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
11246	11246	ERR10851250	ERX10296230	ERS14601257	ERP144652	PRJEB59599	Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	E-MTAB-12577	Transcriptome Analysis	Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17		Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified	WT2 cd41pflt1p48hpf	SAMEA112483907	Department of Hematology cancer institute ErasmusMC	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17\|External Id:SAMEA112483907\|INSDC center alias:Department of Hematology cancer institute ErasmusMC\|INSDC center name:Department of Hematology cancer institute ErasmusMC\|INSDC first public:2023 02 17T00:21:53Z\|INSDC last update:2023 02 17T00:21:53Z\|INSDC status:public\|Submitter Id:E MTAB 12577:WT2 cd41pflt1p48hpf\|age:48\|broker name:ArrayExpress\|cell type:hematopoietic stem cell\|common name:zebrafish\|developmental stage:embryo\|genotype:wild type genotype\|immunophenotype:CD41:GFP+ Flt1:RFP+\|individual:pools of 3 embryos 5\|organism part:liver\|sample name:E MTAB 12577:WT2 cd41pflt1p48hpf\|scientific name:Danio rerio\|strain:TgCD41:GFP TgFlt1:RFP WT								Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	E MTAB 12577:WT2 cd41pflt1p48hpf p	WT2 cd41pflt1p48hpf p	Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified	Experimental Factor: genotype:wild type genotype	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP144652	Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17	WT2_cd41pflt1p48hpf_R1.fastq.gz WT2_cd41pflt1p48hpf_R2.fastq.gz	fastq fastq	2929743360.0	14503680.0	E MTAB 12577:WT2 cd41pflt1p48hpf R	0:101 1:101	A:803775344;C:639485652;G:661899077;T:824575679;N:7608	101	101		803775344	639485652	661899077	824575679	7608	ERX10296230	ERS14601257	ERA20429817	Department of Hematology cancer institute ErasmusMC\|European Nucleotide Archive	Department of Hematology cancer institute ErasmusMC\|European Nucleotide Archive	2	0.94558	0.90768	0.09379	0.09399	0.79058	0.79833	0.48216	0.47743	101	101	B	B	biological fallback assumption	illumina	novaseq_era	full_length	cdna_unspecified	smarter	bulk	unknown	unknown	Netherlands	2023-02-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
11247	11247	ERR10851249	ERX10296229	ERS14601256	ERP144652	PRJEB59599	Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	E-MTAB-12577	Transcriptome Analysis	Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17		Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified	WT1 cd41pflt1p48hpf	SAMEA112483906	Department of Hematology cancer institute ErasmusMC	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17\|External Id:SAMEA112483906\|INSDC center alias:Department of Hematology cancer institute ErasmusMC\|INSDC center name:Department of Hematology cancer institute ErasmusMC\|INSDC first public:2023 02 17T00:21:53Z\|INSDC last update:2023 02 17T00:21:53Z\|INSDC status:public\|Submitter Id:E MTAB 12577:WT1 cd41pflt1p48hpf\|age:48\|broker name:ArrayExpress\|cell type:hematopoietic stem cell\|common name:zebrafish\|developmental stage:embryo\|genotype:wild type genotype\|immunophenotype:CD41:GFP+ Flt1:RFP+\|individual:pools of 3 embryos 4\|organism part:liver\|sample name:E MTAB 12577:WT1 cd41pflt1p48hpf\|scientific name:Danio rerio\|strain:TgCD41:GFP TgFlt1:RFP WT								Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	E MTAB 12577:WT1 cd41pflt1p48hpf p	WT1 cd41pflt1p48hpf p	Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified	Experimental Factor: genotype:wild type genotype	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP144652	Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17	WT1_cd41pflt1p48hpf_R1.fastq.gz WT1_cd41pflt1p48hpf_R2.fastq.gz	fastq fastq	3248647426.0	16082413.0	E MTAB 12577:WT1 cd41pflt1p48hpf R	0:101 1:101	A:883030193;C:725566673;G:750551574;T:889489774;N:9212	101	101		883030193	725566673	750551574	889489774	9212	ERX10296229	ERS14601256	ERA20429817	Department of Hematology cancer institute ErasmusMC\|European Nucleotide Archive	Department of Hematology cancer institute ErasmusMC\|European Nucleotide Archive	2	0.91568	0.8915	0.09819	0.09602	0.86634	0.8706	0.48887	0.48731	101	101	B	B	biological fallback assumption	illumina	novaseq_era	full_length	cdna_unspecified	smarter	bulk	unknown	unknown	Netherlands	2023-02-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
11248	11248	ERR10851248	ERX10296228	ERS14601255	ERP144652	PRJEB59599	Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	E-MTAB-12577	Transcriptome Analysis	Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17		Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified	Het3 cd41pflt1p48hpf	SAMEA112483905	Department of Hematology cancer institute ErasmusMC	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17\|External Id:SAMEA112483905\|INSDC center alias:Department of Hematology cancer institute ErasmusMC\|INSDC center name:Department of Hematology cancer institute ErasmusMC\|INSDC first public:2023 02 17T00:21:53Z\|INSDC last update:2023 02 17T00:21:53Z\|INSDC status:public\|Submitter Id:E MTAB 12577:Het3 cd41pflt1p48hpf\|age:48\|broker name:ArrayExpress\|cell type:hematopoietic stem cell\|common name:zebrafish\|developmental stage:embryo\|genotype:Gata2b +/ \|immunophenotype:CD41:GFP+ Flt1:RFP+\|individual:pools of 3 embryos 3\|organism part:liver\|sample name:E MTAB 12577:Het3 cd41pflt1p48hpf\|scientific name:Danio rerio\|strain:TgCD41:GFP TgFlt1:RFP Gata2b KO								Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	E MTAB 12577:Het3 cd41pflt1p48hpf p	Het3 cd41pflt1p48hpf p	Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified	Experimental Factor: genotype:Gata2b +/	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP144652	Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17	Het3_cd41pflt1p48hpf_R1.fastq.gz Het3_cd41pflt1p48hpf_R2.fastq.gz	fastq fastq	2826011512.0	13990156.0	E MTAB 12577:Het3 cd41pflt1p48hpf R	0:101 1:101	A:777245323;C:622387331;G:640520737;T:785850577;N:7544	101	101		777245323	622387331	640520737	785850577	7544	ERX10296228	ERS14601255	ERA20429817	Department of Hematology cancer institute ErasmusMC\|European Nucleotide Archive	Department of Hematology cancer institute ErasmusMC\|European Nucleotide Archive	2	0.92716	0.90121	0.10896	0.10895	0.76739	0.77628	0.47007	0.46569	101	101	B	B	biological fallback assumption	illumina	novaseq_era	full_length	cdna_unspecified	smarter	bulk	unknown	unknown	Netherlands	2023-02-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
11249	11249	ERR10851247	ERX10296227	ERS14601254	ERP144652	PRJEB59599	Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	E-MTAB-12577	Transcriptome Analysis	Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17		Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified	Het2 cd41pflt1p48hpf	SAMEA112483904	Department of Hematology cancer institute ErasmusMC	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17\|External Id:SAMEA112483904\|INSDC center alias:Department of Hematology cancer institute ErasmusMC\|INSDC center name:Department of Hematology cancer institute ErasmusMC\|INSDC first public:2023 02 17T00:21:53Z\|INSDC last update:2023 02 17T00:21:53Z\|INSDC status:public\|Submitter Id:E MTAB 12577:Het2 cd41pflt1p48hpf\|age:48\|broker name:ArrayExpress\|cell type:hematopoietic stem cell\|common name:zebrafish\|developmental stage:embryo\|genotype:Gata2b +/ \|immunophenotype:CD41:GFP+ Flt1:RFP+\|individual:pools of 3 embryos 2\|organism part:liver\|sample name:E MTAB 12577:Het2 cd41pflt1p48hpf\|scientific name:Danio rerio\|strain:TgCD41:GFP TgFlt1:RFP Gata2b KO								Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	E MTAB 12577:Het2 cd41pflt1p48hpf p	Het2 cd41pflt1p48hpf p	Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified	Experimental Factor: genotype:Gata2b +/	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP144652	Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17	Het2_cd41pflt1p48hpf_R1.fastq.gz Het2_cd41pflt1p48hpf_R2.fastq.gz	fastq fastq	2999149954.0	14847277.0	E MTAB 12577:Het2 cd41pflt1p48hpf R	0:101 1:101	A:822247269;C:656610849;G:681974696;T:838308917;N:8223	101	101		822247269	656610849	681974696	838308917	8223	ERX10296227	ERS14601254	ERA20429817	Department of Hematology cancer institute ErasmusMC\|European Nucleotide Archive	Department of Hematology cancer institute ErasmusMC\|European Nucleotide Archive	2	0.94678	0.91473	0.10277	0.10053	0.76686	0.77684	0.46042	0.47202	101	101	B	B	biological fallback assumption	illumina	novaseq_era	full_length	cdna_unspecified	smarter	bulk	unknown	unknown	Netherlands	2023-02-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
11250	11250	ERR10851246	ERX10296226	ERS14601253	ERP144652	PRJEB59599	Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	E-MTAB-12577	Transcriptome Analysis	Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17		Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified	Het1 cd41pflt1p48hpf	SAMEA112483903	Department of Hematology cancer institute ErasmusMC	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17\|External Id:SAMEA112483903\|INSDC center alias:Department of Hematology cancer institute ErasmusMC\|INSDC center name:Department of Hematology cancer institute ErasmusMC\|INSDC first public:2023 02 17T00:21:53Z\|INSDC last update:2023 02 17T00:21:53Z\|INSDC status:public\|Submitter Id:E MTAB 12577:Het1 cd41pflt1p48hpf\|age:48\|broker name:ArrayExpress\|cell type:hematopoietic stem cell\|common name:zebrafish\|developmental stage:embryo\|genotype:Gata2b +/ \|immunophenotype:CD41:GFP+ Flt1:RFP+\|individual:pools of 3 embryos 1\|organism part:liver\|sample name:E MTAB 12577:Het1 cd41pflt1p48hpf\|scientific name:Danio rerio\|strain:TgCD41:GFP TgFlt1:RFP Gata2b KO								Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	E MTAB 12577:Het1 cd41pflt1p48hpf p	Het1 cd41pflt1p48hpf p	Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified	Experimental Factor: genotype:Gata2b +/	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		ERP144652	Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41	ENA FIRST PUBLIC:2023 02 17\|ENA LAST UPDATE:2023 02 17	Het1_cd41pflt1p48hpf_R1.fastq.gz Het1_cd41pflt1p48hpf_R2.fastq.gz	fastq fastq	36682350994.0	181595797.0	E MTAB 12577:Het1 cd41pflt1p48hpf R	0:101 1:101	A:10130106739;C:7969045717;G:8373740062;T:10209360741;N:97735	101	101		10130106739	7969045717	8373740062	10209360741	97735	ERX10296226	ERS14601253	ERA20429817	Department of Hematology cancer institute ErasmusMC\|European Nucleotide Archive	Department of Hematology cancer institute ErasmusMC\|European Nucleotide Archive	2	0.94302	0.91104	0.11873	0.11597	0.7554	0.76579	0.48813	0.47764	101	101	B	B	biological fallback assumption	illumina	novaseq_era	full_length	cdna_unspecified	smarter	bulk	unknown	unknown	Netherlands	2023-02-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30035	30035	SRR27732031	SRX23397617	SRS20258458	SRP485064	PRJNA1067370	zebrafish embryo for scRNA seq and bulk RNA seq	PRJNA1067370	Other	Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development accompanied by ferroptosis.				wild type 48 hpf embryo	zebrafish embryo 48hpf replicate 3		strain:not applicable\|isolate:not collected\|breed:Danio\|cultivar:not applicable\|ecotype:not applicable\|dev stage:48 hpf\|collection date:2022 10\|geo loc name:not applicable\|sex:not applicable\|tissue:embryo\|genotype:wild type\|sample type:whole organism\|treatment:replicate 3\|BioSampleModel:Model organism or animal								RNA Seq of Danio rerio: 48hpf embryo	W 18	W 18	bulk RNA seq			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP485064			WT48h-3_1.fq.gz WT48h-3_2.fq.gz	fastq fastq	6520477800.0	21734926.0	WT48h 3 1.fq.gz	0:150 1:150	A:1739928482;C:1516508736;G:1531638319;T:1732180903;N:221360	150	150		1739928482	1516508736	1531638319	1732180903	221360	SRX23397617	SRS20258458	SRA1791946	Shanghai Ocean University\|College of Fisheries and Life	Shanghai Ocean University	2	0.93874	0.93954	0.09485	0.09438	0.67888	0.67913	0.46039	0.46026	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	China	2024-01-26	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30036	30036	SRR27732032	SRX23397616	SRS20258457	SRP485064	PRJNA1067370	zebrafish embryo for scRNA seq and bulk RNA seq	PRJNA1067370	Other	Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development accompanied by ferroptosis.				wild type 48 hpf embryo	zebrafish embryo 48hpf replicate 2		strain:not applicable\|isolate:not collected\|breed:Danio\|cultivar:not applicable\|ecotype:not applicable\|dev stage:48 hpf\|collection date:2022 10\|geo loc name:not applicable\|sex:not applicable\|tissue:embryo\|genotype:wild type\|sample type:whole organism\|treatment:replicate 2\|BioSampleModel:Model organism or animal								RNA Seq of Danio rerio: 48hpf embryo	W 17	W 17	bulk RNA seq			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP485064			WT48h-2_2.fq.gz WT48h-2_1.fq.gz	fastq fastq	7046397300.0	23487991.0	WT48h 2 1.fq.gz	0:150 1:150	A:1865031055;C:1655796645;G:1670091105;T:1855237793;N:240702	150	150		1865031055	1655796645	1670091105	1855237793	240702	SRX23397616	SRS20258457	SRA1791946	Shanghai Ocean University\|College of Fisheries and Life	Shanghai Ocean University	2	0.94056	0.93987	0.08562	0.08535	0.68241	0.68288	0.46355	0.46204	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	China	2024-01-26	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30037	30037	SRR27732033	SRX23397615	SRS20258456	SRP485064	PRJNA1067370	zebrafish embryo for scRNA seq and bulk RNA seq	PRJNA1067370	Other	Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development accompanied by ferroptosis.				wild type 48 hpf embryo	zebrafish embryo 48hpf replicate 1		strain:not applicable\|isolate:not collected\|breed:Danio\|cultivar:not applicable\|ecotype:not applicable\|dev stage:48 hpf\|collection date:2022 10\|geo loc name:not applicable\|sex:not applicable\|tissue:embryo\|genotype:wild type\|sample type:whole organism\|treatment:replicate 1\|BioSampleModel:Model organism or animal								RNA Seq of Danio rerio: 48hpf embryo	W 16	W 16	bulk RNA seq			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP485064			WT48h-1_1.fq.gz WT48h-1_2.fq.gz	fastq fastq	6851959800.0	22839866.0	WT48h 1 1.fq.gz	0:150 1:150	A:1813160204;C:1610483050;G:1626359291;T:1801871129;N:86126	150	150		1813160204	1610483050	1626359291	1801871129	86126	SRX23397615	SRS20258456	SRA1791946	Shanghai Ocean University\|College of Fisheries and Life	Shanghai Ocean University	2	0.94028	0.93857	0.08526	0.08523	0.68331	0.68477	0.45695	0.45202	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	China	2024-01-26	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30053	30053	SRR27730716	SRX23396342	SRS20257256	SRP485064	PRJNA1067370	zebrafish embryo for scRNA seq and bulk RNA seq	PRJNA1067370	Other	Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development accompanied by ferroptosis.				hamp / 48 hpf embryo	zebrafish embryo hamp / 48hpf replicate 3		strain:not applicable\|isolate:not collected\|breed:Danio\|cultivar:not applicable\|ecotype:not applicable\|dev stage:48 hpf\|collection date:2022 10\|geo loc name:not applicable\|sex:not applicable\|tissue:embryo\|genotype:hamp / \|sample type:whole organism\|treatment:replicate 3\|BioSampleModel:Model organism or animal								RNA Seq of Danio rerio: 48hpf embryo	W 39	W 39	bulk RNA seq			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP485064			hamp48h-3_1.fq.gz hamp48h-3_2.fq.gz	fastq fastq	7580570700.0	25268569.0	hamp48h 3 1.fq.gz	0:150 1:150	A:2019162299;C:1768225001;G:1782049665;T:2011039613;N:94122	150	150		2019162299	1768225001	1782049665	2011039613	94122	SRX23396342	SRS20257256	SRA1791861	Shanghai Ocean University\|College of Fisheries and Life	Shanghai Ocean University	2	0.93863	0.93681	0.08675	0.08582	0.68394	0.6857	0.46373	0.46321	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	China	2024-01-25	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30054	30054	SRR27730717	SRX23396341	SRS20257255	SRP485064	PRJNA1067370	zebrafish embryo for scRNA seq and bulk RNA seq	PRJNA1067370	Other	Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development accompanied by ferroptosis.				hamp / 48 hpf embryo	zebrafish embryo hamp / 48hpf replicate 2		strain:not applicable\|isolate:not collected\|breed:Danio\|cultivar:not applicable\|ecotype:not applicable\|dev stage:48 hpf\|collection date:2022 10\|geo loc name:not applicable\|sex:not applicable\|tissue:embryo\|genotype:hamp / \|sample type:whole organism\|treatment:replicate 2\|BioSampleModel:Model organism or animal								RNA Seq of Danio rerio: 48hpf embryo	W 38	W 38	bulk RNA seq			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP485064			hamp48h-2_1.fq.gz hamp48h-2_2.fq.gz	fastq fastq	7385330400.0	24617768.0	hamp48h 2 1.fq.gz	0:150 1:150	A:1971527478;C:1717463447;G:1738237873;T:1957858394;N:243208	150	150		1971527478	1717463447	1738237873	1957858394	243208	SRX23396341	SRS20257255	SRA1791861	Shanghai Ocean University\|College of Fisheries and Life	Shanghai Ocean University	2	0.93851	0.9369	0.09049	0.08988	0.68274	0.6843	0.45945	0.46042	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	China	2024-01-25	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30055	30055	SRR27730718	SRX23396340	SRS20257254	SRP485064	PRJNA1067370	zebrafish embryo for scRNA seq and bulk RNA seq	PRJNA1067370	Other	Hepcidin hamp is a key regulator for the maintenance of iron metabolism. How hamp affects the mechanism of zebrafish hematopoiesis is still largely unknown. Here we have generated a stable hamp mutant zebrafish model by using the CRISPR/Cas9 system.We found that iron overload occurred in several tissues of zebrafish and the hemoglobin content decreased significantly during embryonic development.Single cell profiling demonstrated that hematopoietic actors were aberrantly expressed and hematopoietic progenitor cells appeared a group of cell clusters with relatively delayed development accompanied by ferroptosis.				hamp / 48 hpf embryo	zebrafish embryo hamp / 48hpf replicate 1		strain:not applicable\|isolate:not collected\|breed:Danio\|cultivar:not applicable\|ecotype:not applicable\|dev stage:48 hpf\|collection date:2022 10\|geo loc name:not applicable\|sex:not applicable\|tissue:embryo\|genotype:hamp / \|sample type:whole organism\|treatment:replicate 1\|BioSampleModel:Model organism or animal								RNA Seq of Danio rerio: 48hpf embryo	W 37	W 37	bulk RNA seq			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP485064			hamp48h-1_1.fq.gz hamp48h-1_2.fq.gz	fastq fastq	6188343000.0	20627810.0	hamp48h 1 1.fq.gz	0:150 1:150	A:1649030143;C:1444577102;G:1461592285;T:1633092294;N:51176	150	150		1649030143	1444577102	1461592285	1633092294	51176	SRX23396340	SRS20257254	SRA1791861	Shanghai Ocean University\|College of Fisheries and Life	Shanghai Ocean University	2	0.94313	0.94006	0.08835	0.08702	0.6859	0.68702	0.45658	0.46001	150	150	B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc_generic	bulk	bulk	China	2024-01-25	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30091	30091	SRR29493624	SRX25004204	SRS21704907	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		48hpf 8	GSM8339650		tissue:RNA from single embryo at mRNA\|strain:RW\|geo loc name:missing\|collection date:missing	48hpf 8	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RNA from single embryo at mRNA	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8339650	GSM8339650: 48hpf 8; Danio rerio; RNA Seq	GSM8339650 r1	GSM8339650	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			DrRyu-040_1.fastq.gz	fastq	1054993210.0	6986710.0	GSM8339650 r1	0:151	A:368591219;C:204073285;G:206449879;T:275872318;N:6509	151			368591219	204073285	206449879	275872318	6509	SRX25004204	SRS21704907	SRA1904789	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.69055		0.05653		0.80781		0.51858		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-06-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30092	30092	SRR29493625	SRX25004203	SRS21704908	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		48hpf 7	GSM8339649		tissue:RNA from single embryo at mRNA\|strain:RW\|geo loc name:missing\|collection date:missing	48hpf 7	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RNA from single embryo at mRNA	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8339649	GSM8339649: 48hpf 7; Danio rerio; RNA Seq	GSM8339649 r1	GSM8339649	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			DrRyu-039_1.fastq.gz	fastq	733281972.0	4856172.0	GSM8339649 r1	0:151	A:252862813;C:144646461;G:145278671;T:190489500;N:4527	151			252862813	144646461	145278671	190489500	4527	SRX25004203	SRS21704908	SRA1904789	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.71608		0.06725		0.80821		0.51028		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-06-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30093	30093	SRR29493626	SRX25004202	SRS21704909	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		48hpf 6	GSM8339648		tissue:RNA from single embryo at mRNA\|strain:RW\|geo loc name:missing\|collection date:missing	48hpf 6	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RNA from single embryo at mRNA	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8339648	GSM8339648: 48hpf 6; Danio rerio; RNA Seq	GSM8339648 r1	GSM8339648	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			DrRyu-038_1.fastq.gz	fastq	411007353.0	2721903.0	GSM8339648 r1	0:151	A:140856859;C:80213546;G:81159924;T:108774567;N:2457	151			140856859	80213546	81159924	108774567	2457	SRX25004202	SRS21704909	SRA1904789	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.71964		0.07576		0.81105		0.51566		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-06-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30094	30094	SRR29493627	SRX25004201	SRS21704902	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		48hpf 5	GSM8339647		tissue:RNA from single embryo at mRNA\|strain:RW\|geo loc name:missing\|collection date:missing	48hpf 5	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RNA from single embryo at mRNA	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8339647	GSM8339647: 48hpf 5; Danio rerio; RNA Seq	GSM8339647 r1	GSM8339647	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			DrRyu-037_1.fastq.gz	fastq	376794226.0	2495326.0	GSM8339647 r1	0:151	A:127943820;C:74332462;G:75265601;T:99249992;N:2351	151			127943820	74332462	75265601	99249992	2351	SRX25004201	SRS21704902	SRA1904789	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.72373		0.0719		0.8101		0.51107		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-06-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30095	30095	SRR29493628	SRX25004200	SRS21704905	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		48hpf 4	GSM8339646		tissue:RNA from single embryo at mRNA\|strain:RW\|geo loc name:missing\|collection date:missing	48hpf 4	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RNA from single embryo at mRNA	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8339646	GSM8339646: 48hpf 4; Danio rerio; RNA Seq	GSM8339646 r1	GSM8339646	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			DrRyu-036_1.fastq.gz	fastq	671390847.0	4446297.0	GSM8339646 r1	0:151	A:233430966;C:130934865;G:131672025;T:175348951;N:4040	151			233430966	130934865	131672025	175348951	4040	SRX25004200	SRS21704905	SRA1904789	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.70308		0.05985		0.81144		0.52262		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-06-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30096	30096	SRR29493629	SRX25004199	SRS21704900	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		48hpf 3	GSM8339645		tissue:RNA from single embryo at mRNA\|strain:RW\|geo loc name:missing\|collection date:missing	48hpf 3	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RNA from single embryo at mRNA	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8339645	GSM8339645: 48hpf 3; Danio rerio; RNA Seq	GSM8339645 r1	GSM8339645	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			DrRyu-035_1.fastq	fastq	843792681.0	5588031.0	GSM8339645 r1	0:151	A:292807912;C:163694971;G:166440340;T:220844279;N:5179	151			292807912	163694971	166440340	220844279	5179	SRX25004199	SRS21704900	SRA1904789	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.70281		0.06102		0.80726		0.51105		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-06-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30097	30097	SRR29493630	SRX25004198	SRS21704906	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		48hpf 2	GSM8339644		tissue:RNA from single embryo at mRNA\|strain:RW\|geo loc name:missing\|collection date:missing	48hpf 2	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RNA from single embryo at mRNA	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8339644	GSM8339644: 48hpf 2; Danio rerio; RNA Seq	GSM8339644 r1	GSM8339644	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			DrRyu-034_1.fastq.gz	fastq	644765017.0	4269967.0	GSM8339644 r1	0:151	A:221252168;C:125928858;G:127481054;T:170099038;N:3899	151			221252168	125928858	127481054	170099038	3899	SRX25004198	SRS21704906	SRA1904789	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.72235		0.07025		0.80612		0.52362		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-06-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30098	30098	SRR29493631	SRX25004197	SRS21704901	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		48hpf 1	GSM8339643		tissue:RNA from single embryo at mRNA\|strain:RW\|geo loc name:missing\|collection date:missing	48hpf 1	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RNA from single embryo at mRNA	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8339643	GSM8339643: 48hpf 1; Danio rerio; RNA Seq	GSM8339643 r1	GSM8339643	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			DrRyu-033_1.fastq.gz	fastq	611672159.0	4050809.0	GSM8339643 r1	0:151	A:212078207;C:119459285;G:120486929;T:159644086;N:3652	151			212078207	119459285	120486929	159644086	3652	SRX25004197	SRS21704901	SRA1904789	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.71248		0.05797		0.81712		0.49614		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-06-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30147	30147	SRR27710077	SRX23376543	SRS20238466	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		49 48hpf 8	GSM8032982		tissue:RW\|strain:RW\|geo loc name:missing\|collection date:missing	49 48hpf 8	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RW	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8032982	GSM8032982: 49 48hpf 8; Danio rerio; RNA Seq	GSM8032982 r1	GSM8032982	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			Tasaki1-049_R1.fastq.gz	fastq	966508569.0	6400719.0	GSM8032982 r1	0:151	A:320935060;C:194440228;G:196632381;T:254498610;N:2290	151			320935060	194440228	196632381	254498610	2290	SRX23376543	SRS20238466	SRA1791114	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.72814		0.05007		0.80095		0.48661		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-01-24	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30164	30164	SRR27710094	SRX23376526	SRS20238448	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		48 48hpf 7	GSM8032981		tissue:RW\|strain:RW\|geo loc name:missing\|collection date:missing	48 48hpf 7	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RW	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8032981	GSM8032981: 48 48hpf 7; Danio rerio; RNA Seq	GSM8032981 r1	GSM8032981	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			Tasaki1-048_R1.fastq.gz	fastq	2757529686.0	18261786.0	GSM8032981 r1	0:151	A:910828140;C:558468820;G:564879365;T:723346484;N:6877	151			910828140	558468820	564879365	723346484	6877	SRX23376526	SRS20238448	SRA1791114	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.73443		0.04825		0.79683		0.48998		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-01-24	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30165	30165	SRR27710095	SRX23376525	SRS20238447	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		47 48hpf 6	GSM8032980		tissue:RW\|strain:RW\|geo loc name:missing\|collection date:missing	47 48hpf 6	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RW	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8032980	GSM8032980: 47 48hpf 6; Danio rerio; RNA Seq	GSM8032980 r1	GSM8032980	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			Tasaki1-047_R1.fastq.gz	fastq	3490930495.0	23118745.0	GSM8032980 r1	0:151	A:1149241773;C:703401164;G:711403608;T:926875030;N:8920	151			1149241773	703401164	711403608	926875030	8920	SRX23376525	SRS20238447	SRA1791114	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.73592		0.05139		0.79009		0.48157		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-01-24	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30166	30166	SRR27710096	SRX23376524	SRS20238446	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		46 48hpf 5	GSM8032979		tissue:RW\|strain:RW\|geo loc name:missing\|collection date:missing	46 48hpf 5	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RW	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8032979	GSM8032979: 46 48hpf 5; Danio rerio; RNA Seq	GSM8032979 r1	GSM8032979	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			Tasaki1-046_R1.fastq.gz	fastq	363154094.0	2404994.0	GSM8032979 r1	0:151	A:120491623;C:72842193;G:73943263;T:95876121;N:894	151			120491623	72842193	73943263	95876121	894	SRX23376524	SRS20238446	SRA1791114	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.7308		0.04961		0.80146		0.49425		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-01-24	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30167	30167	SRR27710097	SRX23376523	SRS20238445	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		45 48hpf 4	GSM8032978		tissue:RW\|strain:RW\|geo loc name:missing\|collection date:missing	45 48hpf 4	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RW	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8032978	GSM8032978: 45 48hpf 4; Danio rerio; RNA Seq	GSM8032978 r1	GSM8032978	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			Tasaki1-045_R1.fastq.gz	fastq	748115759.0	4954409.0	GSM8032978 r1	0:151	A:245914397;C:151299413;G:153694702;T:197205323;N:1924	151			245914397	151299413	153694702	197205323	1924	SRX23376523	SRS20238445	SRA1791114	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.73182		0.05145		0.80079		0.484		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-01-24	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30168	30168	SRR27710098	SRX23376522	SRS20238444	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		44 48hpf 3	GSM8032977		tissue:RW\|strain:RW\|geo loc name:missing\|collection date:missing	44 48hpf 3	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RW	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8032977	GSM8032977: 44 48hpf 3; Danio rerio; RNA Seq	GSM8032977 r1	GSM8032977	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			Tasaki1-044_R1.fastq.gz	fastq	251878721.0	1668071.0	GSM8032977 r1	0:151	A:85089090;C:50523433;G:51169464;T:65096047;N:687	151			85089090	50523433	51169464	65096047	687	SRX23376522	SRS20238444	SRA1791114	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.72161		0.03724		0.81326		0.47813		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-01-24	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30169	30169	SRR27710099	SRX23376521	SRS20238443	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		43 48hpf 2	GSM8032976		tissue:RW\|strain:RW\|geo loc name:missing\|collection date:missing	43 48hpf 2	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RW	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8032976	GSM8032976: 43 48hpf 2; Danio rerio; RNA Seq	GSM8032976 r1	GSM8032976	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			Tasaki1-043_R1.fastq.gz	fastq	614177702.0	4067402.0	GSM8032976 r1	0:151	A:204044429;C:122774107;G:124400265;T:162957344;N:1557	151			204044429	122774107	124400265	162957344	1557	SRX23376521	SRS20238443	SRA1791114	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.73058		0.0544		0.79703		0.48883		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-01-24	Hatching	Embryo	Embryo Imprecise	All anatomical structures
30170	30170	SRR27710100	SRX23376520	SRS20238442	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		42 48hpf 1	GSM8032975		tissue:RW\|strain:RW\|geo loc name:missing\|collection date:missing	42 48hpf 1	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RW	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illum…	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:48hpf	GSM8032975	GSM8032975: 42 48hpf 1; Danio rerio; RNA Seq	GSM8032975 r1	GSM8032975	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X …		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			Tasaki1-042_R1.fastq.gz	fastq	380919848.0	2522648.0	GSM8032975 r1	0:151	A:127191971;C:76851550;G:77831756;T:99043630;N:941	151			127191971	76851550	77831756	99043630	941	SRX23376520	SRS20238442	SRA1791114	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.72002		0.04841		0.80866		0.48644		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	Japan	2024-01-24	Hatching	Embryo	Embryo Imprecise	All anatomical structures
31872	31872	SRR28764740	SRX24330059	SRS21091017	SRP502657	PRJNA1101966	Pioneer neurons are molecularly distinct and their axon targeting is regulated by retinoic acid signaling	GSE264323	Transcriptome Analysis	During nervous system development pioneer neurons are the first to extend their axons into target tissues creating a scaffold for follower neurons. Despite years of study whether pioneer neurons are a molecularly distinct population is unknown. Analysis of zebrafish posterior lateral line pLL sensory neurons during axon growth using single cell RNA sequencing scRNA seq revealed that pioneer and follower neurons are transcriptionally distinct. Expression profiling of differentiating pLL progenitors defined follower as the ground state whereas “pioneer” is a later developmental state. The scRNA seq data revealed active retinoic acid RA signaling in followers but not in pioneers. Modulation of RA signaling within single pLL neurons showed that its downregulation in pioneers is necessary for expression of neurotrophic factor receptor ret which is required for correct targeting of pioneer axons. Our study provided insights into the molecular landscape of pioneer neurons and revealed the regulatory role of RA signaling in their development. Overall design: Fourteen hpf eighteen hpf twenty two hpf forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 7…				CEL210312AN WT 48h	GSM8222580		source name:zebrafish embryo\|cell type:neuron\|tissue:zebrafish embryo\|strain:mixed\|age:48 hpf loc name:missing\|collection date:missing	CEL210312AN WT 48h	using Cell Ranger version 3.1.0; 10X Genomics Pleasanton CA. USA Assembly: ZebraFishGRCz11 Supplementary files format and content: Tab separated values files and matrix files	zebrafish embryo	Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer’s solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer’s solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter’s instructions single cell 3’ v3 protocol 10x Genomics.		cell type:neuron\|tissue:zebrafish embryo\|strain:mixed\|age:48 hpf	GSM8222580	GSM8222580: CEL210312AN WT 48h; Danio rerio; RNA Seq	GSM8222580 r1	GSM8222580	1	Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter's instructions single cell three prime v3 protocol 10x Genomics.		RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP502657		loader:fastq load.py	CEL210312AN_WT_48h_S100_L003_I1_001.fastq.gz CEL210312AN_WT_48h_S100_L003_R1_001.fastq.gz CEL210312AN_WT_48h_S100_L003_R2_001.fastq.gz	fastq fastq fastq	8597674702.0	67698226.0	GSM8222580 r1	0:8 1:28 2:91	A:1824246454;C:1278127991;G:1448333280;T:1609791598;N:39243	8	28	91	1824246454	1278127991	1448333280	1609791598	39243	SRX24330059	SRS21091017	SRA1850361	Oregon Health and Science Univ	Oregon Health and Science Univ												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-04-22	Hatching	Embryo	Embryo Imprecise	All anatomical structures
31873	31873	SRR28764741	SRX24330059	SRS21091017	SRP502657	PRJNA1101966	Pioneer neurons are molecularly distinct and their axon targeting is regulated by retinoic acid signaling	GSE264323	Transcriptome Analysis	During nervous system development pioneer neurons are the first to extend their axons into target tissues creating a scaffold for follower neurons. Despite years of study whether pioneer neurons are a molecularly distinct population is unknown. Analysis of zebrafish posterior lateral line pLL sensory neurons during axon growth using single cell RNA sequencing scRNA seq revealed that pioneer and follower neurons are transcriptionally distinct. Expression profiling of differentiating pLL progenitors defined follower as the ground state whereas “pioneer” is a later developmental state. The scRNA seq data revealed active retinoic acid RA signaling in followers but not in pioneers. Modulation of RA signaling within single pLL neurons showed that its downregulation in pioneers is necessary for expression of neurotrophic factor receptor ret which is required for correct targeting of pioneer axons. Our study provided insights into the molecular landscape of pioneer neurons and revealed the regulatory role of RA signaling in their development. Overall design: Fourteen hpf eighteen hpf twenty two hpf forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 7…				CEL210312AN WT 48h	GSM8222580		source name:zebrafish embryo\|cell type:neuron\|tissue:zebrafish embryo\|strain:mixed\|age:48 hpf loc name:missing\|collection date:missing	CEL210312AN WT 48h	using Cell Ranger version 3.1.0; 10X Genomics Pleasanton CA. USA Assembly: ZebraFishGRCz11 Supplementary files format and content: Tab separated values files and matrix files	zebrafish embryo	Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer’s solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer’s solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter’s instructions single cell 3’ v3 protocol 10x Genomics.		cell type:neuron\|tissue:zebrafish embryo\|strain:mixed\|age:48 hpf	GSM8222580	GSM8222580: CEL210312AN WT 48h; Danio rerio; RNA Seq	GSM8222580 r1	GSM8222580	1	Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter's instructions single cell three prime v3 protocol 10x Genomics.		RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP502657		loader:fastq load.py	CEL210312AN_WT_48h_S101_L003_I1_001.fastq.gz CEL210312AN_WT_48h_S101_L003_R1_001.fastq.gz CEL210312AN_WT_48h_S101_L003_R2_001.fastq.gz	fastq fastq fastq	10521686856.0	82847928.0	GSM8222580 r2	0:8 1:28 2:91	A:2230570510;C:1564859730;G:1774018840;T:1969664072;N:48296	8	28	91	2230570510	1564859730	1774018840	1969664072	48296	SRX24330059	SRS21091017	SRA1850361	Oregon Health and Science Univ	Oregon Health and Science Univ												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-04-22	Hatching	Embryo	Embryo Imprecise	All anatomical structures
31874	31874	SRR28764742	SRX24330059	SRS21091017	SRP502657	PRJNA1101966	Pioneer neurons are molecularly distinct and their axon targeting is regulated by retinoic acid signaling	GSE264323	Transcriptome Analysis	During nervous system development pioneer neurons are the first to extend their axons into target tissues creating a scaffold for follower neurons. Despite years of study whether pioneer neurons are a molecularly distinct population is unknown. Analysis of zebrafish posterior lateral line pLL sensory neurons during axon growth using single cell RNA sequencing scRNA seq revealed that pioneer and follower neurons are transcriptionally distinct. Expression profiling of differentiating pLL progenitors defined follower as the ground state whereas “pioneer” is a later developmental state. The scRNA seq data revealed active retinoic acid RA signaling in followers but not in pioneers. Modulation of RA signaling within single pLL neurons showed that its downregulation in pioneers is necessary for expression of neurotrophic factor receptor ret which is required for correct targeting of pioneer axons. Our study provided insights into the molecular landscape of pioneer neurons and revealed the regulatory role of RA signaling in their development. Overall design: Fourteen hpf eighteen hpf twenty two hpf forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 7…				CEL210312AN WT 48h	GSM8222580		source name:zebrafish embryo\|cell type:neuron\|tissue:zebrafish embryo\|strain:mixed\|age:48 hpf loc name:missing\|collection date:missing	CEL210312AN WT 48h	using Cell Ranger version 3.1.0; 10X Genomics Pleasanton CA. USA Assembly: ZebraFishGRCz11 Supplementary files format and content: Tab separated values files and matrix files	zebrafish embryo	Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer’s solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer’s solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter’s instructions single cell 3’ v3 protocol 10x Genomics.		cell type:neuron\|tissue:zebrafish embryo\|strain:mixed\|age:48 hpf	GSM8222580	GSM8222580: CEL210312AN WT 48h; Danio rerio; RNA Seq	GSM8222580 r1	GSM8222580	1	Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter's instructions single cell three prime v3 protocol 10x Genomics.		RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP502657		loader:fastq load.py	CEL210312AN_WT_48h_S102_L003_I1_001.fastq.gz CEL210312AN_WT_48h_S102_L003_R1_001.fastq.gz CEL210312AN_WT_48h_S102_L003_R2_001.fastq.gz	fastq fastq fastq	10393048429.0	81835027.0	GSM8222580 r3	0:8 1:28 2:91	A:2205422432;C:1544223539;G:1750760277;T:1946533138;N:48071	8	28	91	2205422432	1544223539	1750760277	1946533138	48071	SRX24330059	SRS21091017	SRA1850361	Oregon Health and Science Univ	Oregon Health and Science Univ												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-04-22	Hatching	Embryo	Embryo Imprecise	All anatomical structures
31875	31875	SRR28764743	SRX24330059	SRS21091017	SRP502657	PRJNA1101966	Pioneer neurons are molecularly distinct and their axon targeting is regulated by retinoic acid signaling	GSE264323	Transcriptome Analysis	During nervous system development pioneer neurons are the first to extend their axons into target tissues creating a scaffold for follower neurons. Despite years of study whether pioneer neurons are a molecularly distinct population is unknown. Analysis of zebrafish posterior lateral line pLL sensory neurons during axon growth using single cell RNA sequencing scRNA seq revealed that pioneer and follower neurons are transcriptionally distinct. Expression profiling of differentiating pLL progenitors defined follower as the ground state whereas “pioneer” is a later developmental state. The scRNA seq data revealed active retinoic acid RA signaling in followers but not in pioneers. Modulation of RA signaling within single pLL neurons showed that its downregulation in pioneers is necessary for expression of neurotrophic factor receptor ret which is required for correct targeting of pioneer axons. Our study provided insights into the molecular landscape of pioneer neurons and revealed the regulatory role of RA signaling in their development. Overall design: Fourteen hpf eighteen hpf twenty two hpf forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 7…				CEL210312AN WT 48h	GSM8222580		source name:zebrafish embryo\|cell type:neuron\|tissue:zebrafish embryo\|strain:mixed\|age:48 hpf loc name:missing\|collection date:missing	CEL210312AN WT 48h	using Cell Ranger version 3.1.0; 10X Genomics Pleasanton CA. USA Assembly: ZebraFishGRCz11 Supplementary files format and content: Tab separated values files and matrix files	zebrafish embryo	Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer’s solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer’s solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter’s instructions single cell 3’ v3 protocol 10x Genomics.		cell type:neuron\|tissue:zebrafish embryo\|strain:mixed\|age:48 hpf	GSM8222580	GSM8222580: CEL210312AN WT 48h; Danio rerio; RNA Seq	GSM8222580 r1	GSM8222580	1	Forty eight hpf TgBACneurod1:EGFPnl1 zebrafish embryos were collected and euthanized in 1.7 ml microcentrifuge tubes. Embryos were deyolked using a calcium free Ringer's solution 116 mM NaCl 2.6 mM KCl 5 mM HEPES pH 7.0 by gently pipetting up and down with a P200 pipet. Embryos were incubated for 5 minutes in Ringer's solution. Embryos were transferred to pre warmed protease solutions 0.25% trypsin 1 mM EDTA pH 8.0 PBS and collagenase P/HBSS 100 mg/mL was added. Embryos were incubated at 28° C for 15 minutes and were homogenized every 5 minutes using a P1000 pipet. The Stop solution 6X 30% calf serum 6 mM CaCl2 PBS was added and samples were centrifuged 350xg 4° C for 5 minutes. Supernatant was removed and 1 mL of chilled suspension solution was added 1% FBS 0.8 mM CaCl2 50 U/mL penicillin 0.05 mg/mL streptomycin DMEM. Samples were centrifuged again 350g 4° C for 5 minutes and supernatant was removed. 700 μl of chilled suspension solution was added and cells were resuspended by pipetting. Cells were passed through a 40 μm cell strainer into a FACs tube and kept on ice. GFP and RFP+ cells were FAC sorted on a BD Symphony cell sorter into sorting buffer 50 μl PBS/ 2% BSA in a siliconized 1.5mL tube. Library was performed according to the manufacter's instructions single cell three prime v3 protocol 10x Genomics.		RNA-Seq	TRANSCRIPTOMIC SINGLE CELL	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP502657		loader:fastq load.py	CEL210312AN_WT_48h_S103_L003_I1_001.fastq.gz CEL210312AN_WT_48h_S103_L003_R1_001.fastq.gz CEL210312AN_WT_48h_S103_L003_R2_001.fastq.gz	fastq fastq fastq	1539235301.0	12119963.0	GSM8222580 r4	0:8 1:28 2:91	A:326058980;C:228846142;G:262343444;T:285660694;N:7373	8	28	91	326058980	228846142	262343444	285660694	7373	SRX24330059	SRS21091017	SRA1850361	Oregon Health and Science Univ	Oregon Health and Science Univ												B		usable mapping rate	illumina	novaseq_era	unknown	cdna_unspecified	unknown	sc	single_cell_droplet	10x	United States	2024-04-22	Hatching	Embryo	Embryo Imprecise	All anatomical structures
32370	32370	SRR29180530	SRX24700714	SRS21428245	SRP509851	PRJNA1116337	Ioxynil and diethylstilbestrol disrupt vascular and heart development in zebrafish	PRJNA1116337	Other	Endocrine disruption is one of the consequences of industrialization and chemicals released into theenvironment have a profound impact on organisms. Waterborne micromolar concentrations of ioxynil IOX and diethylstilbestrol DES in fish affect the development of the heart vasculature and thyroid gland.					DES		isolate:exposure to DES\|age:48 hpf\|dev stage:embryos\|collection date:2018 06\|geo loc name:Portugal\|sex:pooled male and female\|tissue:embryos\|treatment:exposure to DES\|BioSampleModel:Model organism or animal								RNA seq of DES treated	DES	DES	Sequencing the transcriptomes of zebrafish embryos of DES treated			RNA-Seq	TRANSCRIPTOMIC	RANDOM	SINGLE	ILLUMINA	Illumina HiSeq 4000		SRP509851			DES_TAAGGC_L001_R1_001.fastq.gz DES_TAAGGC_L001_R2_001.fastq.gz	fastq fastq	9169560000.0	30565200.0	DES TAAGGC L001 R1 001.fastq.gz	0:150 1:150	A:2545096687;C:2037322055;G:2024787099;T:2562124529;N:229630	150	150		2545096687	2037322055	2024787099	2562124529	229630	SRX24700714	SRS21428245	SRA1878028	Shanghai Ocean University\|College of Fisheries and Life Science	Shanghai Ocean University												B	B	biological fallback assumption	illumina	hiseq_era	unknown	random_priming	unknown	bulk	unknown	unknown	China	2024-05-25	Hatching	Embryo	Embryo Imprecise	All anatomical structures
32371	32371	SRR29180531	SRX24700713	SRS21428246	SRP509851	PRJNA1116337	Ioxynil and diethylstilbestrol disrupt vascular and heart development in zebrafish	PRJNA1116337	Other	Endocrine disruption is one of the consequences of industrialization and chemicals released into theenvironment have a profound impact on organisms. Waterborne micromolar concentrations of ioxynil IOX and diethylstilbestrol DES in fish affect the development of the heart vasculature and thyroid gland.					IOX		isolate:exposure to IOX\|age:48 hpf\|dev stage:embryos\|collection date:2018 06\|geo loc name:Portugal\|sex:pooled male and female\|tissue:embryos\|treatment:exposure to IOX\|BioSampleModel:Model organism or animal								RNA seq of IOX treated	IOX	IOX	Sequencing the transcriptomes of zebrafish embryos of IOX treated			RNA-Seq	TRANSCRIPTOMIC	RANDOM	PAIRED	ILLUMINA	Illumina HiSeq 4000		SRP509851			IOX_CGTACT_L001_R1_001.fastq.gz IOX_CGTACT_L001_R2_001.fastq.gz	fastq fastq	9547157100.0	31823857.0	IOX CGTACT L001 R1 001.fastq.gz	0:150 1:150	A:2631030736;C:2146265744;G:2124421595;T:2645201596;N:237429	150	150		2631030736	2146265744	2124421595	2645201596	237429	SRX24700713	SRS21428246	SRA1878028	Shanghai Ocean University\|College of Fisheries and Life Science	Shanghai Ocean University												B	B	biological fallback assumption	illumina	hiseq_era	unknown	random_priming	unknown	bulk	unknown	unknown	China	2024-05-25	Hatching	Embryo	Embryo Imprecise	All anatomical structures
32372	32372	SRR29180532	SRX24700712	SRS21428244	SRP509851	PRJNA1116337	Ioxynil and diethylstilbestrol disrupt vascular and heart development in zebrafish	PRJNA1116337	Other	Endocrine disruption is one of the consequences of industrialization and chemicals released into theenvironment have a profound impact on organisms. Waterborne micromolar concentrations of ioxynil IOX and diethylstilbestrol DES in fish affect the development of the heart vasculature and thyroid gland.					CTR		isolate:control\|age:48 hpf\|dev stage:embryos\|collection date:2018 06\|geo loc name:Portugal\|sex:pooled male and female\|tissue:embryos\|treatment:control\|BioSampleModel:Model organism or animal								RNA seq of CTR treated	CTR	CTR	Sequencing the transcriptomes of zebrafish embryos of control			RNA-Seq	TRANSCRIPTOMIC	RANDOM	PAIRED	ILLUMINA	Illumina HiSeq 4000		SRP509851			CTR_AGGCAG_L001_R1_001.fastq.gz CTR_AGGCAG_L001_R2_001.fastq.gz	fastq fastq	9602954100.0	32009847.0	CTR AGGCAG L001 R1 001.fastq.gz	0:150 1:150	A:2637866848;C:2169057233;G:2152906664;T:2642882530;N:240825	150	150		2637866848	2169057233	2152906664	2642882530	240825	SRX24700712	SRS21428244	SRA1878028	Shanghai Ocean University\|College of Fisheries and Life Science	Shanghai Ocean University												B	B	biological fallback assumption	illumina	hiseq_era	unknown	random_priming	unknown	bulk	unknown	unknown	China	2024-05-25	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33990	33990	SRR31030860	SRX26416598	SRS22936450	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep4 minus	GSM8578751		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep4 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578751	GSM8578751: ZF NES GAPDH Rep4 minus; Danio rerio; OTHER	GSM8578751 r1	GSM8578751	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_GAPDH_Rep4_minus.R1.fq.gz ZF_NES_GAPDH_Rep4_minus.R2.fq.gz	fastq fastq	1100578200.0	3668594.0	GSM8578751 r1	0:150 1:150	A:287878221;C:249390946;G:265835736;T:297454600;N:18697	150	150		287878221	249390946	265835736	297454600	18697	SRX26416598	SRS22936450	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33991	33991	SRR31030861	SRX26416597	SRS22936451	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep3 plus	GSM8578750		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep3 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578750	GSM8578750: ZF NES GAPDH Rep3 plus; Danio rerio; OTHER	GSM8578750 r1	GSM8578750	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_GAPDH_Rep3_plus.R1.fq.gz ZF_NES_GAPDH_Rep3_plus.R2.fq.gz	fastq fastq	1231779300.0	4105931.0	GSM8578750 r1	0:150 1:150	A:322256597;C:278991471;G:297394980;T:333116282;N:19970	150	150		322256597	278991471	297394980	333116282	19970	SRX26416597	SRS22936451	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33992	33992	SRR31030862	SRX26416596	SRS22936449	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep3 minus	GSM8578749		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep3 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578749	GSM8578749: ZF NES GAPDH Rep3 minus; Danio rerio; OTHER	GSM8578749 r1	GSM8578749	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_GAPDH_Rep3_minus.R1.fq.gz ZF_NES_GAPDH_Rep3_minus.R2.fq.gz	fastq fastq	1002124500.0	3340415.0	GSM8578749 r1	0:150 1:150	A:262024969;C:227163761;G:242157218;T:270761424;N:17128	150	150		262024969	227163761	242157218	270761424	17128	SRX26416596	SRS22936449	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33993	33993	SRR31030863	SRX26416595	SRS22936448	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep2 plus	GSM8578748		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep2 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578748	GSM8578748: ZF NES GAPDH Rep2 plus; Danio rerio; OTHER	GSM8578748 r1	GSM8578748	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_GAPDH_Rep2_plus.R1.fq.gz ZF_NES_GAPDH_Rep2_plus.R2.fq.gz	fastq fastq	1051565100.0	3505217.0	GSM8578748 r1	0:150 1:150	A:275784945;C:237523425;G:253300749;T:284937948;N:18033	150	150		275784945	237523425	253300749	284937948	18033	SRX26416595	SRS22936448	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33994	33994	SRR31030864	SRX26416594	SRS22936447	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep2 minus	GSM8578747		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep2 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578747	GSM8578747: ZF NES GAPDH Rep2 minus; Danio rerio; OTHER	GSM8578747 r1	GSM8578747	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_GAPDH_Rep2_minus.R1.fq.gz ZF_NES_GAPDH_Rep2_minus.R2.fq.gz	fastq fastq	1021837200.0	3406124.0	GSM8578747 r1	0:150 1:150	A:268290250;C:230525208;G:245949056;T:277056045;N:16641	150	150		268290250	230525208	245949056	277056045	16641	SRX26416594	SRS22936447	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33995	33995	SRR31030865	SRX26416593	SRS22936446	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep1 plus	GSM8578746		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep1 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578746	GSM8578746: ZF NES GAPDH Rep1 plus; Danio rerio; OTHER	GSM8578746 r1	GSM8578746	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_GAPDH_Rep1_plus.R1.fq.gz ZF_NES_GAPDH_Rep1_plus.R2.fq.gz	fastq fastq	1093620300.0	3645401.0	GSM8578746 r1	0:150 1:150	A:285989719;C:247805250;G:264181043;T:295625946;N:18342	150	150		285989719	247805250	264181043	295625946	18342	SRX26416593	SRS22936446	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33996	33996	SRR31030866	SRX26416592	SRS22936445	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep1 minus	GSM8578745		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep1 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578745	GSM8578745: ZF NES GAPDH Rep1 minus; Danio rerio; OTHER	GSM8578745 r1	GSM8578745	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_GAPDH_Rep1_minus.R1.fq.gz ZF_NES_GAPDH_Rep1_minus.R2.fq.gz	fastq fastq	911747100.0	3039157.0	GSM8578745 r1	0:150 1:150	A:239833349;C:205185786;G:218897710;T:247814511;N:15744	150	150		239833349	205185786	218897710	247814511	15744	SRX26416592	SRS22936445	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33997	33997	SRR31030867	SRX26416591	SRS22936444	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep4 plus	GSM8578744		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep4 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578744	GSM8578744: ZF H2B MALAT1 Rep4 plus; Danio rerio; OTHER	GSM8578744 r1	GSM8578744	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_MALAT1_Rep4_plus.R1.fq.gz ZF_H2B_MALAT1_Rep4_plus.R2.fq.gz	fastq fastq	842103300.0	2807011.0	GSM8578744 r1	0:150 1:150	A:204870477;C:222752099;G:215404135;T:199062275;N:14314	150	150		204870477	222752099	215404135	199062275	14314	SRX26416591	SRS22936444	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33998	33998	SRR31030868	SRX26416590	SRS22936442	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep4 minus	GSM8578743		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep4 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578743	GSM8578743: ZF H2B MALAT1 Rep4 minus; Danio rerio; OTHER	GSM8578743 r1	GSM8578743	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_MALAT1_Rep4_minus.R1.fq.gz ZF_H2B_MALAT1_Rep4_minus.R2.fq.gz	fastq fastq	1166375100.0	3887917.0	GSM8578743 r1	0:150 1:150	A:283781955;C:308660466;G:298298204;T:275614377;N:20098	150	150		283781955	308660466	298298204	275614377	20098	SRX26416590	SRS22936442	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
33999	33999	SRR31030869	SRX26416589	SRS22936443	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep3 plus	GSM8578742		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep3 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578742	GSM8578742: ZF H2B MALAT1 Rep3 plus; Danio rerio; OTHER	GSM8578742 r1	GSM8578742	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_MALAT1_Rep3_plus.R1.fq.gz ZF_H2B_MALAT1_Rep3_plus.R2.fq.gz	fastq fastq	1159439400.0	3864798.0	GSM8578742 r1	0:150 1:150	A:282055391;C:306842216;G:296569227;T:273952570;N:19996	150	150		282055391	306842216	296569227	273952570	19996	SRX26416589	SRS22936443	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34000	34000	SRR31030870	SRX26416588	SRS22936440	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep3 minus	GSM8578741		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep3 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578741	GSM8578741: ZF H2B MALAT1 Rep3 minus; Danio rerio; OTHER	GSM8578741 r1	GSM8578741	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_MALAT1_Rep3_minus.R1.fq.gz ZF_H2B_MALAT1_Rep3_minus.R2.fq.gz	fastq fastq	1008297600.0	3360992.0	GSM8578741 r1	0:150 1:150	A:245277585;C:266840408;G:257911846;T:238251305;N:16456	150	150		245277585	266840408	257911846	238251305	16456	SRX26416588	SRS22936440	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34001	34001	SRR31030871	SRX26416587	SRS22936441	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep2 plus	GSM8578740		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep2 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578740	GSM8578740: ZF H2B MALAT1 Rep2 plus; Danio rerio; OTHER	GSM8578740 r1	GSM8578740	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_MALAT1_Rep2_plus.R1.fq.gz ZF_H2B_MALAT1_Rep2_plus.R2.fq.gz	fastq fastq	1419263400.0	4730878.0	GSM8578740 r1	0:150 1:150	A:345302268;C:375591885;G:362956395;T:335387828;N:25024	150	150		345302268	375591885	362956395	335387828	25024	SRX26416587	SRS22936441	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34002	34002	SRR31030872	SRX26416586	SRS22936439	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep2 minus	GSM8578739		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep2 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578739	GSM8578739: ZF H2B MALAT1 Rep2 minus; Danio rerio; OTHER	GSM8578739 r1	GSM8578739	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_MALAT1_Rep2_minus.R1.fq.gz ZF_H2B_MALAT1_Rep2_minus.R2.fq.gz	fastq fastq	1249910700.0	4166369.0	GSM8578739 r1	0:150 1:150	A:304074828;C:330741431;G:319677748;T:295395235;N:21458	150	150		304074828	330741431	319677748	295395235	21458	SRX26416586	SRS22936439	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34003	34003	SRR31030873	SRX26416585	SRS22936438	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep1 plus	GSM8578738		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep1 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578738	GSM8578738: ZF H2B MALAT1 Rep1 plus; Danio rerio; OTHER	GSM8578738 r1	GSM8578738	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_MALAT1_Rep1_plus.R1.fq.gz ZF_H2B_MALAT1_Rep1_plus.R2.fq.gz	fastq fastq	1257872700.0	4192909.0	GSM8578738 r1	0:150 1:150	A:306022947;C:332851039;G:321699513;T:297277788;N:21413	150	150		306022947	332851039	321699513	297277788	21413	SRX26416585	SRS22936438	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34004	34004	SRR31030874	SRX26416584	SRS22936437	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B MALAT1 Rep1 minus	GSM8578737		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B MALAT1 Rep1 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578737	GSM8578737: ZF H2B MALAT1 Rep1 minus; Danio rerio; OTHER	GSM8578737 r1	GSM8578737	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_MALAT1_Rep1_minus.R1.fq.gz ZF_H2B_MALAT1_Rep1_minus.R2.fq.gz	fastq fastq	1377040200.0	4590134.0	GSM8578737 r1	0:150 1:150	A:335021330;C:364359707;G:352178356;T:325457746;N:23061	150	150		335021330	364359707	352178356	325457746	23061	SRX26416584	SRS22936437	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34005	34005	SRR31030875	SRX26416583	SRS22936435	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep4 plus	GSM8578736		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep4 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578736	GSM8578736: ZF H2B GAPDH Rep4 plus; Danio rerio; OTHER	GSM8578736 r1	GSM8578736	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_GAPDH_Rep4_plus.R1.fq.gz ZF_H2B_GAPDH_Rep4_plus.R2.fq.gz	fastq fastq	1051103100.0	3503677.0	GSM8578736 r1	0:150 1:150	A:274220771;C:238733668;G:254670769;T:283460283;N:17609	150	150		274220771	238733668	254670769	283460283	17609	SRX26416583	SRS22936435	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34006	34006	SRR31030876	SRX26416582	SRS22936436	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep4 minus	GSM8578735		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep4 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578735	GSM8578735: ZF H2B GAPDH Rep4 minus; Danio rerio; OTHER	GSM8578735 r1	GSM8578735	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_GAPDH_Rep4_minus.R1.fq.gz ZF_H2B_GAPDH_Rep4_minus.R2.fq.gz	fastq fastq	1206485700.0	4021619.0	GSM8578735 r1	0:150 1:150	A:314740194;C:274101014;G:292357972;T:325267132;N:19388	150	150		314740194	274101014	292357972	325267132	19388	SRX26416582	SRS22936436	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34007	34007	SRR31030877	SRX26416581	SRS22936434	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep3 plus	GSM8578734		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep3 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578734	GSM8578734: ZF H2B GAPDH Rep3 plus; Danio rerio; OTHER	GSM8578734 r1	GSM8578734	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_GAPDH_Rep3_plus.R1.fq.gz ZF_H2B_GAPDH_Rep3_plus.R2.fq.gz	fastq fastq	1140550200.0	3801834.0	GSM8578734 r1	0:150 1:150	A:297636297;C:258828826;G:276373993;T:307692213;N:18871	150	150		297636297	258828826	276373993	307692213	18871	SRX26416581	SRS22936434	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34008	34008	SRR31030878	SRX26416580	SRS22936433	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep3 minus	GSM8578733		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep3 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578733	GSM8578733: ZF H2B GAPDH Rep3 minus; Danio rerio; OTHER	GSM8578733 r1	GSM8578733	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_GAPDH_Rep3_minus.R1.fq.gz ZF_H2B_GAPDH_Rep3_minus.R2.fq.gz	fastq fastq	782406600.0	2608022.0	GSM8578733 r1	0:150 1:150	A:204132316;C:177696721;G:189675433;T:210888939;N:13191	150	150		204132316	177696721	189675433	210888939	13191	SRX26416580	SRS22936433	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34009	34009	SRR31030879	SRX26416579	SRS22936431	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep2 plus	GSM8578732		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep2 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578732	GSM8578732: ZF H2B GAPDH Rep2 plus; Danio rerio; OTHER	GSM8578732 r1	GSM8578732	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_GAPDH_Rep2_plus.R1.fq.gz ZF_H2B_GAPDH_Rep2_plus.R2.fq.gz	fastq fastq	958297200.0	3194324.0	GSM8578732 r1	0:150 1:150	A:250011335;C:217600823;G:232206339;T:258462392;N:16311	150	150		250011335	217600823	232206339	258462392	16311	SRX26416579	SRS22936431	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34010	34010	SRR31030880	SRX26416578	SRS22936432	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep2 minus	GSM8578731		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep2 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578731	GSM8578731: ZF H2B GAPDH Rep2 minus; Danio rerio; OTHER	GSM8578731 r1	GSM8578731	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_GAPDH_Rep2_minus.R1.fq.gz ZF_H2B_GAPDH_Rep2_minus.R2.fq.gz	fastq fastq	1020926700.0	3403089.0	GSM8578731 r1	0:150 1:150	A:266429488;C:231749424;G:247353147;T:275377720;N:16921	150	150		266429488	231749424	247353147	275377720	16921	SRX26416578	SRS22936432	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34011	34011	SRR31030881	SRX26416577	SRS22936430	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep1 plus	GSM8578730		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep1 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:plus DBF	GSM8578730	GSM8578730: ZF H2B GAPDH Rep1 plus; Danio rerio; OTHER	GSM8578730 r1	GSM8578730	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_GAPDH_Rep1_plus.R1.fq.gz ZF_H2B_GAPDH_Rep1_plus.R2.fq.gz	fastq fastq	1134318600.0	3781062.0	GSM8578730 r1	0:150 1:150	A:295931335;C:257596481;G:274848790;T:305922827;N:19167	150	150		295931335	257596481	274848790	305922827	19167	SRX26416577	SRS22936430	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34012	34012	SRR31030882	SRX26416576	SRS22936429	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF H2B GAPDH Rep1 minus	GSM8578729		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF H2B GAPDH Rep1 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo H2B\|treatment:minus DBF	GSM8578729	GSM8578729: ZF H2B GAPDH Rep1 minus; Danio rerio; OTHER	GSM8578729 r1	GSM8578729	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_H2B_GAPDH_Rep1_minus.R1.fq.gz ZF_H2B_GAPDH_Rep1_minus.R2.fq.gz	fastq fastq	752638800.0	2508796.0	GSM8578729 r1	0:150 1:150	A:196331185;C:170899863;G:182460258;T:202935049;N:12445	150	150		196331185	170899863	182460258	202935049	12445	SRX26416576	SRS22936429	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate1-mate2 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34013	34013	SRR31031004	SRX26416454	SRS22936307	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		Zeb WT pDBF Rep3	GSM8578770		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:wildtype\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	Zeb WT pDBF Rep3	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:wildtype\|treatment:plus DBF	GSM8578770	GSM8578770: Zeb WT pDBF Rep3; Danio rerio; OTHER	GSM8578770 r1	GSM8578770	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			Zeb_WT_pDBF_Rep3.R1.fq.gz Zeb_WT_pDBF_Rep3.R2.fq.gz	fastq fastq	23216831100.0	77389437.0	GSM8578770 r1	0:150 1:150	A:7577896837;C:3508911439;G:4823311862;T:7306393244;N:317718	150	150		7577896837	3508911439	4823311862	7306393244	317718	SRX26416454	SRS22936307	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34014	34014	SRR31031005	SRX26416453	SRS22936305	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		Zeb WT pDBF Rep2	GSM8578769		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:wildtype\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	Zeb WT pDBF Rep2	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:wildtype\|treatment:plus DBF	GSM8578769	GSM8578769: Zeb WT pDBF Rep2; Danio rerio; OTHER	GSM8578769 r1	GSM8578769	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			Zeb_WT_pDBF_Rep2.R1.fq.gz Zeb_WT_pDBF_Rep2.R2.fq.gz	fastq fastq	27237049500.0	90790165.0	GSM8578769 r1	0:150 1:150	A:8800724632;C:4062692793;G:5651432074;T:8721823175;N:376826	150	150		8800724632	4062692793	5651432074	8721823175	376826	SRX26416453	SRS22936305	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34015	34015	SRR31031006	SRX26416452	SRS22936306	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		Zeb WT pDBF Rep1	GSM8578768		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:wildtype\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	Zeb WT pDBF Rep1	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:wildtype\|treatment:plus DBF	GSM8578768	GSM8578768: Zeb WT pDBF Rep1; Danio rerio; OTHER	GSM8578768 r1	GSM8578768	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			Zeb_WT_pDBF_Rep1.R1.fq.gz Zeb_WT_pDBF_Rep1.R2.fq.gz	fastq fastq	22364115300.0	74547051.0	GSM8578768 r1	0:150 1:150	A:7336106577;C:3346831944;G:4451536371;T:7229335436;N:304972	150	150		7336106577	3346831944	4451536371	7229335436	304972	SRX26416452	SRS22936306	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34016	34016	SRR31031007	SRX26416451	SRS22936304	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		Zeb WT mDBF Rep3	GSM8578767		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:wildtype\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	Zeb WT mDBF Rep3	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:wildtype\|treatment:minus DBF	GSM8578767	GSM8578767: Zeb WT mDBF Rep3; Danio rerio; OTHER	GSM8578767 r1	GSM8578767	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			Zeb_WT_mDBF_Rep3.R1.fq.gz Zeb_WT_mDBF_Rep3.R2.fq.gz	fastq fastq	20112719100.0	67042397.0	GSM8578767 r1	0:150 1:150	A:6537370232;C:2924919118;G:3973928235;T:6676228153;N:273362	150	150		6537370232	2924919118	3973928235	6676228153	273362	SRX26416451	SRS22936304	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34017	34017	SRR31031008	SRX26416450	SRS22936303	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		Zeb WT mDBF Rep2	GSM8578766		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:wildtype\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	Zeb WT mDBF Rep2	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:wildtype\|treatment:minus DBF	GSM8578766	GSM8578766: Zeb WT mDBF Rep2; Danio rerio; OTHER	GSM8578766 r1	GSM8578766	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			Zeb_WT_mDBF_Rep2.R1.fq.gz Zeb_WT_mDBF_Rep2.R2.fq.gz	fastq fastq	24839552100.0	82798507.0	GSM8578766 r1	0:150 1:150	A:8176074473;C:3715794630;G:4984816273;T:7962528150;N:338574	150	150		8176074473	3715794630	4984816273	7962528150	338574	SRX26416450	SRS22936303	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34018	34018	SRR31031009	SRX26416449	SRS22936302	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		Zeb WT mDBF Rep1	GSM8578765		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:wildtype\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	Zeb WT mDBF Rep1	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:wildtype\|treatment:minus DBF	GSM8578765	GSM8578765: Zeb WT mDBF Rep1; Danio rerio; OTHER	GSM8578765 r1	GSM8578765	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			Zeb_WT_mDBF_Rep1.R1.fq.gz Zeb_WT_mDBF_Rep1.R2.fq.gz	fastq fastq	23029785600.0	76765952.0	GSM8578765 r1	0:150 1:150	A:7509388471;C:3438475939;G:4820328116;T:7261277960;N:315114	150	150		7509388471	3438475939	4820328116	7261277960	315114	SRX26416449	SRS22936302	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34019	34019	SRR31031010	SRX26416448	SRS22936301	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		Zeb NES pDBF Rep2	GSM8578764		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	Zeb NES pDBF Rep2	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578764	GSM8578764: Zeb NES pDBF Rep2; Danio rerio; OTHER	GSM8578764 r1	GSM8578764	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			Zeb_NES_pDBF_Rep2.R1.fq.gz Zeb_NES_pDBF_Rep2.R2.fq.gz	fastq fastq	25465584900.0	84885283.0	GSM8578764 r1	0:150 1:150	A:7944190976;C:4330095891;G:5473069331;T:7718120992;N:107710	150	150		7944190976	4330095891	5473069331	7718120992	107710	SRX26416448	SRS22936301	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34020	34020	SRR31031011	SRX26416447	SRS22936300	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		Zeb NES pDBF Rep1	GSM8578763		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	Zeb NES pDBF Rep1	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578763	GSM8578763: Zeb NES pDBF Rep1; Danio rerio; OTHER	GSM8578763 r1	GSM8578763	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			Zeb_NES_pDBF_Rep1.R1.fq.gz Zeb_NES_pDBF_Rep1.R2.fq.gz	fastq fastq	21107351400.0	70357838.0	GSM8578763 r1	0:150 1:150	A:6528579219;C:3620666961;G:4496642830;T:6461373643;N:88747	150	150		6528579219	3620666961	4496642830	6461373643	88747	SRX26416447	SRS22936300	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34021	34021	SRR31031012	SRX26416446	SRS22936299	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		Zeb NES mDBF Rep2	GSM8578762		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	Zeb NES mDBF Rep2	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578762	GSM8578762: Zeb NES mDBF Rep2; Danio rerio; OTHER	GSM8578762 r1	GSM8578762	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			Zeb_NES_mDBF_Rep2.R1.fq.gz Zeb_NES_mDBF_Rep2.R2.fq.gz	fastq fastq	21542967300.0	71809891.0	GSM8578762 r1	0:150 1:150	A:6722613760;C:3654507931;G:4628076548;T:6537678084;N:90977	150	150		6722613760	3654507931	4628076548	6537678084	90977	SRX26416446	SRS22936299	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34022	34022	SRR31031013	SRX26416445	SRS22936297	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		Zeb NES mDBF Rep1	GSM8578761		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	Zeb NES mDBF Rep1	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578761	GSM8578761: Zeb NES mDBF Rep1; Danio rerio; OTHER	GSM8578761 r1	GSM8578761	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			Zeb_NES_mDBF_Rep1.R1.fq.gz Zeb_NES_mDBF_Rep1.R2.fq.gz	fastq fastq	23038870800.0	76796236.0	GSM8578761 r1	0:150 1:150	A:7216059153;C:3815899397;G:4909028200;T:7097787584;N:96466	150	150		7216059153	3815899397	4909028200	7097787584	96466	SRX26416445	SRS22936297	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	mate2-mate1 similar by mapping diff	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34023	34023	SRR31031014	SRX26416444	SRS22936298	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep4 plus	GSM8578760		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep4 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578760	GSM8578760: ZF NES MALAT1 Rep4 plus; Danio rerio; OTHER	GSM8578760 r1	GSM8578760	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_MALAT1_Rep4_plus.R1.fq.gz ZF_NES_MALAT1_Rep4_plus.R2.fq.gz	fastq fastq	1091293200.0	3637644.0	GSM8578760 r1	0:150 1:150	A:265519561;C:288647650;G:279105515;T:258001510;N:18964	150	150		265519561	288647650	279105515	258001510	18964	SRX26416444	SRS22936298	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34024	34024	SRR31031015	SRX26416443	SRS22936296	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep4 minus	GSM8578759		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep4 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578759	GSM8578759: ZF NES MALAT1 Rep4 minus; Danio rerio; OTHER	GSM8578759 r1	GSM8578759	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_MALAT1_Rep4_minus.R1.fq.gz ZF_NES_MALAT1_Rep4_minus.R2.fq.gz	fastq fastq	1395963600.0	4653212.0	GSM8578759 r1	0:150 1:150	A:339654289;C:369433701;G:356957685;T:329893853;N:24072	150	150		339654289	369433701	356957685	329893853	24072	SRX26416443	SRS22936296	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34025	34025	SRR31031016	SRX26416442	SRS22936295	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep3 plus	GSM8578758		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep3 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578758	GSM8578758: ZF NES MALAT1 Rep3 plus; Danio rerio; OTHER	GSM8578758 r1	GSM8578758	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_MALAT1_Rep3_plus.R1.fq.gz ZF_NES_MALAT1_Rep3_plus.R2.fq.gz	fastq fastq	1556195100.0	5187317.0	GSM8578758 r1	0:150 1:150	A:378553535;C:411730281;G:398086882;T:367797563;N:26839	150	150		378553535	411730281	398086882	367797563	26839	SRX26416442	SRS22936295	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34026	34026	SRR31031017	SRX26416441	SRS22936294	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep3 minus	GSM8578757		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep3 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578757	GSM8578757: ZF NES MALAT1 Rep3 minus; Danio rerio; OTHER	GSM8578757 r1	GSM8578757	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_MALAT1_Rep3_minus.R1.fq.gz ZF_NES_MALAT1_Rep3_minus.R2.fq.gz	fastq fastq	1511328900.0	5037763.0	GSM8578757 r1	0:150 1:150	A:367639521;C:400036694;G:386523395;T:357103340;N:25950	150	150		367639521	400036694	386523395	357103340	25950	SRX26416441	SRS22936294	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34027	34027	SRR31031018	SRX26416440	SRS22936293	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep2 plus	GSM8578756		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep2 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578756	GSM8578756: ZF NES MALAT1 Rep2 plus; Danio rerio; OTHER	GSM8578756 r1	GSM8578756	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_MALAT1_Rep2_plus.R1.fq.gz ZF_NES_MALAT1_Rep2_plus.R2.fq.gz	fastq fastq	1451137800.0	4837126.0	GSM8578756 r1	0:150 1:150	A:353052445;C:383981771;G:371154128;T:342925275;N:24181	150	150		353052445	383981771	371154128	342925275	24181	SRX26416440	SRS22936293	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34028	34028	SRR31031019	SRX26416439	SRS22936292	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep2 minus	GSM8578755		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep2 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578755	GSM8578755: ZF NES MALAT1 Rep2 minus; Danio rerio; OTHER	GSM8578755 r1	GSM8578755	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_MALAT1_Rep2_minus.R1.fq.gz ZF_NES_MALAT1_Rep2_minus.R2.fq.gz	fastq fastq	1286489400.0	4288298.0	GSM8578755 r1	0:150 1:150	A:312986127;C:340482608;G:329001591;T:303997982;N:21092	150	150		312986127	340482608	329001591	303997982	21092	SRX26416439	SRS22936292	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34029	34029	SRR31031020	SRX26416438	SRS22936291	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep1 plus	GSM8578754		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep1 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578754	GSM8578754: ZF NES MALAT1 Rep1 plus; Danio rerio; OTHER	GSM8578754 r1	GSM8578754	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_MALAT1_Rep1_plus.R1.fq.gz ZF_NES_MALAT1_Rep1_plus.R2.fq.gz	fastq fastq	1146380100.0	3821267.0	GSM8578754 r1	0:150 1:150	A:278826422;C:303464534;G:293239572;T:270830265;N:19307	150	150		278826422	303464534	293239572	270830265	19307	SRX26416438	SRS22936291	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34030	34030	SRR31031021	SRX26416437	SRS22936289	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES MALAT1 Rep1 minus	GSM8578753		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF\|geo loc name:missing\|collection date:missing	ZF NES MALAT1 Rep1 minus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:minus DBF	GSM8578753	GSM8578753: ZF NES MALAT1 Rep1 minus; Danio rerio; OTHER	GSM8578753 r1	GSM8578753	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_MALAT1_Rep1_minus.R1.fq.gz ZF_NES_MALAT1_Rep1_minus.R2.fq.gz	fastq fastq	1149087000.0	3830290.0	GSM8578753 r1	0:150 1:150	A:279487473;C:304130198;G:293947979;T:271501018;N:20332	150	150		279487473	304130198	293947979	271501018	20332	SRX26416437	SRS22936289	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
34031	34031	SRR31031022	SRX26416436	SRS22936290	SRP539182	PRJNA1174121	Quantification of subcellular RNA localization through direct detection of RNA oxidation	GSE279714	Other	Across cell types and organisms thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled facilitating their biotinylation and purification. However these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq RNAs near a genetically encoded localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package PIGPEN without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm ER and the inner and outer membranes of mitochondria. Finally using transgenic zebrafish we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.		pubmed:39605352;pubmed:40037712		ZF NES GAPDH Rep4 plus	GSM8578752		source name:2 dpf embryos\|tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF\|geo loc name:missing\|collection date:missing	ZF NES GAPDH Rep4 plus	OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.	2 dpf embryos	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.	HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.	tissue:2 dpf embryos\|genotype:Halo NES\|treatment:plus DBF	GSM8578752	GSM8578752: ZF NES GAPDH Rep4 plus; Danio rerio; OTHER	GSM8578752 r1	GSM8578752	1	RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina NovaSeq 6000		SRP539182			ZF_NES_GAPDH_Rep4_plus.R1.fq.gz ZF_NES_GAPDH_Rep4_plus.R2.fq.gz	fastq fastq	1010253300.0	3367511.0	GSM8578752 r1	0:150 1:150	A:264284161;C:228880831;G:244038984;T:273032130;N:17194	150	150		264284161	228880831	244038984	273032130	17194	SRX26416436	SRS22936290	SRA1993027	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus	Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus												B	B	biological fallback assumption	illumina	novaseq_era	full_length	random_priming	lexogen	bulk	unknown	unknown	United States	2024-10-17	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35460	35460	SRR32818804	SRX28102240	SRS24458287	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 8	GSM8863198		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 8	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control	GSM8863198	GSM8863198: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 8; Danio rerio; RNA Seq	GSM8863198 r1	GSM8863198	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P57-GTTCCAAT-GCAGAATT-READ1-Sequences.txt nR284-L2-G5-P57-GTTCCAAT-GCAGAATT-READ2-Sequences.txt	fastq fastq	10743485140.0	53185570.0	GSM8863198 r1	0:101 1:101	A:2043166141;C:3372557345;G:3302778932;T:2024928209;N:54513	101	101		2043166141	3372557345	3302778932	2024928209	54513	SRX28102240	SRS24458287	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35461	35461	SRR32818805	SRX28102239	SRS24458286	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 7	GSM8863197		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 7	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control	GSM8863197	GSM8863197: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 7; Danio rerio; RNA Seq	GSM8863197 r1	GSM8863197	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P56-GCAATGCA-AACGTTCC-READ1-Sequences.txt nR284-L2-G5-P56-GCAATGCA-AACGTTCC-READ2-Sequences.txt	fastq fastq	8690926174.0	43024387.0	GSM8863197 r1	0:101 1:101	A:1676436454;C:2706306943;G:2647919752;T:1660219021;N:44004	101	101		1676436454	2706306943	2647919752	1660219021	44004	SRX28102239	SRS24458286	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35462	35462	SRR32818806	SRX28102238	SRS24458285	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 6	GSM8863196		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 6	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control	GSM8863196	GSM8863196: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 6; Danio rerio; RNA Seq	GSM8863196 r1	GSM8863196	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P55-ATGGCATG-GGTACCTT-READ1-Sequences.txt nR284-L2-G5-P55-ATGGCATG-GGTACCTT-READ2-Sequences.txt	fastq fastq	10679789894.0	52870247.0	GSM8863196 r1	0:101 1:101	A:2075736321;C:3306230069;G:3245751043;T:2052019154;N:53307	101	101		2075736321	3306230069	3245751043	2052019154	53307	SRX28102238	SRS24458285	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35463	35463	SRR32818807	SRX28102237	SRS24458284	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 5	GSM8863195		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 5	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control	GSM8863195	GSM8863195: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 5; Danio rerio; RNA Seq	GSM8863195 r1	GSM8863195	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P54-GGAGCGTC-GCACGGAC-READ1-Sequences.txt nR284-L2-G5-P54-GGAGCGTC-GCACGGAC-READ2-Sequences.txt	fastq fastq	10631975484.0	52633542.0	GSM8863195 r1	0:101 1:101	A:1978520961;C:3379107355;G:3313372052;T:1960921814;N:53302	101	101		1978520961	3379107355	3313372052	1960921814	53302	SRX28102237	SRS24458284	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35464	35464	SRR32818808	SRX28102236	SRS24458283	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4	GSM8863194		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control	GSM8863194	GSM8863194: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4; Danio rerio; RNA Seq	GSM8863194 r1	GSM8863194	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P53-AAGATACT-ATGTAAGT-READ1-Sequences.txt nR284-L2-G5-P53-AAGATACT-ATGTAAGT-READ2-Sequences.txt	fastq fastq	11273189336.0	55807868.0	GSM8863194 r1	0:101 1:101	A:2204760360;C:3477277778;G:3404605220;T:2186489012;N:56966	101	101		2204760360	3477277778	3404605220	2186489012	56966	SRX28102236	SRS24458283	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35465	35465	SRR32818809	SRX28102235	SRS24458282	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3	GSM8863193		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control	GSM8863193	GSM8863193: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3; Danio rerio; RNA Seq	GSM8863193 r1	GSM8863193	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P52-GCGCAAGC-CGGCGTGA-READ1-Sequences.txt nR284-L2-G5-P52-GCGCAAGC-CGGCGTGA-READ2-Sequences.txt	fastq fastq	10239163658.0	50688929.0	GSM8863193 r1	0:101 1:101	A:2004831470;C:3154126629;G:3091862970;T:1988292042;N:50547	101	101		2004831470	3154126629	3091862970	1988292042	50547	SRX28102235	SRS24458282	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35466	35466	SRR32818810	SRX28102234	SRS24458281	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2	GSM8863192		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control	GSM8863192	GSM8863192: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2; Danio rerio; RNA Seq	GSM8863192 r1	GSM8863192	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P51-ATATGGAT-TAATACAG-READ1-Sequences.txt nR284-L2-G5-P51-ATATGGAT-TAATACAG-READ2-Sequences.txt	fastq fastq	11426211002.0	56565401.0	GSM8863192 r1	0:101 1:101	A:2181426814;C:3575345894;G:3505040965;T:2164340511;N:56818	101	101		2181426814	3575345894	3505040965	2164340511	56818	SRX28102234	SRS24458281	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35467	35467	SRR32818811	SRX28102233	SRS24458280	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1	GSM8863191		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos uninjected control	GSM8863191	GSM8863191: sorted mCherry+ tenocytes from uninjected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1; Danio rerio; RNA Seq	GSM8863191 r1	GSM8863191	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P50-CGGACAAC-AATCCGGA-READ1-Sequences.txt nR284-L2-G5-P50-CGGACAAC-AATCCGGA-READ2-Sequences.txt	fastq fastq	8241627270.0	40800135.0	GSM8863191 r1	0:101 1:101	A:1585704825;C:2569399779;G:2515169694;T:1571311579;N:41393	101	101		1585704825	2569399779	2515169694	1571311579	41393	SRX28102233	SRS24458280	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35468	35468	SRR32818812	SRX28102232	SRS24458279	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 6	GSM8863190		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos aBTX injected at single cell stage\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 6	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos aBTX injected at single cell stage	GSM8863190	GSM8863190: sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 6; Danio rerio; RNA Seq	GSM8863190 r1	GSM8863190	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P49-TAAGTGGT-GGCTTAAG-READ1-Sequences.txt nR284-L2-G5-P49-TAAGTGGT-GGCTTAAG-READ2-Sequences.txt	fastq fastq	11020907900.0	54558950.0	GSM8863190 r1	0:101 1:101	A:2122315499;C:3428329681;G:3363708951;T:2106499941;N:53828	101	101		2122315499	3428329681	3363708951	2106499941	53828	SRX28102232	SRS24458279	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35469	35469	SRR32818813	SRX28102231	SRS24458278	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 5	GSM8863189		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos aBTX injected at single cell stage\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 5	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos aBTX injected at single cell stage	GSM8863189	GSM8863189: sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 5; Danio rerio; RNA Seq	GSM8863189 r1	GSM8863189	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P48-TACCGAGG-AGTTCAGG-READ1-Sequences.txt nR284-L2-G5-P48-TACCGAGG-AGTTCAGG-READ2-Sequences.txt	fastq fastq	9778516798.0	48408499.0	GSM8863189 r1	0:101 1:101	A:1871707305;C:3053861632;G:3000334130;T:1852564463;N:49268	101	101		1871707305	3053861632	3000334130	1852564463	49268	SRX28102231	SRS24458278	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35470	35470	SRR32818814	SRX28102230	SRS24458277	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4	GSM8863188		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos aBTX injected at single cell stage\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos aBTX injected at single cell stage	GSM8863188	GSM8863188: sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4; Danio rerio; RNA Seq	GSM8863188 r1	GSM8863188	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P47-AATGCCTC-TGGATCGA-READ1-Sequences.txt nR284-L2-G5-P47-AATGCCTC-TGGATCGA-READ2-Sequences.txt	fastq fastq	9225871462.0	45672631.0	GSM8863188 r1	0:101 1:101	A:1812334628;C:2836256230;G:2784608990;T:1792625480;N:46134	101	101		1812334628	2836256230	2784608990	1792625480	46134	SRX28102230	SRS24458277	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35471	35471	SRR32818815	SRX28102229	SRS24458276	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3	GSM8863187		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos aBTX injected at single cell stage\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos aBTX injected at single cell stage	GSM8863187	GSM8863187: sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3; Danio rerio; RNA Seq	GSM8863187 r1	GSM8863187	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P46-GGCATTCT-CAAGCTAG-READ1-Sequences.txt nR284-L2-G5-P46-GGCATTCT-CAAGCTAG-READ2-Sequences.txt	fastq fastq	8722157192.0	43178996.0	GSM8863187 r1	0:101 1:101	A:1656516190;C:2739809093;G:2694619623;T:1631169000;N:43286	101	101		1656516190	2739809093	2694619623	1631169000	43286	SRX28102229	SRS24458276	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35472	35472	SRR32818816	SRX28102228	SRS24458275	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2	GSM8863186		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos aBTX injected at single cell stage\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos aBTX injected at single cell stage	GSM8863186	GSM8863186: sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2; Danio rerio; RNA Seq	GSM8863186 r1	GSM8863186	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P45-TTACAGGA-GCTTGTCA-READ1-Sequences.txt nR284-L2-G5-P45-TTACAGGA-GCTTGTCA-READ2-Sequences.txt	fastq fastq	9539410206.0	47224803.0	GSM8863186 r1	0:101 1:101	A:1827192429;C:2980924877;G:2922457892;T:1808788630;N:46378	101	101		1827192429	2980924877	2922457892	1808788630	46378	SRX28102228	SRS24458275	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35473	35473	SRR32818817	SRX28102227	SRS24458274	SRP572436	PRJNA1240804	Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 48 hpf zebrafish embryos WT vs. aBTX injected paralyzed bulk RNAseq dataset	GSE292683	Transcriptome Analysis	Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from uninjected control 48 hpf and aBTX alpha bungarotoxin injected paralyzed 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes.		pubmed:40145570		sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1	GSM8863185		source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos aBTX injected at single cell stage\|geo loc name:missing\|collection date:missing	sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1	Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: DESeq2 normalized counts	FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O’Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos\|cell type:mCherry+ tenocytes\|genotype:WT Tgscxa:mCherry background\|treatment:48 hpf embryos aBTX injected at single cell stage	GSM8863185	GSM8863185: sorted mCherry+ tenocytes from aBTX injected 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1; Danio rerio; RNA Seq	GSM8863185 r1	GSM8863185	1	For 48 hpf bulk RNA seq alone transgenic Tgscxa:mCherry embryos BTX injected or un injected siblings were dissociated using Subtilisin A cold active protease in a stock solution consisting of: 5 ul of 1M CaCl2 100 ul of protease stock solution 100mg of Bacillus licheniformis protease Sigma P5380 solubilized in 1 ml of Ca and Mg free PBS 889ul of PBS 1 ul of 0.5M EDTA Sigma E5134 and 5ul of DNAse I Roche 10104159001 stock 25U/ul in PBS stored at 80C adapted from O'Flanagan et al. 2019. Embryos were triturated once every 2 min for 15 seconds using a wide bore 1 ml pipette. Every 15 min tissue solution as checked under dissecting scope to verify dissociation. Full dissociation took 30 min per samples and samples were subsequently run through a 40 mm filter to separate dissociated cells from clumps of aggregate undissociated tissue/ECM and washed with 10 ml of PBS/BSA 0.01% BSA in PBS made fresh on the day of dissociation and transferred to a 15 ml conical tube. Cells were centrifuged at 600g for 5 min at 4°C supernatant is discarded and cells are resuspended in 1 ml of ice cold PBS/BSA before being placed on ice. High expressing mCherry+ cells were gated and sorted on a Bio Rad FACS Aria II cell sorter. Clontech SMARTer Stranded Total RNA Seq v3 Kit		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 550		SRP572436			nR284-L2-G5-P44-CCGTGAAG-ATCCACTG-READ1-Sequences.txt nR284-L2-G5-P44-CCGTGAAG-ATCCACTG-READ2-Sequences.txt	fastq fastq	8772356010.0	43427505.0	GSM8863185 r1	0:101 1:101	A:1656754122;C:2760877460;G:2711917989;T:1642763644;N:42795	101	101		1656754122	2760877460	2711917989	1642763644	42795	SRX28102227	SRS24458274	SRA2098459	UC Irvine	UC Irvine												B	B	biological fallback assumption	illumina	nextseq	full_length	cdna_unspecified	smarter	bulk	bulk	bulk	United States	2025-03-23	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35911	35911	SRR33227833	SRX28474909	SRS24794875	SRP580008	PRJNA1253320	Prpf4 Sequentially Regulates the Expansion and Maturation of Erythrocyte through Distinct Mechanisms	PRJNA1253320	Other	The proliferation of early erythrocyte and the subsequent erythrocyte maturation are critical events during erythropoiesis how these two independent but interconnected processes are efficiently orchestrated during erythropoiesis was largely unknown. Prpf4 expression is enriched from Pre Colony Forming Unit Erythroid PreCFU E to Nucleated Erythrocytes especially in the CFU E cells implying Prpf4 plays a critical role in erythropoiesis. Here we demonstrate that prpf4 sequentially regulates erythrocyte proliferation and maturation during zebrafish definitive hematopoiesis. The data show that prpf4 mutation results in severe defects in erythropoiesis characterized by a substantial reduction in erythroid cell numbers and impaired erythrocyte maturation. Further analysis indicates that prpf4 mutation leads to cell cycle arrest of erythrocytes at the S and G2/M phases as well as a significant increase in erythrocyte apoptosis. Mechanistically prpf4 mutation leads to DNA damage and the subsequent activation of DNA damage response triggering the ATM/CHK2 p53 signaling pathway. This process inhibits the proliferation of early erythrocyte and induces erythrocyte apoptosis. On the other hand the data reveal that prpf4 mutation causes significant defect in skipped exon during pre mRNA splicing accompanying severe splicing defect in slc25a39 pre mRNA. This results in a significant downregulation of slc25a39 mRNA ultimately impairing erythrocyte maturation in late erythropoiesis. In conclusion we identify that prpf4 sequentially regulates early erythrocyte proliferation and the sequential erythrocyte maturation the dual function of prpf4 partially explaining how early erythrocyte proliferation and late erythrocyte maturation are efficiently coordinated during erythropoiesis.				RNA seq of WT zebrafish at 48 hpf	Prpf4 WT rep3		strain:AB\|isolate:embryo pool 6\|breed:wild type\|ecotype:laboratory strain\|age:48 hpf\|dev stage:embryo\|collection date:2023 11\|geo loc name:China: Sichuan Chengdu\|sex:not applicable\|tissue:erythrocytes\|BioSampleModel:Model organism or animal								RNA seq of wild type zebrafish at 48 hpf	lib Prpf4 WT rep3	lib Prpf4 WT rep3	Same as above			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq X Plus		SRP580008			Prpf4_WT_rep3_R1_001.fastq.gz Prpf4_WT_rep3_R2_001.fastq.gz	fastq fastq	4980597900.0	16601993.0	Prpf4 WT rep3 R1 001.fastq.gz	0:150 1:150	A:1226282648;C:1235583412;G:1239317687;T:1279049146;N:365007	150	150		1226282648	1235583412	1239317687	1279049146	365007	SRX28474909	SRS24794875	SRA2115340	Chengdu medical college\|School of Basic Medical Sciences	Chengdu medical college												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	China	2025-04-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35912	35912	SRR33227834	SRX28474908	SRS24794874	SRP580008	PRJNA1253320	Prpf4 Sequentially Regulates the Expansion and Maturation of Erythrocyte through Distinct Mechanisms	PRJNA1253320	Other	The proliferation of early erythrocyte and the subsequent erythrocyte maturation are critical events during erythropoiesis how these two independent but interconnected processes are efficiently orchestrated during erythropoiesis was largely unknown. Prpf4 expression is enriched from Pre Colony Forming Unit Erythroid PreCFU E to Nucleated Erythrocytes especially in the CFU E cells implying Prpf4 plays a critical role in erythropoiesis. Here we demonstrate that prpf4 sequentially regulates erythrocyte proliferation and maturation during zebrafish definitive hematopoiesis. The data show that prpf4 mutation results in severe defects in erythropoiesis characterized by a substantial reduction in erythroid cell numbers and impaired erythrocyte maturation. Further analysis indicates that prpf4 mutation leads to cell cycle arrest of erythrocytes at the S and G2/M phases as well as a significant increase in erythrocyte apoptosis. Mechanistically prpf4 mutation leads to DNA damage and the subsequent activation of DNA damage response triggering the ATM/CHK2 p53 signaling pathway. This process inhibits the proliferation of early erythrocyte and induces erythrocyte apoptosis. On the other hand the data reveal that prpf4 mutation causes significant defect in skipped exon during pre mRNA splicing accompanying severe splicing defect in slc25a39 pre mRNA. This results in a significant downregulation of slc25a39 mRNA ultimately impairing erythrocyte maturation in late erythropoiesis. In conclusion we identify that prpf4 sequentially regulates early erythrocyte proliferation and the sequential erythrocyte maturation the dual function of prpf4 partially explaining how early erythrocyte proliferation and late erythrocyte maturation are efficiently coordinated during erythropoiesis.				RNA seq of WT zebrafish at 48 hpf	Prpf4 WT rep2		strain:AB\|isolate:embryo pool 5\|breed:wild type\|ecotype:laboratory strain\|age:48 hpf\|dev stage:embryo\|collection date:2023 11\|geo loc name:China: Sichuan Chengdu\|sex:not applicable\|tissue:erythrocytes\|BioSampleModel:Model organism or animal								RNA seq of wild type zebrafish at 48 hpf	lib Prpf4 WT rep2	lib Prpf4 WT rep2	Same as above			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq X Plus		SRP580008			Prpf4_WT_rep2_R1_001.fastq.gz Prpf4_WT_rep2_R2_001.fastq.gz	fastq fastq	6071219400.0	20237398.0	Prpf4 WT rep2 R1 001.fastq.gz	0:150 1:150	A:1485039562;C:1529219051;G:1507447307;T:1549077264;N:436216	150	150		1485039562	1529219051	1507447307	1549077264	436216	SRX28474908	SRS24794874	SRA2115340	Chengdu medical college\|School of Basic Medical Sciences	Chengdu medical college												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	China	2025-04-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35913	35913	SRR33227835	SRX28474907	SRS24794873	SRP580008	PRJNA1253320	Prpf4 Sequentially Regulates the Expansion and Maturation of Erythrocyte through Distinct Mechanisms	PRJNA1253320	Other	The proliferation of early erythrocyte and the subsequent erythrocyte maturation are critical events during erythropoiesis how these two independent but interconnected processes are efficiently orchestrated during erythropoiesis was largely unknown. Prpf4 expression is enriched from Pre Colony Forming Unit Erythroid PreCFU E to Nucleated Erythrocytes especially in the CFU E cells implying Prpf4 plays a critical role in erythropoiesis. Here we demonstrate that prpf4 sequentially regulates erythrocyte proliferation and maturation during zebrafish definitive hematopoiesis. The data show that prpf4 mutation results in severe defects in erythropoiesis characterized by a substantial reduction in erythroid cell numbers and impaired erythrocyte maturation. Further analysis indicates that prpf4 mutation leads to cell cycle arrest of erythrocytes at the S and G2/M phases as well as a significant increase in erythrocyte apoptosis. Mechanistically prpf4 mutation leads to DNA damage and the subsequent activation of DNA damage response triggering the ATM/CHK2 p53 signaling pathway. This process inhibits the proliferation of early erythrocyte and induces erythrocyte apoptosis. On the other hand the data reveal that prpf4 mutation causes significant defect in skipped exon during pre mRNA splicing accompanying severe splicing defect in slc25a39 pre mRNA. This results in a significant downregulation of slc25a39 mRNA ultimately impairing erythrocyte maturation in late erythropoiesis. In conclusion we identify that prpf4 sequentially regulates early erythrocyte proliferation and the sequential erythrocyte maturation the dual function of prpf4 partially explaining how early erythrocyte proliferation and late erythrocyte maturation are efficiently coordinated during erythropoiesis.				RNA seq of WT zebrafish at 48 hpf	Prpf4 WT rep1		strain:AB\|isolate:embryo pool 4\|breed:wild type\|ecotype:laboratory strain\|age:48 hpf\|dev stage:embryo\|collection date:2023 11\|geo loc name:China: Sichuan Chengdu\|sex:not applicable\|tissue:erythrocytes\|BioSampleModel:Model organism or animal								RNA seq of wild type zebrafish at 48 hpf	lib Prpf4 WT rep1	lib Prpf4 WT rep1	Sorted erythrocytes from Tggata1:DsRed zebrafish embryo at 48 hpf wild type			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq X Plus		SRP580008			Prpf4_WT_rep1_R1_001.fastq.gz Prpf4_WT_rep1_R2_001.fastq.gz	fastq fastq	5321886300.0	17739621.0	Prpf4 WT rep1 R1 001.fastq.gz	0:150 1:150	A:1289113266;C:1320009641;G:1352169266;T:1360194839;N:399288	150	150		1289113266	1320009641	1352169266	1360194839	399288	SRX28474907	SRS24794873	SRA2115340	Chengdu medical college\|School of Basic Medical Sciences	Chengdu medical college												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	China	2025-04-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35914	35914	SRR33227836	SRX28474906	SRS24794872	SRP580008	PRJNA1253320	Prpf4 Sequentially Regulates the Expansion and Maturation of Erythrocyte through Distinct Mechanisms	PRJNA1253320	Other	The proliferation of early erythrocyte and the subsequent erythrocyte maturation are critical events during erythropoiesis how these two independent but interconnected processes are efficiently orchestrated during erythropoiesis was largely unknown. Prpf4 expression is enriched from Pre Colony Forming Unit Erythroid PreCFU E to Nucleated Erythrocytes especially in the CFU E cells implying Prpf4 plays a critical role in erythropoiesis. Here we demonstrate that prpf4 sequentially regulates erythrocyte proliferation and maturation during zebrafish definitive hematopoiesis. The data show that prpf4 mutation results in severe defects in erythropoiesis characterized by a substantial reduction in erythroid cell numbers and impaired erythrocyte maturation. Further analysis indicates that prpf4 mutation leads to cell cycle arrest of erythrocytes at the S and G2/M phases as well as a significant increase in erythrocyte apoptosis. Mechanistically prpf4 mutation leads to DNA damage and the subsequent activation of DNA damage response triggering the ATM/CHK2 p53 signaling pathway. This process inhibits the proliferation of early erythrocyte and induces erythrocyte apoptosis. On the other hand the data reveal that prpf4 mutation causes significant defect in skipped exon during pre mRNA splicing accompanying severe splicing defect in slc25a39 pre mRNA. This results in a significant downregulation of slc25a39 mRNA ultimately impairing erythrocyte maturation in late erythropoiesis. In conclusion we identify that prpf4 sequentially regulates early erythrocyte proliferation and the sequential erythrocyte maturation the dual function of prpf4 partially explaining how early erythrocyte proliferation and late erythrocyte maturation are efficiently coordinated during erythropoiesis.				RNA seq of prpf4 mutant zebrafish at 48 hpf	Prpf4 mut rep3		strain:AB\|isolate:embryo pool 3\|breed:prpf4 mutant\|ecotype:laboratory strain\|age:48 hpf\|dev stage:embryo\|collection date:2023 11\|geo loc name:China: Sichuan Chengdu\|sex:not applicable\|tissue:erythrocytes\|BioSampleModel:Model organism or animal								RNA seq of prpf4 mutant zebrafish at 48 hpf	lib Prpf4 mut rep3	lib Prpf4 mut rep3	Same as above			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq X Plus		SRP580008			Prpf4_mut_rep3_R1_001.fastq.gz Prpf4_mut_rep3_R2_001.fastq.gz	fastq fastq	7895645400.0	26318818.0	Prpf4 mut rep3 R1 001.fastq.gz	0:150 1:150	A:2018379504;C:1890119858;G:1874818429;T:2111750717;N:576892	150	150		2018379504	1890119858	1874818429	2111750717	576892	SRX28474906	SRS24794872	SRA2115340	Chengdu medical college\|School of Basic Medical Sciences	Chengdu medical college												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	China	2025-04-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35915	35915	SRR33227837	SRX28474905	SRS24794871	SRP580008	PRJNA1253320	Prpf4 Sequentially Regulates the Expansion and Maturation of Erythrocyte through Distinct Mechanisms	PRJNA1253320	Other	The proliferation of early erythrocyte and the subsequent erythrocyte maturation are critical events during erythropoiesis how these two independent but interconnected processes are efficiently orchestrated during erythropoiesis was largely unknown. Prpf4 expression is enriched from Pre Colony Forming Unit Erythroid PreCFU E to Nucleated Erythrocytes especially in the CFU E cells implying Prpf4 plays a critical role in erythropoiesis. Here we demonstrate that prpf4 sequentially regulates erythrocyte proliferation and maturation during zebrafish definitive hematopoiesis. The data show that prpf4 mutation results in severe defects in erythropoiesis characterized by a substantial reduction in erythroid cell numbers and impaired erythrocyte maturation. Further analysis indicates that prpf4 mutation leads to cell cycle arrest of erythrocytes at the S and G2/M phases as well as a significant increase in erythrocyte apoptosis. Mechanistically prpf4 mutation leads to DNA damage and the subsequent activation of DNA damage response triggering the ATM/CHK2 p53 signaling pathway. This process inhibits the proliferation of early erythrocyte and induces erythrocyte apoptosis. On the other hand the data reveal that prpf4 mutation causes significant defect in skipped exon during pre mRNA splicing accompanying severe splicing defect in slc25a39 pre mRNA. This results in a significant downregulation of slc25a39 mRNA ultimately impairing erythrocyte maturation in late erythropoiesis. In conclusion we identify that prpf4 sequentially regulates early erythrocyte proliferation and the sequential erythrocyte maturation the dual function of prpf4 partially explaining how early erythrocyte proliferation and late erythrocyte maturation are efficiently coordinated during erythropoiesis.				RNA seq of prpf4 mutant zebrafish at 48 hpf	Prpf4 mut rep2		strain:AB\|isolate:embryo pool 2\|breed:prpf4 mutant\|ecotype:laboratory strain\|age:48 hpf\|dev stage:embryo\|collection date:2023 11\|geo loc name:China: Sichuan Chengdu\|sex:not applicable\|tissue:erythrocytes\|BioSampleModel:Model organism or animal								RNA seq of prpf4 mutant zebrafish at 48 hpf	lib Prpf4 mut rep2	lib Prpf4 mut rep2	Same as above			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq X Plus		SRP580008			Prpf4_mut_rep2_R1_001.fastq.gz Prpf4_mut_rep2_R2_001.fastq.gz	fastq fastq	8530757700.0	28435859.0	Prpf4 mut rep2 R1 001.fastq.gz	0:150 1:150	A:2173003940;C:2024702047;G:2071325671;T:2261092825;N:633217	150	150		2173003940	2024702047	2071325671	2261092825	633217	SRX28474905	SRS24794871	SRA2115340	Chengdu medical college\|School of Basic Medical Sciences	Chengdu medical college												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	China	2025-04-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
35916	35916	SRR33227838	SRX28474904	SRS24794870	SRP580008	PRJNA1253320	Prpf4 Sequentially Regulates the Expansion and Maturation of Erythrocyte through Distinct Mechanisms	PRJNA1253320	Other	The proliferation of early erythrocyte and the subsequent erythrocyte maturation are critical events during erythropoiesis how these two independent but interconnected processes are efficiently orchestrated during erythropoiesis was largely unknown. Prpf4 expression is enriched from Pre Colony Forming Unit Erythroid PreCFU E to Nucleated Erythrocytes especially in the CFU E cells implying Prpf4 plays a critical role in erythropoiesis. Here we demonstrate that prpf4 sequentially regulates erythrocyte proliferation and maturation during zebrafish definitive hematopoiesis. The data show that prpf4 mutation results in severe defects in erythropoiesis characterized by a substantial reduction in erythroid cell numbers and impaired erythrocyte maturation. Further analysis indicates that prpf4 mutation leads to cell cycle arrest of erythrocytes at the S and G2/M phases as well as a significant increase in erythrocyte apoptosis. Mechanistically prpf4 mutation leads to DNA damage and the subsequent activation of DNA damage response triggering the ATM/CHK2 p53 signaling pathway. This process inhibits the proliferation of early erythrocyte and induces erythrocyte apoptosis. On the other hand the data reveal that prpf4 mutation causes significant defect in skipped exon during pre mRNA splicing accompanying severe splicing defect in slc25a39 pre mRNA. This results in a significant downregulation of slc25a39 mRNA ultimately impairing erythrocyte maturation in late erythropoiesis. In conclusion we identify that prpf4 sequentially regulates early erythrocyte proliferation and the sequential erythrocyte maturation the dual function of prpf4 partially explaining how early erythrocyte proliferation and late erythrocyte maturation are efficiently coordinated during erythropoiesis.				RNA seq of prpf4 mutant zebrafish at 48 hpf	Prpf4 mut rep1		strain:AB\|isolate:embryo pool 1\|breed:prpf4 mutant\|ecotype:laboratory strain\|age:48 hpf\|dev stage:embryo\|collection date:2023 11\|geo loc name:China: Sichuan Chengdu\|sex:not applicable\|tissue:erythrocytes\|BioSampleModel:Model organism or animal								RNA seq of prpf4 mutant zebrafish at 48 hpf	lib Prpf4 mut rep1	lib Prpf4 mut rep1	Sorted erythrocytes from Tggata1:DsRed zebrafish embryo at 48 hpf prpf4 mutant			RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina NovaSeq X Plus		SRP580008			Prpf4_mut_rep1_R1_001.fastq.gz Prpf4_mut_rep1_R2_001.fastq.gz	fastq fastq	4274603100.0	14248677.0	Prpf4 mut rep1 R1 001.fastq.gz	0:150 1:150	A:1071061320;C:1016341664;G:1078610744;T:1108274547;N:314825	150	150		1071061320	1016341664	1078610744	1108274547	314825	SRX28474904	SRS24794870	SRA2115340	Chengdu medical college\|School of Basic Medical Sciences	Chengdu medical college												B	B	biological fallback assumption	illumina	novaseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown	China	2025-04-20	Hatching	Embryo	Embryo Imprecise	All anatomical structures
36195	36195	SRR042434	SRX020028	SRS066219	SRP002411	PRJNA126003	A novel miRNA processing pathway independent of Dicer requires Argonaute2 catalytic activity	GSE21503	Transcriptome Analysis	Here we identify a Dicer independent miRNA biogenesis pathway that employs the slicer catalytic activity of Argonaute2 Ago2. To uncover Dicer independent miRNAs we sequenced small RNAs in wild type maternal zygotic dicer MZdicer and MZago2 mutants using zebrafish as a model system. We find that in contrast to other miRNAs miR 451 levels were increased in MZdicer but drastically reduced in the MZago2 mutants. We show that pre miR 451 processing requires Ago2 catalytic activity in vivo. MZago2 mutant embryos display delayed erythrocyte maturation that can be rescued by wild type Ago2 or miR 451 duplex but not catalytically dead Ago2. We propose that Ago2 mediated cleavage of a subset of pre miRNAs followed by uridylation and trimming generates functional miRNAs in a Dicer independent manner. Overall design: Examination of small RNAs 18 to 35 nucleotides in 3 different zebrafish genotypes wild type MZago2 MZdicer at 48 hpf		pubmed:20448148		MZago2 mutant YΔ90	GSM540646		tissue:48hpf embryo MZago2 mutant\|strain:mixed AB TU TL TLF background\|developmental stage:48hpf embryo\|genotype:MZago2 Δ90/Δ90	MZago2 mutant YΔ90	Alignment: Sequence reads were mapped to Zebrafish Zv8/danRer6 precursor miRNA sequences using Bowtie software version 0.12.1 with maximal two mismatches within first 20 nucleotides. Alignments are available in the supplementary *out.txt file.	48hpf embryo MZago2 mutant	Total RNA from frozen embryos was extracted with Trizol reagent and phenol/chloroform. Libraries were prepared according to Illumina's instructions Part # 1004239 Rev. A accompanying the small RNA Sample Kit. Briefly total RNA samples were run in a denaturing PAGE and the band corresponding to the RNAs of 18 35 nucletides was excised. RNA 5’ and 3’ adapters were ligated sequentially. Reverse transcription followed by PCR amplified cDNA constructs with both adapters. The purified DNA was captured on an Illumina flow cell for cluster generation. Libraries were sequenced on the Genome Analyzer following the manufacturer's protocols.	Embryos were collected from breeding tanks and kept at 28C in p60 plates with water and 0.2 mg/L methylene blue. At 48 hpf embryos were hand dechorionated and 40 embryos per sample were flash frozen in liquid nitrogen.	strain:mixed AB TU TL TLF background\|developmental stage:48hpf embryo\|genotype:MZago2 Δ90/Δ90	GSM540646	GSM540646: MZago2 mutant YΔ90	GSM540646: MZago2 mutant YΔ90	GSM540646: MZago2 mutant YΔ90	1		GEO Accession:GSM540646	RNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina Genome Analyzer	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP002411			Ago2_ydelta90.fastq	fastq	437752008.0	12159778.0	GSM540646 1	0:36	A:96750665;C:83495585;G:119239752;T:138073795;N:192211	36			96750665	83495585	119239752	138073795	192211	SRX020028	SRS066219	SRA012683	GEO	Giraldez Lab, Genetics, Yale University	1	0.03964		0.0		0.99985		0.00052		36		B		usable mapping rate	illumina	early_illumina	unknown	size_fractionation	unknown	bulk	unknown	unknown	United States	2010-05-04	Hatching	Embryo	Embryo Imprecise	All anatomical structures
36196	36196	SRR042433	SRX020027	SRS066218	SRP002411	PRJNA126003	A novel miRNA processing pathway independent of Dicer requires Argonaute2 catalytic activity	GSE21503	Transcriptome Analysis	Here we identify a Dicer independent miRNA biogenesis pathway that employs the slicer catalytic activity of Argonaute2 Ago2. To uncover Dicer independent miRNAs we sequenced small RNAs in wild type maternal zygotic dicer MZdicer and MZago2 mutants using zebrafish as a model system. We find that in contrast to other miRNAs miR 451 levels were increased in MZdicer but drastically reduced in the MZago2 mutants. We show that pre miR 451 processing requires Ago2 catalytic activity in vivo. MZago2 mutant embryos display delayed erythrocyte maturation that can be rescued by wild type Ago2 or miR 451 duplex but not catalytically dead Ago2. We propose that Ago2 mediated cleavage of a subset of pre miRNAs followed by uridylation and trimming generates functional miRNAs in a Dicer independent manner. Overall design: Examination of small RNAs 18 to 35 nucleotides in 3 different zebrafish genotypes wild type MZago2 MZdicer at 48 hpf		pubmed:20448148		WT2	GSM540645		tissue:48hpf embryo WT\|strain:mixed AB TU TL TLF background\|developmental stage:48hpf embryo\|genotype:wild type	WT2	Alignment: Sequence reads were mapped to Zebrafish Zv8/danRer6 precursor miRNA sequences using Bowtie software version 0.12.1 with maximal two mismatches within first 20 nucleotides. Alignments are available in the supplementary *out.txt file.	48hpf embryo WT	Total RNA from frozen embryos was extracted with Trizol reagent and phenol/chloroform. Libraries were prepared according to Illumina's instructions Part # 1004239 Rev. A accompanying the small RNA Sample Kit. Briefly total RNA samples were run in a denaturing PAGE and the band corresponding to the RNAs of 18 35 nucletides was excised. RNA 5’ and 3’ adapters were ligated sequentially. Reverse transcription followed by PCR amplified cDNA constructs with both adapters. The purified DNA was captured on an Illumina flow cell for cluster generation. Libraries were sequenced on the Genome Analyzer following the manufacturer's protocols.	Embryos were collected from breeding tanks and kept at 28C in p60 plates with water and 0.2 mg/L methylene blue. At 48 hpf embryos were hand dechorionated and 40 embryos per sample were flash frozen in liquid nitrogen.	strain:mixed AB TU TL TLF background\|developmental stage:48hpf embryo\|genotype:wild type	GSM540645	GSM540645: WT2	GSM540645: WT2	GSM540645: WT2	1		GEO Accession:GSM540645	RNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina Genome Analyzer	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP002411			WT2.fastq	fastq	59530030.0	1700858.0	GSM540645 1	0:35	A:12981942;C:11521313;G:16378279;T:18609524;N:38972	35			12981942	11521313	16378279	18609524	38972	SRX020027	SRS066218	SRA012683	GEO	Giraldez Lab, Genetics, Yale University	1	0.06435		0.0		0.99995		0.0		35		B		usable mapping rate	illumina	early_illumina	unknown	size_fractionation	unknown	bulk	unknown	unknown	United States	2010-05-04	Hatching	Embryo	Embryo Imprecise	All anatomical structures
36197	36197	SRR042432	SRX020026	SRS066217	SRP002411	PRJNA126003	A novel miRNA processing pathway independent of Dicer requires Argonaute2 catalytic activity	GSE21503	Transcriptome Analysis	Here we identify a Dicer independent miRNA biogenesis pathway that employs the slicer catalytic activity of Argonaute2 Ago2. To uncover Dicer independent miRNAs we sequenced small RNAs in wild type maternal zygotic dicer MZdicer and MZago2 mutants using zebrafish as a model system. We find that in contrast to other miRNAs miR 451 levels were increased in MZdicer but drastically reduced in the MZago2 mutants. We show that pre miR 451 processing requires Ago2 catalytic activity in vivo. MZago2 mutant embryos display delayed erythrocyte maturation that can be rescued by wild type Ago2 or miR 451 duplex but not catalytically dead Ago2. We propose that Ago2 mediated cleavage of a subset of pre miRNAs followed by uridylation and trimming generates functional miRNAs in a Dicer independent manner. Overall design: Examination of small RNAs 18 to 35 nucleotides in 3 different zebrafish genotypes wild type MZago2 MZdicer at 48 hpf		pubmed:20448148		MZdicer mutant2 hu896	GSM540644		tissue:48hpf embryo Mzdicer mutant\|strain:mixed AB TU TL TLF background\|developmental stage:48hpf embryo\|genotype:MZdicer hu896/hu896	MZdicer mutant2 hu896	Alignment: Sequence reads were mapped to Zebrafish Zv8/danRer6 precursor miRNA sequences using Bowtie software version 0.12.1 with maximal two mismatches within first 20 nucleotides. Alignments are available in the supplementary *out.txt file.	48hpf embryo Mzdicer mutant	Total RNA from frozen embryos was extracted with Trizol reagent and phenol/chloroform. Libraries were prepared according to Illumina's instructions Part # 1004239 Rev. A accompanying the small RNA Sample Kit. Briefly total RNA samples were run in a denaturing PAGE and the band corresponding to the RNAs of 18 35 nucletides was excised. RNA 5’ and 3’ adapters were ligated sequentially. Reverse transcription followed by PCR amplified cDNA constructs with both adapters. The purified DNA was captured on an Illumina flow cell for cluster generation. Libraries were sequenced on the Genome Analyzer following the manufacturer's protocols.	Embryos were collected from breeding tanks and kept at 28C in p60 plates with water and 0.2 mg/L methylene blue. At 48 hpf embryos were hand dechorionated and 40 embryos per sample were flash frozen in liquid nitrogen.	strain:mixed AB TU TL TLF background\|developmental stage:48hpf embryo\|genotype:MZdicer hu896/hu896	GSM540644	GSM540644: MZdicer mutant2 hu896	GSM540644: MZdicer mutant2 hu896	GSM540644: MZdicer mutant2 hu896	1		GEO Accession:GSM540644	RNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	Illumina Genome Analyzer	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP002411			MZdicer2_hu896.fastq	fastq	4268740.0	121964.0	GSM540644 1	0:35	A:813936;C:1034356;G:1131604;T:1280756;N:8088	35			813936	1034356	1131604	1280756	8088	SRX020026	SRS066217	SRA012683	GEO	Giraldez Lab, Genetics, Yale University	1	0.03836		0.0009		0.99849		0.3021		35		B		usable mapping rate	illumina	early_illumina	unknown	size_fractionation	unknown	bulk	unknown	unknown	United States	2010-05-04	Hatching	Embryo	Embryo Imprecise	All anatomical structures

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;