run_metadata
1,177 rows where devstage_curation = "Gastrula" and tissue_curation = "Embryo Imprecise"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 8088 | 8088 | ERR034127 | ERX012653 | ERS032268 | ERP000635 | PRJEB2512 | The Zebrafish transcriptome during early development | KI-BN-JKE-DRERIO-RNASEQ-2011 | Transcriptome Analysis | Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions. | RNA extracted from zebrafish embryo at 50% epiboly stage | zebrafish embryo 50 epiboly | SAMEA791629 | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791629|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 50epiboly|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 50epiboly|sex:mixed|strain:Tuebingen | Transcriptome profiling of early zebrafish development | KI BN JKE DRERIO RNASEQ 2011 50epiboly | JKE Drerio rna seq | Transcriptome profiling of 50% epiboly stages of zebrafish embryos. | Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems. | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ABI_SOLID | AB SOLiD System 3.0 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | ERP000635 | AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development | ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16 | KI-BN-JKE-DRERIO-RNASEQ-2011-50epiboly.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-50epiboly_QV.qual.gz | SOLiD_native SOLiD_native | 3929903550.0 | 78598071.0 | KI BN JKE DRERIO RNASEQ 2011 50epiboly | 0:50 | 50 | ERX012653 | ERS032268 | ERA029959 | KI-BN|Department of Biosciences and Nutrition | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | 1 | 0.60757 | 0.09893 | 0.94899 | 0.77821 | 50 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | unknown | unknown | Sweden | 2011-06-09 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 10060 | 10060 | ERR4795364 | ERX4665135 | ERS5281176 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 4 | E MTAB 9727:Sample 4 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 4 s | Sample 4 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 4 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN4_AH2TW3BGX5_S1_R1_cat.fastq.gz | fastq | 5410723202.0 | 71707309.0 | E MTAB 9727:Sample 4 | 0:75.46 1:0 | A:1330416803;C:531269504;G:734031980;T:2814959249;N:45666 | 75 | 0 | 1330416803 | 531269504 | 734031980 | 2814959249 | 45666 | ERX4665135 | ERS5281176 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.33614 | 0.21532 | 0.99019 | 0.41002 | 76 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10061 | 10061 | ERR4795365 | ERX4665135 | ERS5281176 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 4 | E MTAB 9727:Sample 4 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 4 s | Sample 4 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 4 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN4_AH2TW3BGX5_S1_R2_cat.fastq.gz | fastq | 5414184547.0 | 71707309.0 | E MTAB 9727:Sample 4 1 | 0:0 1:75.50 | A:1582938104;C:1052565419;G:1177180395;T:1600161662;N:1338967 | 0 | 75 | 1582938104 | 1052565419 | 1177180395 | 1600161662 | 1338967 | ERX4665135 | ERS5281176 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.84976 | 0.28521 | 0.85038 | 0.5124 | 75 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10062 | 10062 | ERR4795362 | ERX4665134 | ERS5281175 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 3 | E MTAB 9727:Sample 3 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 3 s | Sample 3 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 3 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN3_AHY3WGBGX3_S7_R1_cat.fastq.gz | fastq | 4823193891.0 | 63965519.0 | E MTAB 9727:Sample 3 | 0:75.40 1:0 | A:1323978162;C:446831209;G:581746343;T:2470114091;N:524086 | 75 | 0 | 1323978162 | 446831209 | 581746343 | 2470114091 | 524086 | ERX4665134 | ERS5281175 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.36549 | 0.19722 | 0.95552 | 0.4702 | 76 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10063 | 10063 | ERR4795363 | ERX4665134 | ERS5281175 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 3 | E MTAB 9727:Sample 3 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 3 s | Sample 3 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 3 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN3_AHY3WGBGX3_S7_R2_cat.fastq.gz | fastq | 4828889391.0 | 63965519.0 | E MTAB 9727:Sample 3 1 | 0:0 1:75.49 | A:1434099697;C:964508763;G:893584575;T:1534727600;N:1968756 | 0 | 75 | 1434099697 | 964508763 | 893584575 | 1534727600 | 1968756 | ERX4665134 | ERS5281175 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.85811 | 0.26231 | 0.82731 | 0.48618 | 76 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10064 | 10064 | ERR4795360 | ERX4665133 | ERS5281174 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 2 | E MTAB 9727:Sample 2 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 2 s | Sample 2 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN2_AHY3WGBGX3_S6_R1_cat.fastq.gz | fastq | 5598371393.0 | 74235388.0 | E MTAB 9727:Sample 2 | 0:75.41 1:0 | A:1526486973;C:558020193;G:717587491;T:2795646081;N:630655 | 75 | 0 | 1526486973 | 558020193 | 717587491 | 2795646081 | 630655 | ERX4665133 | ERS5281174 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.28059 | 0.19252 | 0.96404 | 0.4874 | 75 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10065 | 10065 | ERR4795361 | ERX4665133 | ERS5281174 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 2 | E MTAB 9727:Sample 2 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 2 s | Sample 2 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 2 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN2_AHY3WGBGX3_S6_R2_cat.fastq.gz | fastq | 5600151371.0 | 74235388.0 | E MTAB 9727:Sample 2 1 | 0:0 1:75.44 | A:1850568176;C:1035622971;G:1071138281;T:1640475883;N:2346060 | 0 | 75 | 1850568176 | 1035622971 | 1071138281 | 1640475883 | 2346060 | ERX4665133 | ERS5281174 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.7679 | 0.30371 | 0.82651 | 0.43401 | 75 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10066 | 10066 | ERR4795358 | ERX4665132 | ERS5281173 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 1 | E MTAB 9727:Sample 1 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 1 s | Sample 1 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN1_AHY3WGBGX3_S5_R1_cat.fastq.gz | fastq | 4996502316.0 | 66258508.0 | E MTAB 9727:Sample 1 | 0:75.41 1:0 | A:1330744174;C:451622042;G:591151500;T:2622422664;N:561936 | 75 | 0 | 1330744174 | 451622042 | 591151500 | 2622422664 | 561936 | ERX4665132 | ERS5281173 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.29754 | 0.17671 | 0.9669 | 0.45463 | 75 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 10067 | 10067 | ERR4795359 | ERX4665132 | ERS5281173 | ERP124847 | PRJEB41113 | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E-MTAB-9727 | Transcriptome Analysis | The mesothelium forms epithelial membranes that line the bodies cavities and surround the internal organs. Mesothelia widely contribute to organ homeostasis and regeneration and their dysregulation can result in congenital anomalies of the viscera ventral wall defects and mesothelioma tumors. Nonetheless the embryonic ontogeny and developmental regulation of mesothelium formation has remained uncharted. Here we combine genetic lineage tracing in toto live imaging and single cell transcriptomics in zebrafish to track mesothelial progenitor origins from the lateral plate mesoderm LPM. Our single cell analysis uncovers a post gastrulation gene expression signature centered on hand2 that delineates distinct progenitor populations within the forming LPM. Combining gene expression analysis and imaging of transgenic reporter zebrafish embryos we chart the origin of mesothelial progenitors to the lateral most hand2 expressing LPM and confirm evolutionary conservation in mouse. Our time lapse imaging of transgenic hand2 reporter embryos captures zebrafish mesothelium formation documenting the coordinated cell movements that form pericardium and visceral and parietal peritoneum. We establish that the primordial germ cells migrate associated with the forming mesothelium as ventral migration boundary. Functionally hand2 mutants fail to close the ventral mesothelium due to perturbed migration of mesothelium progenitors. Analyzing mouse and human mesothelioma tumors hypothesized to emerge from transformed mesothelium we find de novo expression of LPM associated transcription factors and in particular of Hand2 indicating the re initiation of a developmental transcriptional program in mesothelioma. Taken together our work outlines a genetic and developmental signature of mesothelial origins centered around Hand2 contributing to our understanding of mesothelial pathologies and mesothelioma. | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | Protocols: Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse trans… | Sample 1 | E MTAB 9727:Sample 1 | isolate:not applicable|organism:Danio rerio|sex:mixed|age:10|developmental stage:tailbud stage|organism part:lateral plate mesoderm plate|genotype:drl:mCherry|ENA FIRST PUBLIC:2021 04 01|ENA LAST UPDATE:2021 09 01 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | E MTAB 9727:Sample 1 s | Sample 1 s | Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | Wildtype stain and drl:mCherry positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase Roche followed by washing in E3 medium. Around 300 embryos were used to generate the sample. The E3 medium was replaced by 1X PBS and the embryos were stored on ice until further processing. The embryos were dissociated using 2 mg/mL collagenase IV Worthington in DMEM high glucose 4.5g/l and NaHCO3 without xxx glutamine and sodium pyruvate Sigma Aldrich and incubated for 5 min in a water bath at 37oC. The embryonic tissues were triturated into a single cell suspension by pipetting carefully up and down. When the embryos were not yet dissociated sufficiently they were incubated for another 5 min. Cells were filtered through a 35 μm cell strainer Falcon round bottom tubes with cell strainer cap and centrifuged at 6000 rpm for 30 sec. Cell pellets were resuspended in 1X HBSS Gibco containing 2% FBS and subjected to an additional round of centrifugation and resuspension. post washing the cells were resuspended in 1X PBS. drl:mCherry positive cells were sorted using a FACS Aria III cell sorter BD Bioscience. Cells were gated based on size and forward scattering to exclude debris and doublets. The gating for the negative population was determined based on wildtype tailbud staged embryos. See also Figure S2 for gate setting. The SORTseq single cell RNA sequencing protocol was carried out as described previously Muraro et al. 2016. Live mCherry positive single cells were sorted in four 384 well plates BioRad containing 5 μl of CEL Seq2 primer solution in mineral oil 24 bp polyT stretch a 4 bp random molecular barcode UMI a cell specific barcode the 5′Illumina TruSeq small RNA kit adaptor and a T7 promoter provided by Single Cell Discoveries. post sorting the plates were immediately placed on ice and stored at −80°C. In brief ERCC Spike in RNA 0.02 μL of 1:50000 dilution was added to each well before cell lysis with heat shocking. Reverse transcription an… | Experimental Factor: replicate:lateral plate mesoderm plate 1 | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | RANDOM | SINGLE | ILLUMINA | NextSeq 500 | ERP124847 | NextSeq 500 sequencing; Hand2 delineates mesothelium progenitors and is reactivated in mesothelioma | ENA FIRST PUBLIC:2022 01 14|ENA LAST UPDATE:2022 01 14 | SN1_AHY3WGBGX3_S5_R2_cat.fastq.gz | fastq | 4999908389.0 | 66258508.0 | E MTAB 9727:Sample 1 1 | 0:0 1:75.46 | A:1591945117;C:933968124;G:986108614;T:1485824022;N:2062512 | 0 | 75 | 1591945117 | 933968124 | 986108614 | 1485824022 | 2062512 | ERX4665132 | ERS5281173 | ERA3048543 | University of Zurich|European Nucleotide Archive | University of Zurich|European Nucleotide Archive | 1 | 0.81333 | 0.2466 | 0.83027 | 0.51572 | 75 | B | usable mapping rate | illumina | nextseq | unknown | random_priming | trueseq | sc | single_cell_plate | celseq | Switzerland | 2021-04-01 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28538 | 28538 | SRR26395012 | SRX22100922 | SRS19166048 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 50% epiboly Iso seq | strain:AB x India|age:5.3 hpf|dev stage:50% epiboly|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 10|BioSampleModel:Model organism or animal | PacBio Iso seq of zebrafish: 50% epiboly | DR 010 | DR 010 | Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | PACBIO_SMRT | Sequel II | SRP466518 | 50epiboly.ccs.fq.gz | fastq | 6994871304.0 | 1739615.0 | 50epiboly.ccs.fq.gz | 0:4020.93 | A:1886646970;C:1618863911;G:1609321304;T:1880039119;N:0 | 4020 | 1886646970 | 1618863911 | 1609321304 | 1880039119 | 0 | SRX22100922 | SRS19166048 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 1 | 0.2059 | 0.00164 | 0.92101 | 0.06119 | 3367 | T | long read | pacbio | pacbio_modern | full_length | poly_a | unknown | bulk | unknown | unknown | United States | 2023-10-16 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 28542 | 28542 | SRR26395016 | SRX22100917 | SRS19166043 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | Shield RNA seq rep8 | strain:AB x India|age:6 hpf|dev stage:shield|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR sh 8|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: shield replicate8 | DR 051 | DR 051 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | Shield-8_1.fq.gz Shield-8_2.fq.gz | fastq fastq | 15762545120.0 | 56294804.0 | Shield 8 1.fq.gz | 0:140 1:140 | A:4228709269;C:3695256879;G:3726067176;T:4112463793;N:48003 | 140 | 140 | 4228709269 | 3695256879 | 3726067176 | 4112463793 | 48003 | SRX22100917 | SRS19166043 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.94979 | 0.95185 | 0.07126 | 0.07102 | 0.76755 | 0.76773 | 0.50529 | 0.50592 | 140 | 140 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28544 | 28544 | SRR26395018 | SRX22100915 | SRS19166041 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | Shield RNA seq rep7 | strain:AB x India|age:6 hpf|dev stage:shield|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR sh 7|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: shield replicate7 | DR 050 | DR 050 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | Shield-7_1.fq.gz Shield-7_2.fq.gz | fastq fastq | 15398289480.0 | 54993891.0 | Shield 7 1.fq.gz | 0:140 1:140 | A:4074722797;C:3649035072;G:3682015786;T:3992469036;N:46789 | 140 | 140 | 4074722797 | 3649035072 | 3682015786 | 3992469036 | 46789 | SRX22100915 | SRS19166041 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.95219 | 0.95373 | 0.0715 | 0.0711 | 0.76313 | 0.76292 | 0.49998 | 0.49568 | 140 | 140 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28545 | 28545 | SRR26395019 | SRX22100914 | SRS19166040 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | Shield RNA seq rep6 | strain:AB x India|age:6 hpf|dev stage:shield|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR sh 6|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: shield replicate6 | DR 049 | DR 049 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | Shield-6_1.fq.gz Shield-6_2.fq.gz | fastq fastq | 16327179120.0 | 58311354.0 | Shield 6 1.fq.gz | 0:140 1:140 | A:4372183418;C:3818375443;G:3853553895;T:4283014987;N:51377 | 140 | 140 | 4372183418 | 3818375443 | 3853553895 | 4283014987 | 51377 | SRX22100914 | SRS19166040 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.95316 | 0.95424 | 0.05929 | 0.05845 | 0.75745 | 0.75682 | 0.48626 | 0.4848 | 140 | 140 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28546 | 28546 | SRR26395020 | SRX22100913 | SRS19166039 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | Shield RNA seq rep5 | strain:AB x India|age:6 hpf|dev stage:shield|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR sh 5|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: shield replicate5 | DR 048 | DR 048 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | Shield-5_1.fq.gz Shield-5_2.fq.gz | fastq fastq | 15066432920.0 | 53808689.0 | Shield 5 1.fq.gz | 0:140 1:140 | A:4038093009;C:3519974340;G:3554554998;T:3953765648;N:44925 | 140 | 140 | 4038093009 | 3519974340 | 3554554998 | 3953765648 | 44925 | SRX22100913 | SRS19166039 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.95404 | 0.95588 | 0.05759 | 0.05623 | 0.76067 | 0.76025 | 0.48812 | 0.4867 | 140 | 140 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28547 | 28547 | SRR26395021 | SRX22100912 | SRS19166038 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | Shield RNA seq rep4 | strain:AB x India|age:6 hpf|dev stage:shield|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR sh 4|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: shield replicate4 | DR 047 | DR 047 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | Shield-4_1.fq.gz Shield-4_2.fq.gz | fastq fastq | 16536966880.0 | 59060596.0 | Shield 4 1.fq.gz | 0:140 1:140 | A:4424555246;C:3870128974;G:3905988590;T:4336243381;N:50689 | 140 | 140 | 4424555246 | 3870128974 | 3905988590 | 4336243381 | 50689 | SRX22100912 | SRS19166038 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.95449 | 0.95538 | 0.06048 | 0.05828 | 0.75737 | 0.75613 | 0.47956 | 0.4814 | 140 | 140 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28548 | 28548 | SRR26395022 | SRX22100911 | SRS19166037 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | Shield RNA seq rep3 | strain:AB x India|age:6 hpf|dev stage:shield|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR sh 3|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: shield replicate3 | DR 046 | DR 046 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | Shield-3_1.fq.gz Shield-3_2.fq.gz | fastq fastq | 17019618000.0 | 60784350.0 | Shield 3 1.fq.gz | 0:140 1:140 | A:4575832980;C:3964601842;G:4000470774;T:4478659727;N:52677 | 140 | 140 | 4575832980 | 3964601842 | 4000470774 | 4478659727 | 52677 | SRX22100911 | SRS19166037 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.95355 | 0.95446 | 0.0641 | 0.06282 | 0.76122 | 0.7613 | 0.47036 | 0.47493 | 140 | 140 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28549 | 28549 | SRR26395023 | SRX22100910 | SRS19166035 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | Shield RNA seq rep2 | strain:AB x India|age:6 hpf|dev stage:shield|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR sh 2|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: shield replicate2 | DR 045 | DR 045 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | Shield-2_1.fq.gz Shield-2_2.fq.gz | fastq fastq | 16732360960.0 | 59758432.0 | Shield 2 1.fq.gz | 0:140 1:140 | A:4501751099;C:3892688345;G:3929794118;T:4408076627;N:50771 | 140 | 140 | 4501751099 | 3892688345 | 3929794118 | 4408076627 | 50771 | SRX22100910 | SRS19166035 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.95234 | 0.95249 | 0.06482 | 0.06341 | 0.75722 | 0.75615 | 0.47904 | 0.47639 | 140 | 140 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28550 | 28550 | SRR26395024 | SRX22100909 | SRS19166034 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | Shield RNA seq rep1 | strain:AB x India|age:6 hpf|dev stage:shield|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR sh 1|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: shield replicate1 | DR 044 | DR 044 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | Shield-1_1.fq.gz Shield-1_2.fq.gz | fastq fastq | 17928569400.0 | 64030605.0 | Shield 1 1.fq.gz | 0:140 1:140 | A:4941499556;C:4080333377;G:4110452158;T:4796233689;N:50620 | 140 | 140 | 4941499556 | 4080333377 | 4110452158 | 4796233689 | 50620 | SRX22100909 | SRS19166034 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.9473 | 0.95033 | 0.0571 | 0.05495 | 0.76826 | 0.76743 | 0.47692 | 0.48711 | 140 | 140 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28586 | 28586 | SRR26395062 | SRX22100872 | SRS19165998 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | Shield Iso seq | strain:AB x India|age:6 hpf|dev stage:shield|collection date:2021 01|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 11|BioSampleModel:Model organism or animal | PacBio Iso seq of zebrafish: shield | DR 011 | DR 011 | Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | PACBIO_SMRT | Sequel II | SRP466518 | shield.ccs.fq.gz | fastq | 7256029471.0 | 1854553.0 | shield.ccs.fq.gz | 0:3912.55 | A:1984833012;C:1651523494;G:1642156033;T:1977516932;N:0 | 3912 | 1984833012 | 1651523494 | 1642156033 | 1977516932 | 0 | SRX22100872 | SRS19165998 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 1 | 0.2041 | 0.00298 | 0.91837 | 0.08263 | 2962 | T | long read | pacbio | pacbio_modern | full_length | poly_a | unknown | bulk | unknown | unknown | United States | 2023-10-16 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 28619 | 28619 | SRR26502009 | SRX22205869 | SRS19261277 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | U 50 C | GSM7863859 | tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:50% epiboly 50|stage index:3|geo loc name:missing|collection date:missing | U 50 C | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:uninjected U controls|developmental stage:50% epiboly 50|approx time hpf index:3 | GSM7863859 | GSM7863859: U 50 C; Danio rerio; RNA Seq | GSM7863859 r1 | GSM7863859 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | U_50_C_1.fq.gz U_50_C_2.fq.gz | fastq fastq | 7676609400.0 | 25588698.0 | GSM7863859 r1 | 0:150 1:150 | A:2052789881;C:1798984774;G:1797986453;T:2026785847;N:62445 | 150 | 150 | 2052789881 | 1798984774 | 1797986453 | 2026785847 | 62445 | SRX22205869 | SRS19261277 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96336 | 0.9632 | 0.07907 | 0.07851 | 0.74708 | 0.7469 | 0.48773 | 0.48811 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28620 | 28620 | SRR26502010 | SRX22205868 | SRS19261276 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | U 50 B | GSM7863858 | tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:50% epiboly 50|stage index:3|geo loc name:missing|collection date:missing | U 50 B | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:uninjected U controls|developmental stage:50% epiboly 50|approx time hpf index:3 | GSM7863858 | GSM7863858: U 50 B; Danio rerio; RNA Seq | GSM7863858 r1 | GSM7863858 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | U_50_B_1.fq.gz U_50_B_2.fq.gz | fastq fastq | 6872895000.0 | 22909650.0 | GSM7863858 r1 | 0:150 1:150 | A:1837058703;C:1608308029;G:1615730840;T:1811739219;N:58209 | 150 | 150 | 1837058703 | 1608308029 | 1615730840 | 1811739219 | 58209 | SRX22205868 | SRS19261276 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96322 | 0.96217 | 0.07208 | 0.07136 | 0.75085 | 0.75252 | 0.47964 | 0.47774 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28621 | 28621 | SRR26502011 | SRX22205867 | SRS19261275 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | U 50 A | GSM7863857 | tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:50% epiboly 50|stage index:3|geo loc name:missing|collection date:missing | U 50 A | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:uninjected U controls|developmental stage:50% epiboly 50|approx time hpf index:3 | GSM7863857 | GSM7863857: U 50 A; Danio rerio; RNA Seq | GSM7863857 r1 | GSM7863857 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | U_50_A_1.fq.gz U_50_A_2.fq.gz | fastq fastq | 8477727600.0 | 28259092.0 | GSM7863857 r1 | 0:150 1:150 | A:2151180279;C:2096703749;G:2108487202;T:2121206697;N:149673 | 150 | 150 | 2151180279 | 2096703749 | 2108487202 | 2121206697 | 149673 | SRX22205867 | SRS19261275 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.97051 | 0.96926 | 0.05003 | 0.04924 | 0.76073 | 0.76112 | 0.48302 | 0.48116 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28631 | 28631 | SRR26502021 | SRX22205857 | SRS19261265 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | T SH C | GSM7863847 | tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:shield SH|stage index:4|geo loc name:missing|collection date:missing | T SH C | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:shield SH|approx time hpf index:4 | GSM7863847 | GSM7863847: T SH C; Danio rerio; RNA Seq | GSM7863847 r1 | GSM7863847 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | T_SH_C_1.fq.gz T_SH_C_2.fq.gz | fastq fastq | 7953265500.0 | 26510885.0 | GSM7863847 r1 | 0:150 1:150 | A:2133488997;C:1855198565;G:1859838514;T:2104672766;N:66658 | 150 | 150 | 2133488997 | 1855198565 | 1859838514 | 2104672766 | 66658 | SRX22205857 | SRS19261265 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96189 | 0.96168 | 0.08304 | 0.08233 | 0.75649 | 0.75743 | 0.47868 | 0.47166 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28632 | 28632 | SRR26502022 | SRX22205856 | SRS19261263 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | T SH B | GSM7863846 | tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:shield SH|stage index:4|geo loc name:missing|collection date:missing | T SH B | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:shield SH|approx time hpf index:4 | GSM7863846 | GSM7863846: T SH B; Danio rerio; RNA Seq | GSM7863846 r1 | GSM7863846 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | T_SH_B_1.fq.gz T_SH_B_2.fq.gz | fastq fastq | 5882446800.0 | 19608156.0 | GSM7863846 r1 | 0:150 1:150 | A:1588739640;C:1361266542;G:1363198387;T:1569193507;N:48724 | 150 | 150 | 1588739640 | 1361266542 | 1363198387 | 1569193507 | 48724 | SRX22205856 | SRS19261263 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96302 | 0.96195 | 0.07924 | 0.07882 | 0.75879 | 0.75875 | 0.48203 | 0.48276 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28633 | 28633 | SRR26502023 | SRX22205855 | SRS19261264 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | T SH A | GSM7863845 | tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:shield SH|stage index:4|geo loc name:missing|collection date:missing | T SH A | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:shield SH|approx time hpf index:4 | GSM7863845 | GSM7863845: T SH A; Danio rerio; RNA Seq | GSM7863845 r1 | GSM7863845 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | T_SH_A_1.fq.gz T_SH_A_2.fq.gz | fastq fastq | 6448725600.0 | 21495752.0 | GSM7863845 r1 | 0:150 1:150 | A:1728514776;C:1508622371;G:1508093886;T:1703449935;N:44632 | 150 | 150 | 1728514776 | 1508622371 | 1508093886 | 1703449935 | 44632 | SRX22205855 | SRS19261264 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96181 | 0.96195 | 0.07627 | 0.07594 | 0.75763 | 0.75901 | 0.48098 | 0.48016 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28634 | 28634 | SRR26502024 | SRX22205854 | SRS19261262 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | T 90 C | GSM7863844 | tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:90% epiboly 90|stage index:6|geo loc name:missing|collection date:missing | T 90 C | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:90% epiboly 90|approx time hpf index:6 | GSM7863844 | GSM7863844: T 90 C; Danio rerio; RNA Seq | GSM7863844 r1 | GSM7863844 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | T_90_C_1.fq.gz T_90_C_2.fq.gz | fastq fastq | 6398344800.0 | 21327816.0 | GSM7863844 r1 | 0:150 1:150 | A:1724872738;C:1482617211;G:1486086002;T:1704715600;N:53249 | 150 | 150 | 1724872738 | 1482617211 | 1486086002 | 1704715600 | 53249 | SRX22205854 | SRS19261262 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96441 | 0.9648 | 0.09658 | 0.09584 | 0.75343 | 0.75371 | 0.46794 | 0.4645 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28635 | 28635 | SRR26502025 | SRX22205853 | SRS19261261 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | T 90 B | GSM7863843 | tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:90% epiboly 90|stage index:6|geo loc name:missing|collection date:missing | T 90 B | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:90% epiboly 90|approx time hpf index:6 | GSM7863843 | GSM7863843: T 90 B; Danio rerio; RNA Seq | GSM7863843 r1 | GSM7863843 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | T_90_B_1.fq.gz T_90_B_2.fq.gz | fastq fastq | 6279978300.0 | 20933261.0 | GSM7863843 r1 | 0:150 1:150 | A:1680271798;C:1468182401;G:1474005123;T:1657464307;N:54671 | 150 | 150 | 1680271798 | 1468182401 | 1474005123 | 1657464307 | 54671 | SRX22205853 | SRS19261261 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96311 | 0.96305 | 0.09359 | 0.09345 | 0.74393 | 0.74519 | 0.47078 | 0.46759 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28636 | 28636 | SRR26502026 | SRX22205852 | SRS19261260 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | T 90 A | GSM7863842 | tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:90% epiboly 90|stage index:6|geo loc name:missing|collection date:missing | T 90 A | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:90% epiboly 90|approx time hpf index:6 | GSM7863842 | GSM7863842: T 90 A; Danio rerio; RNA Seq | GSM7863842 r1 | GSM7863842 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | T_90_A_1.fq.gz T_90_A_2.fq.gz | fastq fastq | 7755654300.0 | 25852181.0 | GSM7863842 r1 | 0:150 1:150 | A:2077927368;C:1813062432;G:1814888286;T:2049708638;N:67576 | 150 | 150 | 2077927368 | 1813062432 | 1814888286 | 2049708638 | 67576 | SRX22205852 | SRS19261260 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96466 | 0.96575 | 0.08904 | 0.08901 | 0.75394 | 0.75511 | 0.47076 | 0.47136 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28637 | 28637 | SRR26502027 | SRX22205851 | SRS19261259 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | T 75 C | GSM7863841 | tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:75% epiboly 75|stage index:5|geo loc name:missing|collection date:missing | T 75 C | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:75% epiboly 75|approx time hpf index:5 | GSM7863841 | GSM7863841: T 75 C; Danio rerio; RNA Seq | GSM7863841 r1 | GSM7863841 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | T_75_C_1.fq.gz T_75_C_2.fq.gz | fastq fastq | 6501058500.0 | 21670195.0 | GSM7863841 r1 | 0:150 1:150 | A:1751253851;C:1509986787;G:1512935619;T:1726827086;N:55157 | 150 | 150 | 1751253851 | 1509986787 | 1512935619 | 1726827086 | 55157 | SRX22205851 | SRS19261259 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96228 | 0.96276 | 0.0919 | 0.09234 | 0.75467 | 0.75607 | 0.47125 | 0.47104 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28638 | 28638 | SRR26502028 | SRX22205850 | SRS19261258 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | T 75 B | GSM7863840 | tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:75% epiboly 75|stage index:5|geo loc name:missing|collection date:missing | T 75 B | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:75% epiboly 75|approx time hpf index:5 | GSM7863840 | GSM7863840: T 75 B; Danio rerio; RNA Seq | GSM7863840 r1 | GSM7863840 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | T_75_B_1.fq.gz T_75_B_2.fq.gz | fastq fastq | 7631094900.0 | 25436983.0 | GSM7863840 r1 | 0:150 1:150 | A:2048061699;C:1779680847;G:1784890228;T:2018397630;N:64496 | 150 | 150 | 2048061699 | 1779680847 | 1784890228 | 2018397630 | 64496 | SRX22205850 | SRS19261258 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96341 | 0.96389 | 0.08779 | 0.08755 | 0.75264 | 0.75388 | 0.47832 | 0.47521 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28639 | 28639 | SRR26502029 | SRX22205849 | SRS19261257 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | T 75 A | GSM7863839 | tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:75% epiboly 75|stage index:5|geo loc name:missing|collection date:missing | T 75 A | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:75% epiboly 75|approx time hpf index:5 | GSM7863839 | GSM7863839: T 75 A; Danio rerio; RNA Seq | GSM7863839 r1 | GSM7863839 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | T_75_A_1.fq.gz T_75_A_2.fq.gz | fastq fastq | 9152924700.0 | 30509749.0 | GSM7863839 r1 | 0:150 1:150 | A:2467013867;C:2123447001;G:2124918665;T:2437466129;N:79038 | 150 | 150 | 2467013867 | 2123447001 | 2124918665 | 2437466129 | 79038 | SRX22205849 | SRS19261257 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96173 | 0.96213 | 0.09128 | 0.09074 | 0.75341 | 0.75371 | 0.47969 | 0.48083 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28640 | 28640 | SRR26502030 | SRX22205848 | SRS19261256 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | T 50 C | GSM7863838 | tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:50% epiboly 50|stage index:3|geo loc name:missing|collection date:missing | T 50 C | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:50% epiboly 50|approx time hpf index:3 | GSM7863838 | GSM7863838: T 50 C; Danio rerio; RNA Seq | GSM7863838 r1 | GSM7863838 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | T_50_C_1.fq.gz T_50_C_2.fq.gz | fastq fastq | 7865395800.0 | 26217986.0 | GSM7863838 r1 | 0:150 1:150 | A:2105742564;C:1838971039;G:1844028912;T:2076589235;N:64050 | 150 | 150 | 2105742564 | 1838971039 | 1844028912 | 2076589235 | 64050 | SRX22205848 | SRS19261256 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96154 | 0.96179 | 0.0733 | 0.0731 | 0.75106 | 0.75183 | 0.48119 | 0.48112 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28641 | 28641 | SRR26502031 | SRX22205847 | SRS19261255 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | T 50 B | GSM7863837 | tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:50% epiboly 50|stage index:3|geo loc name:missing|collection date:missing | T 50 B | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:50% epiboly 50|approx time hpf index:3 | GSM7863837 | GSM7863837: T 50 B; Danio rerio; RNA Seq | GSM7863837 r1 | GSM7863837 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | T_50_B_1.fq.gz T_50_B_2.fq.gz | fastq fastq | 6252881700.0 | 20842939.0 | GSM7863837 r1 | 0:150 1:150 | A:1673032708;C:1458194206;G:1466242599;T:1655359178;N:53009 | 150 | 150 | 1673032708 | 1458194206 | 1466242599 | 1655359178 | 53009 | SRX22205847 | SRS19261255 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96127 | 0.96223 | 0.0787 | 0.07847 | 0.75254 | 0.75388 | 0.47997 | 0.47675 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28642 | 28642 | SRR26502032 | SRX22205846 | SRS19261254 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | T 50 A | GSM7863836 | tissue:Zebrafish embryo explants|condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:50% epiboly 50|stage index:3|geo loc name:missing|collection date:missing | T 50 A | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:constitutively active Nodal receptor CA acvr1b* T|developmental stage:50% epiboly 50|approx time hpf index:3 | GSM7863836 | GSM7863836: T 50 A; Danio rerio; RNA Seq | GSM7863836 r1 | GSM7863836 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | T_50_A_1.fq.gz T_50_A_2.fq.gz | fastq fastq | 7121804700.0 | 23739349.0 | GSM7863836 r1 | 0:150 1:150 | A:1904685479;C:1668509467;G:1670775713;T:1877772836;N:61205 | 150 | 150 | 1904685479 | 1668509467 | 1670775713 | 1877772836 | 61205 | SRX22205846 | SRS19261254 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96409 | 0.96384 | 0.07121 | 0.07079 | 0.74746 | 0.74726 | 0.48606 | 0.4885 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28646 | 28646 | SRR26502036 | SRX22205842 | SRS19261250 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | U SH C | GSM7863868 | tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:shield SH|stage index:4|geo loc name:missing|collection date:missing | U SH C | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:uninjected U controls|developmental stage:shield SH|approx time hpf index:4 | GSM7863868 | GSM7863868: U SH C; Danio rerio; RNA Seq | GSM7863868 r1 | GSM7863868 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | U_SH_C_1.fq.gz U_SH_C_2.fq.gz | fastq fastq | 6688731300.0 | 22295771.0 | GSM7863868 r1 | 0:150 1:150 | A:1804374671;C:1551897330;G:1551654443;T:1780747960;N:56896 | 150 | 150 | 1804374671 | 1551897330 | 1551654443 | 1780747960 | 56896 | SRX22205842 | SRS19261250 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96154 | 0.96144 | 0.08744 | 0.08731 | 0.7539 | 0.75566 | 0.4833 | 0.47896 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28647 | 28647 | SRR26502037 | SRX22205841 | SRS19261249 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | U SH B | GSM7863867 | tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:shield SH|stage index:4|geo loc name:missing|collection date:missing | U SH B | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:uninjected U controls|developmental stage:shield SH|approx time hpf index:4 | GSM7863867 | GSM7863867: U SH B; Danio rerio; RNA Seq | GSM7863867 r1 | GSM7863867 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | U_SH_B_1.fq.gz U_SH_B_2.fq.gz | fastq fastq | 6512335800.0 | 21707786.0 | GSM7863867 r1 | 0:150 1:150 | A:1744526207;C:1519043511;G:1527463368;T:1721185737;N:116977 | 150 | 150 | 1744526207 | 1519043511 | 1527463368 | 1721185737 | 116977 | SRX22205841 | SRS19261249 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.95957 | 0.95817 | 0.08175 | 0.08113 | 0.75846 | 0.75812 | 0.47649 | 0.47681 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28648 | 28648 | SRR26502038 | SRX22205840 | SRS19261248 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | U SH A | GSM7863866 | tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:shield SH|stage index:4|geo loc name:missing|collection date:missing | U SH A | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:uninjected U controls|developmental stage:shield SH|approx time hpf index:4 | GSM7863866 | GSM7863866: U SH A; Danio rerio; RNA Seq | GSM7863866 r1 | GSM7863866 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | U_SH_A_1.fq.gz U_SH_A_2.fq.gz | fastq fastq | 7442565000.0 | 24808550.0 | GSM7863866 r1 | 0:150 1:150 | A:1995701799;C:1735855246;G:1739102229;T:1971773813;N:131913 | 150 | 150 | 1995701799 | 1735855246 | 1739102229 | 1971773813 | 131913 | SRX22205840 | SRS19261248 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96153 | 0.95979 | 0.08334 | 0.08223 | 0.75688 | 0.75745 | 0.4743 | 0.47513 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28649 | 28649 | SRR26502039 | SRX22205839 | SRS19261247 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | U 90 C | GSM7863865 | tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:90% epiboly 90|stage index:6|geo loc name:missing|collection date:missing | U 90 C | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:uninjected U controls|developmental stage:90% epiboly 90|approx time hpf index:6 | GSM7863865 | GSM7863865: U 90 C; Danio rerio; RNA Seq | GSM7863865 r1 | GSM7863865 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | U_90_C_1.fq.gz U_90_C_2.fq.gz | fastq fastq | 5882246400.0 | 19607488.0 | GSM7863865 r1 | 0:150 1:150 | A:1592127975;C:1356629000;G:1355357959;T:1578080880;N:50586 | 150 | 150 | 1592127975 | 1356629000 | 1355357959 | 1578080880 | 50586 | SRX22205839 | SRS19261247 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96232 | 0.96172 | 0.09888 | 0.0981 | 0.75386 | 0.75489 | 0.48113 | 0.48407 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28650 | 28650 | SRR26502040 | SRX22205838 | SRS19261246 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | U 90 B | GSM7863864 | tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:90% epiboly 90|stage index:6|geo loc name:missing|collection date:missing | U 90 B | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:uninjected U controls|developmental stage:90% epiboly 90|approx time hpf index:6 | GSM7863864 | GSM7863864: U 90 B; Danio rerio; RNA Seq | GSM7863864 r1 | GSM7863864 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | U_90_B_1.fq.gz U_90_B_2.fq.gz | fastq fastq | 8416685700.0 | 28055619.0 | GSM7863864 r1 | 0:150 1:150 | A:2263108331;C:1958055116;G:1962100909;T:2233349987;N:71357 | 150 | 150 | 2263108331 | 1958055116 | 1962100909 | 2233349987 | 71357 | SRX22205838 | SRS19261246 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96228 | 0.96182 | 0.09278 | 0.09268 | 0.74982 | 0.75213 | 0.47307 | 0.47284 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28651 | 28651 | SRR26502041 | SRX22205837 | SRS19261245 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | U 90 A | GSM7863863 | tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:90% epiboly 90|stage index:6|geo loc name:missing|collection date:missing | U 90 A | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:uninjected U controls|developmental stage:90% epiboly 90|approx time hpf index:6 | GSM7863863 | GSM7863863: U 90 A; Danio rerio; RNA Seq | GSM7863863 r1 | GSM7863863 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | U_90_A_1.fq.gz U_90_A_2.fq.gz | fastq fastq | 6122109600.0 | 20407032.0 | GSM7863863 r1 | 0:150 1:150 | A:1653463991;C:1417599296;G:1415530495;T:1635462881;N:52937 | 150 | 150 | 1653463991 | 1417599296 | 1415530495 | 1635462881 | 52937 | SRX22205837 | SRS19261245 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96407 | 0.96477 | 0.10222 | 0.10171 | 0.74819 | 0.74925 | 0.47288 | 0.47211 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28652 | 28652 | SRR26502042 | SRX22205836 | SRS19261244 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | U 75 C | GSM7863862 | tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:75% epiboly 75|stage index:5|geo loc name:missing|collection date:missing | U 75 C | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:uninjected U controls|developmental stage:75% epiboly 75|approx time hpf index:5 | GSM7863862 | GSM7863862: U 75 C; Danio rerio; RNA Seq | GSM7863862 r1 | GSM7863862 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | U_75_C_1.fq.gz U_75_C_2.fq.gz | fastq fastq | 6220317600.0 | 20734392.0 | GSM7863862 r1 | 0:150 1:150 | A:1669342537;C:1449107213;G:1451970416;T:1649844410;N:53024 | 150 | 150 | 1669342537 | 1449107213 | 1451970416 | 1649844410 | 53024 | SRX22205836 | SRS19261244 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.961 | 0.96067 | 0.08861 | 0.088 | 0.75655 | 0.7569 | 0.48138 | 0.48198 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28653 | 28653 | SRR26502043 | SRX22205835 | SRS19261243 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | U 75 B | GSM7863861 | tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:75% epiboly 75|stage index:5|geo loc name:missing|collection date:missing | U 75 B | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:uninjected U controls|developmental stage:75% epiboly 75|approx time hpf index:5 | GSM7863861 | GSM7863861: U 75 B; Danio rerio; RNA Seq | GSM7863861 r1 | GSM7863861 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | U_75_B_1.fq.gz U_75_B_2.fq.gz | fastq fastq | 8081667600.0 | 26938892.0 | GSM7863861 r1 | 0:150 1:150 | A:2179588193;C:1874416281;G:1875304825;T:2152215340;N:142961 | 150 | 150 | 2179588193 | 1874416281 | 1875304825 | 2152215340 | 142961 | SRX22205835 | SRS19261243 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96025 | 0.95806 | 0.09028 | 0.08915 | 0.75426 | 0.75386 | 0.48186 | 0.47495 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28654 | 28654 | SRR26502044 | SRX22205834 | SRS19261242 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | U 75 A | GSM7863860 | tissue:Zebrafish embryo explants|condition:uninjected U controls|developmental stage:75% epiboly 75|stage index:5|geo loc name:missing|collection date:missing | U 75 A | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:uninjected U controls|developmental stage:75% epiboly 75|approx time hpf index:5 | GSM7863860 | GSM7863860: U 75 A; Danio rerio; RNA Seq | GSM7863860 r1 | GSM7863860 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | U_75_A_1.fq.gz U_75_A_2.fq.gz | fastq fastq | 6499026300.0 | 21663421.0 | GSM7863860 r1 | 0:150 1:150 | A:1752226021;C:1507945830;G:1507651350;T:1731087760;N:115339 | 150 | 150 | 1752226021 | 1507945830 | 1507651350 | 1731087760 | 115339 | SRX22205834 | SRS19261242 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96204 | 0.96031 | 0.09679 | 0.09497 | 0.75051 | 0.7515 | 0.479 | 0.47734 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28664 | 28664 | SRR26502054 | SRX22205824 | SRS19261233 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | N SH C | GSM7863826 | tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:shield SH|stage index:4|geo loc name:missing|collection date:missing | N SH C | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:Nodal ligand ndr2 N|developmental stage:shield SH|approx time hpf index:4 | GSM7863826 | GSM7863826: N SH C; Danio rerio; RNA Seq | GSM7863826 r1 | GSM7863826 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | N_SH_C_1.fq.gz N_SH_C_2.fq.gz | fastq fastq | 9113015100.0 | 30376717.0 | GSM7863826 r1 | 0:150 1:150 | A:2442019230;C:2127502465;G:2131954892;T:2411378522;N:159991 | 150 | 150 | 2442019230 | 2127502465 | 2131954892 | 2411378522 | 159991 | SRX22205824 | SRS19261233 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.95836 | 0.95651 | 0.083 | 0.08242 | 0.75568 | 0.75635 | 0.47428 | 0.47139 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28665 | 28665 | SRR26502055 | SRX22205823 | SRS19261231 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | N SH B | GSM7863825 | tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:shield SH|stage index:4|geo loc name:missing|collection date:missing | N SH B | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:Nodal ligand ndr2 N|developmental stage:shield SH|approx time hpf index:4 | GSM7863825 | GSM7863825: N SH B; Danio rerio; RNA Seq | GSM7863825 r1 | GSM7863825 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | N_SH_B_1.fq.gz N_SH_B_2.fq.gz | fastq fastq | 8041623600.0 | 26805412.0 | GSM7863825 r1 | 0:150 1:150 | A:2159380955;C:1870789352;G:1876754939;T:2134554828;N:143526 | 150 | 150 | 2159380955 | 1870789352 | 1876754939 | 2134554828 | 143526 | SRX22205823 | SRS19261231 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.95918 | 0.95768 | 0.08245 | 0.08185 | 0.75586 | 0.7554 | 0.48131 | 0.4782 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28666 | 28666 | SRR26502056 | SRX22205822 | SRS19261230 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | N SH A | GSM7863824 | tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:shield SH|stage index:4|geo loc name:missing|collection date:missing | N SH A | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:Nodal ligand ndr2 N|developmental stage:shield SH|approx time hpf index:4 | GSM7863824 | GSM7863824: N SH A; Danio rerio; RNA Seq | GSM7863824 r1 | GSM7863824 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | N_SH_A_1.fq.gz N_SH_A_2.fq.gz | fastq fastq | 8008707900.0 | 26695693.0 | GSM7863824 r1 | 0:150 1:150 | A:2140787133;C:1869767141;G:1882721398;T:2115289932;N:142296 | 150 | 150 | 2140787133 | 1869767141 | 1882721398 | 2115289932 | 142296 | SRX22205822 | SRS19261230 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.9566 | 0.95517 | 0.08491 | 0.08416 | 0.75728 | 0.75838 | 0.4658 | 0.47743 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28667 | 28667 | SRR26502057 | SRX22205821 | SRS19261229 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | N 90 C | GSM7863823 | tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:90% epiboly 90|stage index:6|geo loc name:missing|collection date:missing | N 90 C | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:Nodal ligand ndr2 N|developmental stage:90% epiboly 90|approx time hpf index:6 | GSM7863823 | GSM7863823: N 90 C; Danio rerio; RNA Seq | GSM7863823 r1 | GSM7863823 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | N_90_C_1.fq.gz N_90_C_2.fq.gz | fastq fastq | 8692269300.0 | 28974231.0 | GSM7863823 r1 | 0:150 1:150 | A:2325747976;C:2028802846;G:2039587502;T:2298059046;N:71930 | 150 | 150 | 2325747976 | 2028802846 | 2039587502 | 2298059046 | 71930 | SRX22205821 | SRS19261229 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96233 | 0.96305 | 0.09351 | 0.09356 | 0.75272 | 0.75189 | 0.47484 | 0.47481 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28668 | 28668 | SRR26502058 | SRX22205820 | SRS19261228 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | N 90 B | GSM7863822 | tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:90% epiboly 90|stage index:6|geo loc name:missing|collection date:missing | N 90 B | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:Nodal ligand ndr2 N|developmental stage:90% epiboly 90|approx time hpf index:6 | GSM7863822 | GSM7863822: N 90 B; Danio rerio; RNA Seq | GSM7863822 r1 | GSM7863822 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | N_90_B_1.fq.gz N_90_B_2.fq.gz | fastq fastq | 7106159400.0 | 23687198.0 | GSM7863822 r1 | 0:150 1:150 | A:1907847765;C:1653524923;G:1660338458;T:1884321885;N:126369 | 150 | 150 | 1907847765 | 1653524923 | 1660338458 | 1884321885 | 126369 | SRX22205820 | SRS19261228 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96111 | 0.96015 | 0.09004 | 0.08929 | 0.75424 | 0.75442 | 0.46204 | 0.45958 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28669 | 28669 | SRR26502059 | SRX22205819 | SRS19261227 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | N 90 A | GSM7863821 | tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:90% epiboly 90|stage index:6|geo loc name:missing|collection date:missing | N 90 A | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:Nodal ligand ndr2 N|developmental stage:90% epiboly 90|approx time hpf index:6 | GSM7863821 | GSM7863821: N 90 A; Danio rerio; RNA Seq | GSM7863821 r1 | GSM7863821 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | N_90_A_1.fq.gz N_90_A_2.fq.gz | fastq fastq | 5628789300.0 | 18762631.0 | GSM7863821 r1 | 0:150 1:150 | A:1501659697;C:1321244256;G:1325654867;T:1480211036;N:19444 | 150 | 150 | 1501659697 | 1321244256 | 1325654867 | 1480211036 | 19444 | SRX22205819 | SRS19261227 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.95899 | 0.96012 | 0.09606 | 0.09553 | 0.75497 | 0.75491 | 0.4661 | 0.4681 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28670 | 28670 | SRR26502060 | SRX22205818 | SRS19261226 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | N 75 C | GSM7863820 | tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:75% epiboly 75|stage index:5|geo loc name:missing|collection date:missing | N 75 C | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:Nodal ligand ndr2 N|developmental stage:75% epiboly 75|approx time hpf index:5 | GSM7863820 | GSM7863820: N 75 C; Danio rerio; RNA Seq | GSM7863820 r1 | GSM7863820 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | N_75_C_1.fq.gz N_75_C_2.fq.gz | fastq fastq | 6570327600.0 | 21901092.0 | GSM7863820 r1 | 0:150 1:150 | A:1758048820;C:1536184221;G:1540288696;T:1735687988;N:117875 | 150 | 150 | 1758048820 | 1536184221 | 1540288696 | 1735687988 | 117875 | SRX22205818 | SRS19261226 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96157 | 0.95904 | 0.09178 | 0.08976 | 0.75702 | 0.75726 | 0.4642 | 0.47039 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28671 | 28671 | SRR26502061 | SRX22205817 | SRS19261225 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | N 75 B | GSM7863819 | tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:75% epiboly 75|stage index:5|geo loc name:missing|collection date:missing | N 75 B | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:Nodal ligand ndr2 N|developmental stage:75% epiboly 75|approx time hpf index:5 | GSM7863819 | GSM7863819: N 75 B; Danio rerio; RNA Seq | GSM7863819 r1 | GSM7863819 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | N_75_B_1.fq.gz N_75_B_2.fq.gz | fastq fastq | 6651981600.0 | 22173272.0 | GSM7863819 r1 | 0:150 1:150 | A:1779039362;C:1553672672;G:1560305682;T:1758846065;N:117819 | 150 | 150 | 1779039362 | 1553672672 | 1560305682 | 1758846065 | 117819 | SRX22205817 | SRS19261225 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.96113 | 0.95869 | 0.08762 | 0.08717 | 0.75619 | 0.75822 | 0.47562 | 0.47183 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28672 | 28672 | SRR26502062 | SRX22205816 | SRS19261224 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | N 75 A | GSM7863818 | tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:75% epiboly 75|stage index:5|geo loc name:missing|collection date:missing | N 75 A | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:Nodal ligand ndr2 N|developmental stage:75% epiboly 75|approx time hpf index:5 | GSM7863818 | GSM7863818: N 75 A; Danio rerio; RNA Seq | GSM7863818 r1 | GSM7863818 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | N_75_A_1.fq.gz N_75_A_2.fq.gz | fastq fastq | 7142931300.0 | 23809771.0 | GSM7863818 r1 | 0:150 1:150 | A:1937831740;C:1643617608;G:1644790568;T:1916566274;N:125110 | 150 | 150 | 1937831740 | 1643617608 | 1644790568 | 1916566274 | 125110 | SRX22205816 | SRS19261224 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.95756 | 0.95571 | 0.09626 | 0.09538 | 0.75568 | 0.75574 | 0.4801 | 0.48291 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28673 | 28673 | SRR26502063 | SRX22205815 | SRS19261223 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | N 50 C | GSM7863817 | tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:50% epiboly 50|stage index:3|geo loc name:missing|collection date:missing | N 50 C | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:Nodal ligand ndr2 N|developmental stage:50% epiboly 50|approx time hpf index:3 | GSM7863817 | GSM7863817: N 50 C; Danio rerio; RNA Seq | GSM7863817 r1 | GSM7863817 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | N_50_C_1.fq.gz N_50_C_2.fq.gz | fastq fastq | 6393259800.0 | 21310866.0 | GSM7863817 r1 | 0:150 1:150 | A:1720344436;C:1478560577;G:1485815360;T:1708424812;N:114615 | 150 | 150 | 1720344436 | 1478560577 | 1485815360 | 1708424812 | 114615 | SRX22205815 | SRS19261223 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.95787 | 0.93607 | 0.08619 | 0.08344 | 0.74915 | 0.7512 | 0.48569 | 0.48395 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28674 | 28674 | SRR26502064 | SRX22205814 | SRS19261222 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | N 50 B | GSM7863816 | tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:50% epiboly 50|stage index:3|geo loc name:missing|collection date:missing | N 50 B | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:Nodal ligand ndr2 N|developmental stage:50% epiboly 50|approx time hpf index:3 | GSM7863816 | GSM7863816: N 50 B; Danio rerio; RNA Seq | GSM7863816 r1 | GSM7863816 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | N_50_B_1.fq.gz N_50_B_2.fq.gz | fastq fastq | 7099633200.0 | 23665444.0 | GSM7863816 r1 | 0:150 1:150 | A:1901037919;C:1657456969;G:1662891679;T:1878120726;N:125907 | 150 | 150 | 1901037919 | 1657456969 | 1662891679 | 1878120726 | 125907 | SRX22205814 | SRS19261222 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.95864 | 0.95733 | 0.07564 | 0.07553 | 0.74923 | 0.75024 | 0.48134 | 0.48002 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28675 | 28675 | SRR26502065 | SRX22205813 | SRS19261221 | SRP468205 | PRJNA1031674 | Longitudinal gene expression profiling in Nodal induced and control zebrafish embryonic explants | GSE246158 | Transcriptome Analysis | We report RNA sequencing from zebrafish explants generated from embryos injected with mRNA encoding the Nodal ligand ndr2 N constitutively active Nodal receptor CA acvr1b* T and uninjected U controls. Explants of all 3 conditions were compared at each of 7 developmental stages: sphere SR zfs:0000015 30 50% epiboly 50 shield SH 75% epiboly 75 90% epiboly 90 and 2 somite 2S corresponding to 4 4.7 5.3 6 8 9 and 11 hpf respectively. Overall design: Sequencing of polyadenylated mRNAs from ndr2 N CA acvr1b*T and uninjected U explants with 3 biological replicates A C per condition per stage SR 2S. | pubmed:39651654 | N 50 A | GSM7863815 | tissue:Zebrafish embryo explants|condition:Nodal ligand ndr2 N|developmental stage:50% epiboly 50|stage index:3|geo loc name:missing|collection date:missing | N 50 A | Sequenced reads were trimmed for adaptor sequence using TrimGalore Reads were mapped to the UCSC zebrafish reference genome danRer11 using STAR featureCounts was used to evaluate gene expression level as read counts Assembly: Danio rerio GRCz11 Ensembl Release 98 Supplementary files format and content: Matrix table with raw gene counts for every gene and every sample | Zebrafish embryo explants | Explants of N and T conditions were isolated from embryos injected at the 1 cell stage with 10 pg ndr2 or 0.5 pg CA acvr1b* mRNA respectively | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | Explants were cultured in explant media from their time of isolation from the embryo at approximately 3 hours post until collection | condition:Nodal ligand ndr2 N|developmental stage:50% epiboly 50|approx time hpf index:3 | GSM7863815 | GSM7863815: N 50 A; Danio rerio; RNA Seq | GSM7863815 r1 | GSM7863815 | 1 | Total RNA was isolated using Trizol reagent then purified by sodium acetate precipitation and eluted in 10 mM Tris pH7.5 RNA libraries were prepared for sequencing using standard Illumina protocols | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP468205 | loader:fastq load.py | N_50_A_1.fq.gz N_50_A_2.fq.gz | fastq fastq | 7762668300.0 | 25875561.0 | GSM7863815 r1 | 0:150 1:150 | A:2081357341;C:1808926382;G:1815914430;T:2056336244;N:133903 | 150 | 150 | 2081357341 | 1808926382 | 1815914430 | 2056336244 | 133903 | SRX22205813 | SRS19261221 | SRA1738892 | Baylor College of Medicine | Baylor College of Medicine | 2 | 0.95618 | 0.95489 | 0.08291 | 0.08238 | 0.75012 | 0.7511 | 0.48142 | 0.48069 | 150 | 150 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2023-10-24 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | |||||||||
| 28779 | 28779 | SRR26639295 | SRX22339675 | SRS19389324 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | TL rep3 | GSM7880093 | source name:50% epiboly|tissue:50% epiboly|geo loc name:missing|collection date:missing | TL rep3 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly | GSM7880093 | GSM7880093: TL rep3; Danio rerio; RNA Seq | GSM7880093 r1 | GSM7880093 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | TL_3_R1.fastq.gz TL_3_R2.fastq.gz | fastq fastq | 20445377954.0 | 67699927.0 | GSM7880093 r1 | 0:151 1:151 | A:5561527076;C:4694922553;G:4739686239;T:5449146715;N:95371 | 151 | 151 | 5561527076 | 4694922553 | 4739686239 | 5449146715 | 95371 | SRX22339675 | SRS19389324 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.95517 | 0.9587 | 0.06702 | 0.0641 | 0.7545 | 0.75327 | 0.48677 | 0.4759 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28780 | 28780 | SRR26639296 | SRX22339674 | SRS19389323 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | TL rep2 | GSM7880092 | source name:50% epiboly|tissue:50% epiboly|geo loc name:missing|collection date:missing | TL rep2 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly | GSM7880092 | GSM7880092: TL rep2; Danio rerio; RNA Seq | GSM7880092 r1 | GSM7880092 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | TL_2_R1.fastq.gz TL_2_R2.fastq.gz | fastq fastq | 18973506964.0 | 62826182.0 | GSM7880092 r1 | 0:151 1:151 | A:5134289386;C:4388284948;G:4404959801;T:5045885680;N:87149 | 151 | 151 | 5134289386 | 4388284948 | 4404959801 | 5045885680 | 87149 | SRX22339674 | SRS19389323 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.95643 | 0.95981 | 0.0673 | 0.06493 | 0.75357 | 0.75375 | 0.48364 | 0.48649 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28781 | 28781 | SRR26639297 | SRX22339673 | SRS19389322 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | TL rep1 | GSM7880091 | source name:50% epiboly|tissue:50% epiboly|geo loc name:missing|collection date:missing | TL rep1 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly | GSM7880091 | GSM7880091: TL rep1; Danio rerio; RNA Seq | GSM7880091 r1 | GSM7880091 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | TL_1_R1.fastq.gz TL_1_R2.fastq.gz | fastq fastq | 19734646926.0 | 65346513.0 | GSM7880091 r1 | 0:151 1:151 | A:5330305942;C:4563398898;G:4584631576;T:5256217283;N:93227 | 151 | 151 | 5330305942 | 4563398898 | 4584631576 | 5256217283 | 93227 | SRX22339673 | SRS19389322 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.95587 | 0.95973 | 0.07453 | 0.07232 | 0.75081 | 0.74955 | 0.48679 | 0.49162 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28782 | 28782 | SRR26639298 | SRX22339672 | SRS19389321 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | Tu rep3 | GSM7880090 | source name:50% epiboly|tissue:50% epiboly|geo loc name:missing|collection date:missing | Tu rep3 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly | GSM7880090 | GSM7880090: Tu rep3; Danio rerio; RNA Seq | GSM7880090 r1 | GSM7880090 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | Tu_3_R1.fastq.gz Tu_3_R2.fastq.gz | fastq fastq | 18114004696.0 | 59980148.0 | GSM7880090 r1 | 0:151 1:151 | A:4945816405;C:4151145591;G:4181986380;T:4834972115;N:84205 | 151 | 151 | 4945816405 | 4151145591 | 4181986380 | 4834972115 | 84205 | SRX22339672 | SRS19389321 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.96564 | 0.968 | 0.07423 | 0.07113 | 0.75653 | 0.75635 | 0.49412 | 0.48474 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28783 | 28783 | SRR26639299 | SRX22339671 | SRS19389320 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | Tu rep2 | GSM7880089 | source name:50% epiboly|tissue:50% epiboly|geo loc name:missing|collection date:missing | Tu rep2 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly | GSM7880089 | GSM7880089: Tu rep2; Danio rerio; RNA Seq | GSM7880089 r1 | GSM7880089 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | Tu_2_R1.fastq.gz Tu_2_R2.fastq.gz | fastq fastq | 18943158078.0 | 62725689.0 | GSM7880089 r1 | 0:151 1:151 | A:5140123698;C:4366290874;G:4396999060;T:5039656619;N:87827 | 151 | 151 | 5140123698 | 4366290874 | 4396999060 | 5039656619 | 87827 | SRX22339671 | SRS19389320 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.973 | 0.97483 | 0.07443 | 0.07095 | 0.7567 | 0.75599 | 0.48669 | 0.48759 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28784 | 28784 | SRR26639300 | SRX22339670 | SRS19389319 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | Tu rep1 | GSM7880088 | source name:50% epiboly|tissue:50% epiboly|geo loc name:missing|collection date:missing | Tu rep1 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly | GSM7880088 | GSM7880088: Tu rep1; Danio rerio; RNA Seq | GSM7880088 r1 | GSM7880088 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | Tu_1_R1.fastq.gz Tu_1_R2.fastq.gz | fastq fastq | 17044930132.0 | 56440166.0 | GSM7880088 r1 | 0:151 1:151 | A:4628036893;C:3920619633;G:3956897991;T:4539296630;N:78985 | 151 | 151 | 4628036893 | 3920619633 | 3956897991 | 4539296630 | 78985 | SRX22339670 | SRS19389319 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.97111 | 0.97341 | 0.07345 | 0.07061 | 0.7515 | 0.75037 | 0.48233 | 0.48702 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28785 | 28785 | SRR26639301 | SRX22339669 | SRS19389318 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | Double KO rep3 | GSM7880087 | source name:50% epiboly|tissue:50% epiboly|genotype:axin2 / ;nkd1 / |geo loc name:missing|collection date:missing | Double KO rep3 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly|genotype:axin2 / ;nkd1 / | GSM7880087 | GSM7880087: Double KO rep3; Danio rerio; RNA Seq | GSM7880087 r1 | GSM7880087 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | Double_3_R1.fastq.gz Double_3_R2.fastq.gz | fastq fastq | 20375422976.0 | 67468288.0 | GSM7880087 r1 | 0:151 1:151 | A:5534861058;C:4681935474;G:4717573645;T:5440958114;N:94685 | 151 | 151 | 5534861058 | 4681935474 | 4717573645 | 5440958114 | 94685 | SRX22339669 | SRS19389318 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.96089 | 0.96356 | 0.08173 | 0.07855 | 0.75586 | 0.75515 | 0.4897 | 0.48796 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28786 | 28786 | SRR26639302 | SRX22339668 | SRS19389317 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | Double KO rep2 | GSM7880086 | source name:50% epiboly|tissue:50% epiboly|genotype:axin2 / ;nkd1 / |geo loc name:missing|collection date:missing | Double KO rep2 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly|genotype:axin2 / ;nkd1 / | GSM7880086 | GSM7880086: Double KO rep2; Danio rerio; RNA Seq | GSM7880086 r1 | GSM7880086 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | Double_2_R1.fastq.gz Double_2_R2.fastq.gz | fastq fastq | 16249427100.0 | 53806050.0 | GSM7880086 r1 | 0:151 1:151 | A:4397257316;C:3744615011;G:3783189121;T:4324289150;N:76502 | 151 | 151 | 4397257316 | 3744615011 | 3783189121 | 4324289150 | 76502 | SRX22339668 | SRS19389317 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.96048 | 0.96185 | 0.08123 | 0.07879 | 0.75521 | 0.75481 | 0.4825 | 0.4802 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28787 | 28787 | SRR26639303 | SRX22339667 | SRS19389316 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | Double KO rep1 | GSM7880085 | source name:50% epiboly|tissue:50% epiboly|genotype:axin2 / ;nkd1 / |geo loc name:missing|collection date:missing | Double KO rep1 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly|genotype:axin2 / ;nkd1 / | GSM7880085 | GSM7880085: Double KO rep1; Danio rerio; RNA Seq | GSM7880085 r1 | GSM7880085 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | Double_1_R1.fastq.gz Double_1_R2.fastq.gz | fastq fastq | 18084016096.0 | 59880848.0 | GSM7880085 r1 | 0:151 1:151 | A:4905932629;C:4161002236;G:4193704390;T:4823292417;N:84424 | 151 | 151 | 4905932629 | 4161002236 | 4193704390 | 4823292417 | 84424 | SRX22339667 | SRS19389316 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.96276 | 0.96501 | 0.07416 | 0.07122 | 0.7555 | 0.75629 | 0.47721 | 0.47152 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28788 | 28788 | SRR26639304 | SRX22339666 | SRS19389315 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | Nkd1 KO rep3 | GSM7880084 | source name:50% epiboly|tissue:50% epiboly|genotype:nkd1 / |geo loc name:missing|collection date:missing | Nkd1 KO rep3 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly|genotype:nkd1 / | GSM7880084 | GSM7880084: Nkd1 KO rep3; Danio rerio; RNA Seq | GSM7880084 r1 | GSM7880084 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | Nkd1_3_R1.fastq.gz Nkd1_3_R2.fastq.gz | fastq fastq | 24641134622.0 | 81593161.0 | GSM7880084 r1 | 0:151 1:151 | A:6684332278;C:5685754681;G:5728753509;T:6542179311;N:114843 | 151 | 151 | 6684332278 | 5685754681 | 5728753509 | 6542179311 | 114843 | SRX22339666 | SRS19389315 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.96427 | 0.96656 | 0.07251 | 0.06951 | 0.75156 | 0.7516 | 0.4756 | 0.47866 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28789 | 28789 | SRR26639305 | SRX22339665 | SRS19389314 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | Nkd1 KO rep2 | GSM7880083 | source name:50% epiboly|tissue:50% epiboly|genotype:nkd1 / |geo loc name:missing|collection date:missing | Nkd1 KO rep2 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly|genotype:nkd1 / | GSM7880083 | GSM7880083: Nkd1 KO rep2; Danio rerio; RNA Seq | GSM7880083 r1 | GSM7880083 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | Nkd1_2_R1.fastq.gz Nkd1_2_R2.fastq.gz | fastq fastq | 19029970092.0 | 63013146.0 | GSM7880083 r1 | 0:151 1:151 | A:5165657698;C:4380766763;G:4411331997;T:5072125586;N:88048 | 151 | 151 | 5165657698 | 4380766763 | 4411331997 | 5072125586 | 88048 | SRX22339665 | SRS19389314 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.96662 | 0.96852 | 0.07847 | 0.07573 | 0.76288 | 0.76309 | 0.48192 | 0.48259 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28790 | 28790 | SRR26639306 | SRX22339664 | SRS19389313 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | Nkd1 KO rep1 | GSM7880082 | source name:50% epiboly|tissue:50% epiboly|genotype:nkd1 / |geo loc name:missing|collection date:missing | Nkd1 KO rep1 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly|genotype:nkd1 / | GSM7880082 | GSM7880082: Nkd1 KO rep1; Danio rerio; RNA Seq | GSM7880082 r1 | GSM7880082 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | Nkd1_1_R1.fastq.gz Nkd1_1_R2.fastq.gz | fastq fastq | 18402739044.0 | 60936222.0 | GSM7880082 r1 | 0:151 1:151 | A:5018572160;C:4211415106;G:4247409861;T:4925254691;N:87226 | 151 | 151 | 5018572160 | 4211415106 | 4247409861 | 4925254691 | 87226 | SRX22339664 | SRS19389313 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.96243 | 0.96385 | 0.07305 | 0.06928 | 0.75128 | 0.75073 | 0.47989 | 0.47829 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28791 | 28791 | SRR26639307 | SRX22339663 | SRS19389312 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | Axin2 KO rep3 | GSM7880081 | source name:50% epiboly|tissue:50% epiboly|genotype:axin2 / |geo loc name:missing|collection date:missing | Axin2 KO rep3 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly|genotype:axin2 / | GSM7880081 | GSM7880081: Axin2 KO rep3; Danio rerio; RNA Seq | GSM7880081 r1 | GSM7880081 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | Axin2_3_R1.fastq.gz Axin2_3_R2.fastq.gz | fastq fastq | 16427081318.0 | 54394309.0 | GSM7880081 r1 | 0:151 1:151 | A:4422777157;C:3807576705;G:3843869337;T:4352781064;N:77055 | 151 | 151 | 4422777157 | 3807576705 | 3843869337 | 4352781064 | 77055 | SRX22339663 | SRS19389312 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.95129 | 0.95403 | 0.06861 | 0.06651 | 0.75574 | 0.75613 | 0.48258 | 0.49053 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28792 | 28792 | SRR26639308 | SRX22339662 | SRS19389311 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | Axin2 KO rep2 | GSM7880080 | source name:50% epiboly|tissue:50% epiboly|genotype:axin2 / |geo loc name:missing|collection date:missing | Axin2 KO rep2 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly|genotype:axin2 / | GSM7880080 | GSM7880080: Axin2 KO rep2; Danio rerio; RNA Seq | GSM7880080 r1 | GSM7880080 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | Axin2_2_R1.fastq.gz Axin2_2_R2.fastq.gz | fastq fastq | 17960840262.0 | 59472981.0 | GSM7880080 r1 | 0:151 1:151 | A:4857331826;C:4141633380;G:4178206859;T:4783585028;N:83169 | 151 | 151 | 4857331826 | 4141633380 | 4178206859 | 4783585028 | 83169 | SRX22339662 | SRS19389311 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.95192 | 0.95512 | 0.07788 | 0.07625 | 0.75452 | 0.7554 | 0.49595 | 0.49783 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28793 | 28793 | SRR26639309 | SRX22339661 | SRS19389310 | SRP469870 | PRJNA1035005 | Loss of Nkd1 is dominant over loss of Axin2 in regulating Wnt signaling. | GSE246858 | Transcriptome Analysis | Wnt signaling is a crucial developmental pathway involved in early development as well as stem cell maintenance in adults and its misregulation leads to numerous diseases. Thus understanding the regulation of this pathway becomes vitally important. Axin2 and Nkd1 are widely utilized negative feedback regulators in Wnt signaling where Axin2 functions to destabilize cytoplasmic ß catenin and Nkd1 functions to inhibit the nuclear localization of ß catenin. Here we set out to further understand how Axin2 and Nkd1 regulate Wnt signaling by creating axin2 / nkd1 / single mutants and axin2 / ;nkd1 / double mutant zebrafish using sgRNA/Cas9. All three Wnt regulator mutants were viable and had impaired heart looping neuromast migration defects and behavior abnormalities in common but there were no signs of synergy in the axin2 / ;nkd1 / double mutants. Further Wnt target gene expression by qRT PCR and RNA seq analysis and protein expression by mass spec demonstrated that the double axin2 / ;nkd1 / mutant resembled the nkd1 / phenotype demonstrating that Axin functions upstream of Nkd1 and that loss of Nkd1 is dominant over the loss of Axin2. In support of this the data further demonstrates that Axin2 uniquely alters the properties of ß catenin dependent transcription having novel readouts of Wnt activity compared to nkd1 / or the axin2 / ;nkd1 / double mutant. We also tested the sensitivity of the Wnt regulator mutants to exacerbated Wnt signaling where the single mutants displayed characteristic heightened Wnt sensitivity resulting in an eyeless phenotype. Surprisingly this phenotype was rescued in the double mutant where we speculate that cross talk between Wnt/ß catenin and Wnt/Planar Cell Polarity pathways could lead to altered Wnt signaling in some scenarios. Collectively the data emphasizes both the commonality and the complexity in the feedback regulation of Wnt signaling. Overall design: To investigate Axin2 and Nkd1 regulation of Wnt signaling axin2 / and nkd1 / single knockout zebrafish… | Axin2 KO rep1 | GSM7880079 | source name:50% epiboly|tissue:50% epiboly|genotype:axin2 / |geo loc name:missing|collection date:missing | Axin2 KO rep1 | Rsubread v2.2.6 reads were aligned using the Rsubread align function to the Ensembl Genome Browser assembly ID: GRCz11 reads were filtered using EdgeR 3.30.3 filterByExpr function Assembly: GRCz11 Supplementary files format and content: csv for counts of all genotypes | 50% epiboly | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | tissue:50% epiboly|genotype:axin2 / | GSM7880079 | GSM7880079: Axin2 KO rep1; Danio rerio; RNA Seq | GSM7880079 r1 | GSM7880079 | 1 | 10 embryos at 50% epiboly were extracted using the FroggaBio GENEzol TriRNA pure kit following manufacturers instructions. NEBNext Ultra II DNA library prep kit for illumina New England BioLabs | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP469870 | loader:fastq load.py | Axin2_1_R1.fastq.gz Axin2_1_R2.fastq.gz | fastq fastq | 18793983668.0 | 62231734.0 | GSM7880079 r1 | 0:151 1:151 | A:5089751490;C:4331889868;G:4362686962;T:5009566791;N:88557 | 151 | 151 | 5089751490 | 4331889868 | 4362686962 | 5009566791 | 88557 | SRX22339661 | SRS19389310 | SRA1744390 | MCB, University of Guelph | MCB, University of Guelph | 2 | 0.95446 | 0.95694 | 0.07342 | 0.07066 | 0.75455 | 0.75353 | 0.49627 | 0.48613 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | cdna_unspecified | nebnext | bulk | unknown | unknown | Canada | 2023-11-02 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||
| 28906 | 28906 | SRR26845640 | SRX22541146 | SRS19550731 | SRP472251 | PRJNA1040920 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data] | GSE247930 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used f… | parent bioproject:PRJNA1040928 | zebrafish shield 20µM lnamir430 50mM s4u r6 | GSM7903226 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing | zebrafish shield 20µM lnamir430 50mM s4u r6 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection | GSM7903226 | GSM7903226: zebrafish shield 20µM lnamir430 50mM s4u r6; Danio rerio; RNA Seq | GSM7903226 r1 | GSM7903226 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472251 | loader:fastq load.py | shield_LNA430_6.fastq.gz | fastq | 7432626966.0 | 73590366.0 | GSM7903226 r1 | 0:101 | A:2650382519;C:1367541457;G:1415587402;T:1999115588;N:0 | 101 | 2650382519 | 1367541457 | 1415587402 | 1999115588 | 0 | SRX22541146 | SRS19550731 | SRA1751929 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.66888 | 0.17305 | 0.83465 | 0.69037 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28907 | 28907 | SRR26845641 | SRX22541145 | SRS19550730 | SRP472251 | PRJNA1040920 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data] | GSE247930 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used f… | parent bioproject:PRJNA1040928 | zebrafish shield 20µM lnamir430 50mM s4u r5 | GSM7903225 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing | zebrafish shield 20µM lnamir430 50mM s4u r5 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection | GSM7903225 | GSM7903225: zebrafish shield 20µM lnamir430 50mM s4u r5; Danio rerio; RNA Seq | GSM7903225 r1 | GSM7903225 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472251 | loader:fastq load.py | shield_LNA430_5.fastq.gz | fastq | 5517442847.0 | 54628147.0 | GSM7903225 r1 | 0:101 | A:1830971596;C:1020448830;G:1068982055;T:1597040366;N:0 | 101 | 1830971596 | 1020448830 | 1068982055 | 1597040366 | 0 | SRX22541145 | SRS19550730 | SRA1751929 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.7123 | 0.14169 | 0.81785 | 0.61343 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28908 | 28908 | SRR26845642 | SRX22541144 | SRS19550729 | SRP472251 | PRJNA1040920 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data] | GSE247930 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used f… | parent bioproject:PRJNA1040928 | zebrafish shield 20µM lnamir430 50mM s4u r4 | GSM7903224 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing | zebrafish shield 20µM lnamir430 50mM s4u r4 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection | GSM7903224 | GSM7903224: zebrafish shield 20µM lnamir430 50mM s4u r4; Danio rerio; RNA Seq | GSM7903224 r1 | GSM7903224 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472251 | loader:fastq load.py | shield_LNA430_4.fastq.gz | fastq | 7633894514.0 | 75583114.0 | GSM7903224 r1 | 0:101 | A:2522715535;C:1462363691;G:1540381861;T:2108433427;N:0 | 101 | 2522715535 | 1462363691 | 1540381861 | 2108433427 | 0 | SRX22541144 | SRS19550729 | SRA1751929 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.71858 | 0.20656 | 0.83522 | 0.6748 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28909 | 28909 | SRR26845643 | SRX22541143 | SRS19550728 | SRP472251 | PRJNA1040920 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data] | GSE247930 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used f… | parent bioproject:PRJNA1040928 | zebrafish shield 20µM lnamir430 50mM s4u r3 | GSM7903223 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing | zebrafish shield 20µM lnamir430 50mM s4u r3 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection | GSM7903223 | GSM7903223: zebrafish shield 20µM lnamir430 50mM s4u r3; Danio rerio; RNA Seq | GSM7903223 r1 | GSM7903223 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472251 | loader:fastq load.py | shield_LNA430_3.fastq.gz | fastq | 6740922911.0 | 66741811.0 | GSM7903223 r1 | 0:101 | A:2320670868;C:1251436299;G:1316606507;T:1852209237;N:0 | 101 | 2320670868 | 1251436299 | 1316606507 | 1852209237 | 0 | SRX22541143 | SRS19550728 | SRA1751929 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.69597 | 0.18028 | 0.8341 | 0.68324 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28910 | 28910 | SRR26845644 | SRX22541142 | SRS19550727 | SRP472251 | PRJNA1040920 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data] | GSE247930 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used f… | parent bioproject:PRJNA1040928 | zebrafish shield 20µM lnamir430 50mM s4u r2 | GSM7903222 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing | zebrafish shield 20µM lnamir430 50mM s4u r2 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection | GSM7903222 | GSM7903222: zebrafish shield 20µM lnamir430 50mM s4u r2; Danio rerio; RNA Seq | GSM7903222 r1 | GSM7903222 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472251 | loader:fastq load.py | shield_LNA430_2.fastq.gz | fastq | 4965369272.0 | 49162072.0 | GSM7903222 r1 | 0:101 | A:1663212628;C:946084438;G:1026397565;T:1326957174;N:2717467 | 101 | 1663212628 | 946084438 | 1026397565 | 1326957174 | 2717467 | SRX22541142 | SRS19550727 | SRA1751929 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.67731 | 0.17959 | 0.84758 | 0.35494 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28911 | 28911 | SRR26845645 | SRX22541141 | SRS19550724 | SRP472251 | PRJNA1040920 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data] | GSE247930 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used f… | parent bioproject:PRJNA1040928 | zebrafish shield 20µM lnamir430 50mM s4u r1 | GSM7903221 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing | zebrafish shield 20µM lnamir430 50mM s4u r1 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection | GSM7903221 | GSM7903221: zebrafish shield 20µM lnamir430 50mM s4u r1; Danio rerio; RNA Seq | GSM7903221 r1 | GSM7903221 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472251 | loader:fastq load.py | shield_LNA430_1.fastq.gz | fastq | 4180419189.0 | 41390289.0 | GSM7903221 r1 | 0:101 | A:1388136145;C:781877911;G:841117776;T:1166988154;N:2299203 | 101 | 1388136145 | 781877911 | 841117776 | 1166988154 | 2299203 | SRX22541141 | SRS19550724 | SRA1751929 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.7194 | 0.16361 | 0.8326 | 0.36766 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28912 | 28912 | SRR26845646 | SRX22541140 | SRS19550726 | SRP472251 | PRJNA1040920 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data] | GSE247930 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used f… | parent bioproject:PRJNA1040928 | zebrafish shield 20µM lnacontrol 50mM s4u r6 | GSM7903220 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing | zebrafish shield 20µM lnacontrol 50mM s4u r6 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection | GSM7903220 | GSM7903220: zebrafish shield 20µM lnacontrol 50mM s4u r6; Danio rerio; RNA Seq | GSM7903220 r1 | GSM7903220 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472251 | loader:fastq load.py | shield_LNA_Mis_6.fastq.gz | fastq | 3528723355.0 | 34937855.0 | GSM7903220 r1 | 0:101 | A:1169270874;C:664348337;G:701284585;T:993819559;N:0 | 101 | 1169270874 | 664348337 | 701284585 | 993819559 | 0 | SRX22541140 | SRS19550726 | SRA1751929 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.73609 | 0.18234 | 0.82789 | 0.67273 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28913 | 28913 | SRR26845647 | SRX22541139 | SRS19550725 | SRP472251 | PRJNA1040920 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data] | GSE247930 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used f… | parent bioproject:PRJNA1040928 | zebrafish shield 20µM lnacontrol 50mM s4u r5 | GSM7903219 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing | zebrafish shield 20µM lnacontrol 50mM s4u r5 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection | GSM7903219 | GSM7903219: zebrafish shield 20µM lnacontrol 50mM s4u r5; Danio rerio; RNA Seq | GSM7903219 r1 | GSM7903219 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472251 | loader:fastq load.py | shield_LNA_Mis_5.fastq.gz | fastq | 6194543716.0 | 61332116.0 | GSM7903219 r1 | 0:101 | A:2097813326;C:1118975109;G:1172439642;T:1805315639;N:0 | 101 | 2097813326 | 1118975109 | 1172439642 | 1805315639 | 0 | SRX22541139 | SRS19550725 | SRA1751929 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.68662 | 0.14858 | 0.81931 | 0.58494 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28914 | 28914 | SRR26845648 | SRX22541138 | SRS19550721 | SRP472251 | PRJNA1040920 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data] | GSE247930 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used f… | parent bioproject:PRJNA1040928 | zebrafish shield 20µM lnacontrol 50mM s4u r4 | GSM7903218 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing | zebrafish shield 20µM lnacontrol 50mM s4u r4 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection | GSM7903218 | GSM7903218: zebrafish shield 20µM lnacontrol 50mM s4u r4; Danio rerio; RNA Seq | GSM7903218 r1 | GSM7903218 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472251 | loader:fastq load.py | shield_LNA_Mis_4.fastq.gz | fastq | 7267022619.0 | 71950719.0 | GSM7903218 r1 | 0:101 | A:2506840526;C:1345281143;G:1405742068;T:2009158882;N:0 | 101 | 2506840526 | 1345281143 | 1405742068 | 2009158882 | 0 | SRX22541138 | SRS19550721 | SRA1751929 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.66968 | 0.17594 | 0.83151 | 0.65157 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28915 | 28915 | SRR26845649 | SRX22541137 | SRS19550722 | SRP472251 | PRJNA1040920 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data] | GSE247930 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used f… | parent bioproject:PRJNA1040928 | zebrafish shield 20µM lnacontrol 50mM s4u r3 | GSM7903217 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing | zebrafish shield 20µM lnacontrol 50mM s4u r3 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection | GSM7903217 | GSM7903217: zebrafish shield 20µM lnacontrol 50mM s4u r3; Danio rerio; RNA Seq | GSM7903217 r1 | GSM7903217 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472251 | loader:fastq load.py | shield_LNA_Mis_3.fastq.gz | fastq | 5967073536.0 | 59079936.0 | GSM7903217 r1 | 0:101 | A:2104721652;C:1097559356;G:1127515791;T:1637276737;N:0 | 101 | 2104721652 | 1097559356 | 1127515791 | 1637276737 | 0 | SRX22541137 | SRS19550722 | SRA1751929 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.63706 | 0.16097 | 0.83461 | 0.66484 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28916 | 28916 | SRR26845650 | SRX22541136 | SRS19550723 | SRP472251 | PRJNA1040920 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data] | GSE247930 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used f… | parent bioproject:PRJNA1040928 | zebrafish shield 20µM lnacontrol 50mM s4u r2 | GSM7903216 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing | zebrafish shield 20µM lnacontrol 50mM s4u r2 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection | GSM7903216 | GSM7903216: zebrafish shield 20µM lnacontrol 50mM s4u r2; Danio rerio; RNA Seq | GSM7903216 r1 | GSM7903216 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472251 | loader:fastq load.py | shield_LNA_Mis_2.fastq.gz | fastq | 3643975465.0 | 36078965.0 | GSM7903216 r1 | 0:101 | A:1169767894;C:685310134;G:753541931;T:1033295416;N:2060090 | 101 | 1169767894 | 685310134 | 753541931 | 1033295416 | 2060090 | SRX22541136 | SRS19550723 | SRA1751929 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.7292 | 0.18508 | 0.83424 | 0.62718 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28917 | 28917 | SRR26845651 | SRX22541135 | SRS19550720 | SRP472251 | PRJNA1040920 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data] | GSE247930 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used f… | parent bioproject:PRJNA1040928 | zebrafish shield 20µM lnacontrol 50mM s4u r1 | GSM7903215 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing | zebrafish shield 20µM lnacontrol 50mM s4u r1 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection | GSM7903215 | GSM7903215: zebrafish shield 20µM lnacontrol 50mM s4u r1; Danio rerio; RNA Seq | GSM7903215 r1 | GSM7903215 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472251 | loader:fastq load.py | shield_LNA_Mis_1.fastq.gz | fastq | 4881473117.0 | 48331417.0 | GSM7903215 r1 | 0:101 | A:1562562452;C:901372607;G:981986460;T:1432839789;N:2711809 | 101 | 1562562452 | 901372607 | 981986460 | 1432839789 | 2711809 | SRX22541135 | SRS19550720 | SRA1751929 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.72355 | 0.15423 | 0.82262 | 0.58105 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28918 | 28918 | SRR26845652 | SRX22541168 | SRS19550753 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 8hour wt 75mM s4u r3 | GSM7903274 | tissue:Embryos at 8 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 8hour wt 75mM s4u r3 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 8 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:8 hpf of [AB TU]x[TL TLF] | GSM7903274 | GSM7903274: zebrafish 8hour wt 75mM s4u r3; Danio rerio; RNA Seq | GSM7903274 r1 | GSM7903274 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s8h_4.fastq.gz | fastq | 5796273345.0 | 57388845.0 | GSM7903274 r1 | 0:101 | A:1987532805;C:1079193337;G:1164388405;T:1561938100;N:3220698 | 101 | 1987532805 | 1079193337 | 1164388405 | 1561938100 | 3220698 | SRX22541168 | SRS19550753 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.64204 | 0.18985 | 0.84348 | 0.60294 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28919 | 28919 | SRR26845653 | SRX22541167 | SRS19550752 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 8hour wt 75mM s4u r2 | GSM7903273 | tissue:Embryos at 8 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 8hour wt 75mM s4u r2 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 8 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:8 hpf of [AB TU]x[TL TLF] | GSM7903273 | GSM7903273: zebrafish 8hour wt 75mM s4u r2; Danio rerio; RNA Seq | GSM7903273 r1 | GSM7903273 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s8h_2.fastq.gz | fastq | 4897372941.0 | 48488841.0 | GSM7903273 r1 | 0:101 | A:1699755610;C:929418233;G:1005848571;T:1259595469;N:2755058 | 101 | 1699755610 | 929418233 | 1005848571 | 1259595469 | 2755058 | SRX22541167 | SRS19550752 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.62249 | 0.23058 | 0.85782 | 0.62172 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28920 | 28920 | SRR26845654 | SRX22541166 | SRS19550750 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 8hour wt 75mM s4u r1 | GSM7903272 | tissue:Embryos at 8 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 8hour wt 75mM s4u r1 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 8 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:8 hpf of [AB TU]x[TL TLF] | GSM7903272 | GSM7903272: zebrafish 8hour wt 75mM s4u r1; Danio rerio; RNA Seq | GSM7903272 r1 | GSM7903272 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s8h_1.fastq.gz | fastq | 4081964490.0 | 40415490.0 | GSM7903272 r1 | 0:101 | A:1381746632;C:779891737;G:836779689;T:1081260235;N:2286197 | 101 | 1381746632 | 779891737 | 836779689 | 1081260235 | 2286197 | SRX22541166 | SRS19550750 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.63669 | 0.23628 | 0.8578 | 0.61689 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28921 | 28921 | SRR26845655 | SRX22541165 | SRS19550751 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 7hour wt 75mM s4u r3 | GSM7903271 | tissue:Embryos at 7 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 7hour wt 75mM s4u r3 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 7 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:7 hpf of [AB TU]x[TL TLF] | GSM7903271 | GSM7903271: zebrafish 7hour wt 75mM s4u r3; Danio rerio; RNA Seq | GSM7903271 r1 | GSM7903271 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s7h_4.fastq.gz | fastq | 4851172511.0 | 48031411.0 | GSM7903271 r1 | 0:101 | A:1617620537;C:932157064;G:983796569;T:1314884644;N:2713697 | 101 | 1617620537 | 932157064 | 983796569 | 1314884644 | 2713697 | SRX22541165 | SRS19550751 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.63288 | 0.17507 | 0.84122 | 0.6377 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28922 | 28922 | SRR26845656 | SRX22541164 | SRS19550748 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 7hour wt 75mM s4u r2 | GSM7903270 | tissue:Embryos at 7 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 7hour wt 75mM s4u r2 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 7 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:7 hpf of [AB TU]x[TL TLF] | GSM7903270 | GSM7903270: zebrafish 7hour wt 75mM s4u r2; Danio rerio; RNA Seq | GSM7903270 r1 | GSM7903270 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s7h_2.fastq.gz | fastq | 4762466029.0 | 47153129.0 | GSM7903270 r1 | 0:101 | A:1617990526;C:900885384;G:944898805;T:1296064007;N:2627307 | 101 | 1617990526 | 900885384 | 944898805 | 1296064007 | 2627307 | SRX22541164 | SRS19550748 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.64254 | 0.23162 | 0.84504 | 0.62634 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28923 | 28923 | SRR26845657 | SRX22541163 | SRS19550749 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 7hour wt 75mM s4u r1 | GSM7903269 | tissue:Embryos at 7 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 7hour wt 75mM s4u r1 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 7 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:7 hpf of [AB TU]x[TL TLF] | GSM7903269 | GSM7903269: zebrafish 7hour wt 75mM s4u r1; Danio rerio; RNA Seq | GSM7903269 r1 | GSM7903269 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s7h_1.fastq.gz | fastq | 5021159147.0 | 49714447.0 | GSM7903269 r1 | 0:101 | A:1658742605;C:951972011;G:1025355321;T:1382277303;N:2811907 | 101 | 1658742605 | 951972011 | 1025355321 | 1382277303 | 2811907 | SRX22541163 | SRS19550749 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.71548 | 0.24849 | 0.82704 | 0.65095 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28924 | 28924 | SRR26845658 | SRX22541162 | SRS19550747 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 6hour wt 75mM s4u r3 | GSM7903268 | tissue:Embryos at 6 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 6hour wt 75mM s4u r3 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 6 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:6 hpf of [AB TU]x[TL TLF] | GSM7903268 | GSM7903268: zebrafish 6hour wt 75mM s4u r3; Danio rerio; RNA Seq | GSM7903268 r1 | GSM7903268 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s6h_3.fastq.gz | fastq | 4548634990.0 | 45035990.0 | GSM7903268 r1 | 0:101 | A:1519559786;C:870914391;G:937154183;T:1218472088;N:2534542 | 101 | 1519559786 | 870914391 | 937154183 | 1218472088 | 2534542 | SRX22541162 | SRS19550747 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.6699 | 0.26195 | 0.84756 | 0.61557 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28925 | 28925 | SRR26845659 | SRX22541161 | SRS19550746 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 6hour wt 75mM s4u r2 | GSM7903267 | tissue:Embryos at 6 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 6hour wt 75mM s4u r2 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 6 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:6 hpf of [AB TU]x[TL TLF] | GSM7903267 | GSM7903267: zebrafish 6hour wt 75mM s4u r2; Danio rerio; RNA Seq | GSM7903267 r1 | GSM7903267 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s6h_2.fastq.gz | fastq | 5673879525.0 | 56177025.0 | GSM7903267 r1 | 0:101 | A:1889309422;C:1079098000;G:1157406188;T:1544899367;N:3166548 | 101 | 1889309422 | 1079098000 | 1157406188 | 1544899367 | 3166548 | SRX22541161 | SRS19550746 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.6803 | 0.2063 | 0.83078 | 0.64225 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28940 | 28940 | SRR26846105 | SRX22541614 | SRS19551199 | SRP472260 | PRJNA1040930 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data] | GSE247934 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light … | parent bioproject:PRJNA1040928 | pubmed:38504288 | zebrafish 7hours aamanitin 75mM s4u r3 | GSM7903289 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u|geo loc name:missing|collection date:missing | zebrafish 7hours aamanitin 75mM s4u r3 | Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u | GSM7903289 | GSM7903289: zebrafish 7hours aamanitin 75mM s4u r3; Danio rerio; RNA Seq | GSM7903289 r1 | GSM7903289 | 1 | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP472260 | s75mM_s4U_Alpha_AM_3_7.2hpf.fastq | fastq | 2324253052.0 | 30582277.0 | GSM7903289 r1 | 0:76 | A:730230137;C:445929142;G:497720807;T:650150631;N:222335 | 76 | 730230137 | 445929142 | 497720807 | 650150631 | 222335 | SRX22541614 | SRS19551199 | SRA1751942 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.91664 | 0.09242 | 0.85141 | 0.83766 | 76 | B | usable mapping rate | illumina | nextseq | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28941 | 28941 | SRR26846106 | SRX22541613 | SRS19551197 | SRP472260 | PRJNA1040930 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data] | GSE247934 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light … | parent bioproject:PRJNA1040928 | pubmed:38504288 | zebrafish 7hours aamanitin 75mM s4u r2 | GSM7903288 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u|geo loc name:missing|collection date:missing | zebrafish 7hours aamanitin 75mM s4u r2 | Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u | GSM7903288 | GSM7903288: zebrafish 7hours aamanitin 75mM s4u r2; Danio rerio; RNA Seq | GSM7903288 r1 | GSM7903288 | 1 | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP472260 | s75mM_s4U_Alpha_AM_2_7.2hpf.fastq | fastq | 2258390388.0 | 29715663.0 | GSM7903288 r1 | 0:76 | A:730303334;C:433847002;G:477372738;T:616648008;N:219306 | 76 | 730303334 | 433847002 | 477372738 | 616648008 | 219306 | SRX22541613 | SRS19551197 | SRA1751942 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.90032 | 0.09917 | 0.85456 | 0.82527 | 76 | B | usable mapping rate | illumina | nextseq | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28942 | 28942 | SRR26846107 | SRX22541612 | SRS19551198 | SRP472260 | PRJNA1040930 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data] | GSE247934 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light … | parent bioproject:PRJNA1040928 | pubmed:38504288 | zebrafish 7hours aamanitin 75mM s4u r1 | GSM7903287 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u|geo loc name:missing|collection date:missing | zebrafish 7hours aamanitin 75mM s4u r1 | Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u | GSM7903287 | GSM7903287: zebrafish 7hours aamanitin 75mM s4u r1; Danio rerio; RNA Seq | GSM7903287 r1 | GSM7903287 | 1 | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP472260 | s75mM_s4U_Alpha_AM_1_7.2hpf.fastq | fastq | 2448732008.0 | 32220158.0 | GSM7903287 r1 | 0:76 | A:762363800;C:470381296;G:528015897;T:687735325;N:235690 | 76 | 762363800 | 470381296 | 528015897 | 687735325 | 235690 | SRX22541612 | SRS19551198 | SRA1751942 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.92405 | 0.09134 | 0.85086 | 0.83762 | 76 | B | usable mapping rate | illumina | nextseq | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28943 | 28943 | SRR26846108 | SRX22541611 | SRS19551195 | SRP472260 | PRJNA1040930 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data] | GSE247934 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light … | parent bioproject:PRJNA1040928 | pubmed:38504288 | zebrafish 7hours wt 75mM s4u r3 | GSM7903286 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u|geo loc name:missing|collection date:missing | zebrafish 7hours wt 75mM s4u r3 | Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u | GSM7903286 | GSM7903286: zebrafish 7hours wt 75mM s4u r3; Danio rerio; RNA Seq | GSM7903286 r1 | GSM7903286 | 1 | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP472260 | s75mM_s4U_3_shield.fastq | fastq | 1972068596.0 | 25948271.0 | GSM7903286 r1 | 0:76 | A:624727984;C:405741582;G:403474252;T:537931982;N:192796 | 76 | 624727984 | 405741582 | 403474252 | 537931982 | 192796 | SRX22541611 | SRS19551195 | SRA1751942 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.69551 | 0.10734 | 0.85922 | 0.81475 | 76 | B | usable mapping rate | illumina | nextseq | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28944 | 28944 | SRR26846109 | SRX22541610 | SRS19551196 | SRP472260 | PRJNA1040930 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data] | GSE247934 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light … | parent bioproject:PRJNA1040928 | pubmed:38504288 | zebrafish 7hours wt 75mM s4u r2 | GSM7903285 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u|geo loc name:missing|collection date:missing | zebrafish 7hours wt 75mM s4u r2 | Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u | GSM7903285 | GSM7903285: zebrafish 7hours wt 75mM s4u r2; Danio rerio; RNA Seq | GSM7903285 r1 | GSM7903285 | 1 | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP472260 | s75mM_s4U_2_shield.fastq | fastq | 2516506300.0 | 33111925.0 | GSM7903285 r1 | 0:76 | A:831930759;C:501602051;G:506951200;T:675776222;N:246068 | 76 | 831930759 | 501602051 | 506951200 | 675776222 | 246068 | SRX22541610 | SRS19551196 | SRA1751942 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.71823 | 0.11734 | 0.85626 | 0.82109 | 76 | B | usable mapping rate | illumina | nextseq | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28945 | 28945 | SRR26846110 | SRX22541609 | SRS19551194 | SRP472260 | PRJNA1040930 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data] | GSE247934 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light … | parent bioproject:PRJNA1040928 | pubmed:38504288 | zebrafish 7hours wt 75mM s4u r1 | GSM7903284 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u|geo loc name:missing|collection date:missing | zebrafish 7hours wt 75mM s4u r1 | Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u | GSM7903284 | GSM7903284: zebrafish 7hours wt 75mM s4u r1; Danio rerio; RNA Seq | GSM7903284 r1 | GSM7903284 | 1 | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP472260 | s75mM_s4U_1_shield.fastq | fastq | 2549071616.0 | 33540416.0 | GSM7903284 r1 | 0:76 | A:818805455;C:519667619;G:516651535;T:693699280;N:247727 | 76 | 818805455 | 519667619 | 516651535 | 693699280 | 247727 | SRX22541609 | SRS19551194 | SRA1751942 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.6955 | 0.10765 | 0.86076 | 0.8198 | 76 | B | usable mapping rate | illumina | nextseq | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28946 | 28946 | SRR26846111 | SRX22541608 | SRS19551193 | SRP472260 | PRJNA1040930 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data] | GSE247934 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light … | parent bioproject:PRJNA1040928 | pubmed:38504288 | zebrafish 7hours wt 50mM s4u r3 | GSM7903283 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u|geo loc name:missing|collection date:missing | zebrafish 7hours wt 50mM s4u r3 | Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u | GSM7903283 | GSM7903283: zebrafish 7hours wt 50mM s4u r3; Danio rerio; RNA Seq | GSM7903283 r1 | GSM7903283 | 1 | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP472260 | s50mM_s4U_3_shield.fastq | fastq | 2618751456.0 | 34457256.0 | GSM7903283 r1 | 0:76 | A:825375324;C:516006422;G:537742430;T:739370895;N:256385 | 76 | 825375324 | 516006422 | 537742430 | 739370895 | 256385 | SRX22541608 | SRS19551193 | SRA1751942 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.79157 | 0.12783 | 0.83591 | 0.7815 | 76 | B | usable mapping rate | illumina | nextseq | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28947 | 28947 | SRR26846112 | SRX22541607 | SRS19551192 | SRP472260 | PRJNA1040930 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data] | GSE247934 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light … | parent bioproject:PRJNA1040928 | pubmed:38504288 | zebrafish 7hours wt 50mM s4u r2 | GSM7903282 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u|geo loc name:missing|collection date:missing | zebrafish 7hours wt 50mM s4u r2 | Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u | GSM7903282 | GSM7903282: zebrafish 7hours wt 50mM s4u r2; Danio rerio; RNA Seq | GSM7903282 r1 | GSM7903282 | 1 | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP472260 | s50mM_s4U_2_shield.fastq | fastq | 2728810932.0 | 35905407.0 | GSM7903282 r1 | 0:76 | A:862839647;C:533956089;G:555216318;T:776529555;N:269323 | 76 | 862839647 | 533956089 | 555216318 | 776529555 | 269323 | SRX22541607 | SRS19551192 | SRA1751942 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.78249 | 0.13163 | 0.83558 | 0.7725 | 76 | B | usable mapping rate | illumina | nextseq | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28948 | 28948 | SRR26846113 | SRX22541606 | SRS19551191 | SRP472260 | PRJNA1040930 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data] | GSE247934 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light … | parent bioproject:PRJNA1040928 | pubmed:38504288 | zebrafish 7hours wt 50mM s4u r1 | GSM7903281 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u|geo loc name:missing|collection date:missing | zebrafish 7hours wt 50mM s4u r1 | Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u | GSM7903281 | GSM7903281: zebrafish 7hours wt 50mM s4u r1; Danio rerio; RNA Seq | GSM7903281 r1 | GSM7903281 | 1 | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP472260 | s50mM_s4U_1_shield.fastq | fastq | 2799942904.0 | 36841354.0 | GSM7903281 r1 | 0:76 | A:896568389;C:543434921;G:571731242;T:787934334;N:274018 | 76 | 896568389 | 543434921 | 571731242 | 787934334 | 274018 | SRX22541606 | SRS19551191 | SRA1751942 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.77902 | 0.1234 | 0.83976 | 0.77809 | 76 | B | usable mapping rate | illumina | nextseq | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28949 | 28949 | SRR26846114 | SRX22541605 | SRS19551190 | SRP472260 | PRJNA1040930 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data] | GSE247934 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light … | parent bioproject:PRJNA1040928 | pubmed:38504288 | zebrafish 7hours wt 25mM s4u r3 | GSM7903280 | source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u|geo loc name:missing|collection date:missing | zebrafish 7hours wt 25mM s4u r3 | Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at shield stage | Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u | GSM7903280 | GSM7903280: zebrafish 7hours wt 25mM s4u r3; Danio rerio; RNA Seq | GSM7903280 r1 | GSM7903280 | 1 | Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP472260 | s25mM_s4U_3_shield.fastq | fastq | 2472530952.0 | 32533302.0 | GSM7903280 r1 | 0:76 | A:792442838;C:471795434;G:509242670;T:698813712;N:236298 | 76 | 792442838 | 471795434 | 509242670 | 698813712 | 236298 | SRX22541605 | SRS19551190 | SRA1751942 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.84425 | 0.13847 | 0.83569 | 0.77265 | 76 | B | usable mapping rate | illumina | nextseq | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Gastrula | Embryo | Embryo Imprecise | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;