run_metadata
287 rows where devstage_curation = "Cleavage" and tissue_curation = "Embryo Imprecise"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 8055 | 8055 | ERR022484 | ERX008924 | ERS017427 | ERP000400 | PRJEB2333 | Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer | E-MTAB-434 | Other | E MTAB 434:ZF 2cells | SAMEA898400 | Wellcome Sanger Institute | Alias:E MTAB 434:ZF 2cells|Broker name:ArrayExpress|Description:Protocols: Zebrafish embyos or tissues were collected from a Tuebingen strain incross and grown at 28 C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were resuspended RNase free 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments. Total RNA was made into an RNAseq Illumina library following the manufacturer's protocol including a DNase treatment between to 2 rounds of polyA pull down. The libraries have fragment size of 250 to 300 bp.|DevelopmentalStage:embryo|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2011 03 10T17:55:05Z|INSDC last update:2018 03 08T15:25:14Z|INSDC status:public|SRA accession:ERS017427|Sample Name:ERS017427|Sex:mixed|StrainOrLine:Tuebingen|Title:ZF 2cells | Illumina Genome Analyzer II paired end sequencing; Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer | E MTAB 434:sequencing of Zebrafish embryo 2cells | RNA from Zebrafish embryo 2cells | Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer | Zebrafish embyos or tissues were collected from a Tuebingen strain incross and grown at 28 C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were resuspended RNase free 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments. Total RNA was made into an RNAseq Illumina library following the manufacturer's protocol including a DNase treatment between to 2 rounds of polyA pull down. The libraries have fragment size of 250 to 300 bp. | Experimental Factor: DEVELPOMENTAL STAGE:embryo|Experimental Factor: ORGANISM PART:cell | FL-cDNA | TRANSCRIPTOMIC | unspecified | PAIRED | ILLUMINA | Illumina Genome Analyzer II | ERP000400 | Illumina Genome Analyzer II paired end sequencing; Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer | ENA FIRST PUBLIC:2011 03 10|ENA LAST UPDATE:2018 11 16 | 4946_5.srf | srf | 3947547008.0 | 25970704.0 | E MTAB 434:4946 5.srf | 0:76 1:76 | A:1069302461;C:914233601;G:902631356;T:1055986090;N:5393500 | 76 | 76 | 1069302461 | 914233601 | 902631356 | 1055986090 | 5393500 | ERX008924 | ERS017427 | ERA015179 | SC|Wellcome Trust Sanger Institute | SC|Wellcome Trust Sanger Institute | 2 | 0.93356 | 0.93346 | 0.03988 | 0.04022 | 0.79135 | 0.79198 | 0.48864 | 0.48464 | 76 | 76 | B | B | biological fallback assumption | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United Kingdom | 2011-03-10 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 8090 | 8090 | ERR034125 | ERX012651 | ERS032266 | ERP000635 | PRJEB2512 | The Zebrafish transcriptome during early development | KI-BN-JKE-DRERIO-RNASEQ-2011 | Transcriptome Analysis | Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions. | RNA extracted from zebrafish embryo at 16 cell stage | zebrafish embryo 16 cell | SAMEA791631 | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791631|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 16cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 16cell|sex:mixed|strain:Tuebingen | Transcriptome profiling of early zebrafish development | KI BN JKE DRERIO RNASEQ 2011 16cell | JKE Drerio rna seq | Transcriptome profiling of 16 cell stage of zebrafish embryos. | Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems. | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ABI_SOLID | AB SOLiD System 3.0 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | ERP000635 | AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development | ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16 | KI-BN-JKE-DRERIO-RNASEQ-2011-16cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-16cell_QV.qual.gz | SOLiD_native SOLiD_native | 4256756500.0 | 85135130.0 | KI BN JKE DRERIO RNASEQ 2011 16cell | 0:50 | 50 | ERX012651 | ERS032266 | ERA029959 | KI-BN|Department of Biosciences and Nutrition | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | 1 | 0.57946 | 0.08115 | 0.91896 | 0.72164 | 50 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | unknown | unknown | Sweden | 2011-06-09 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 28560 | 28560 | SRR26395034 | SRX22100899 | SRS19166025 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep8 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 8|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate8 | DR 035 | DR 035 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-8_1.fq.gz C64-8_2.fq.gz | fastq fastq | 13755975120.0 | 50948056.0 | C64 8 1.fq.gz | 0:135 1:135 | A:3658420874;C:3226727105;G:3239474262;T:3628930832;N:2422047 | 135 | 135 | 3658420874 | 3226727105 | 3239474262 | 3628930832 | 2422047 | SRX22100899 | SRS19166025 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.92463 | 0.92386 | 0.0253 | 0.02389 | 0.77441 | 0.77851 | 0.48196 | 0.47927 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28561 | 28561 | SRR26395035 | SRX22100898 | SRS19166024 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep7 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 7|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate7 | DR 034 | DR 034 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-7_1.fq.gz C64-7_2.fq.gz | fastq fastq | 14250954780.0 | 52781314.0 | C64 7 1.fq.gz | 0:135 1:135 | A:3810945650;C:3320623800;G:3339892194;T:3776960886;N:2532250 | 135 | 135 | 3810945650 | 3320623800 | 3339892194 | 3776960886 | 2532250 | SRX22100898 | SRS19166024 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.93734 | 0.93685 | 0.02705 | 0.02576 | 0.77553 | 0.7791 | 0.47481 | 0.47745 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28562 | 28562 | SRR26395036 | SRX22100897 | SRS19166023 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep6 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 6|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate6 | DR 033 | DR 033 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-6_1.fq.gz C64-6_2.fq.gz | fastq fastq | 14251193190.0 | 52782197.0 | C64 6 1.fq.gz | 0:135 1:135 | A:3801408063;C:3332053069;G:3345233238;T:3769986735;N:2512085 | 135 | 135 | 3801408063 | 3332053069 | 3345233238 | 3769986735 | 2512085 | SRX22100897 | SRS19166023 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.94348 | 0.94342 | 0.02571 | 0.02414 | 0.77112 | 0.77492 | 0.48218 | 0.4777 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28563 | 28563 | SRR26395037 | SRX22100896 | SRS19166022 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep5 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 5|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate5 | DR 032 | DR 032 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-5_1.fq.gz C64-5_2.fq.gz | fastq fastq | 15142948650.0 | 56084995.0 | C64 5 1.fq.gz | 0:135 1:135 | A:4031434744;C:3549307228;G:3562636129;T:3996868396;N:2702153 | 135 | 135 | 4031434744 | 3549307228 | 3562636129 | 3996868396 | 2702153 | SRX22100896 | SRS19166022 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.93753 | 0.93663 | 0.02519 | 0.024 | 0.77301 | 0.77674 | 0.47421 | 0.46951 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28564 | 28564 | SRR26395038 | SRX22100895 | SRS19166021 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep4 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 4|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate4 | DR 031 | DR 031 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-4_1.fq.gz C64-4_2.fq.gz | fastq fastq | 14488466220.0 | 53660986.0 | C64 4 1.fq.gz | 0:135 1:135 | A:3863267905;C:3389148218;G:3402037749;T:3831469669;N:2542679 | 135 | 135 | 3863267905 | 3389148218 | 3402037749 | 3831469669 | 2542679 | SRX22100895 | SRS19166021 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.93879 | 0.93825 | 0.02613 | 0.02437 | 0.77212 | 0.77577 | 0.47796 | 0.47196 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28566 | 28566 | SRR26395040 | SRX22100893 | SRS19166019 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep3 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 3|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate3 | DR 030 | DR 030 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-3_1.fq.gz C64-3_2.fq.gz | fastq fastq | 16017940620.0 | 59325706.0 | C64 3 1.fq.gz | 0:135 1:135 | A:4273558549;C:3744205640;G:3760255830;T:4237074764;N:2845837 | 135 | 135 | 4273558549 | 3744205640 | 3760255830 | 4237074764 | 2845837 | SRX22100893 | SRS19166019 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.93688 | 0.9383 | 0.02702 | 0.02595 | 0.77433 | 0.7767 | 0.47319 | 0.47413 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28567 | 28567 | SRR26395041 | SRX22100892 | SRS19166018 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep2 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 2|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate2 | DR 029 | DR 029 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-2_1.fq.gz C64-2_2.fq.gz | fastq fastq | 16732836630.0 | 61973469.0 | C64 2 1.fq.gz | 0:135 1:135 | A:4451249064;C:3924735460;G:3940154978;T:4413679398;N:3017730 | 135 | 135 | 4451249064 | 3924735460 | 3940154978 | 4413679398 | 3017730 | SRX22100892 | SRS19166018 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.94302 | 0.94257 | 0.02459 | 0.02333 | 0.77248 | 0.77479 | 0.47902 | 0.47678 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28568 | 28568 | SRR26395042 | SRX22100891 | SRS19166017 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep1 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 1|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate1 | DR 028 | DR 028 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-1_1.fq.gz C64-1_2.fq.gz | fastq fastq | 16459047450.0 | 60959435.0 | C64 1 1.fq.gz | 0:135 1:135 | A:4391773658;C:3847087464;G:3866793612;T:4350489494;N:2903222 | 135 | 135 | 4391773658 | 3847087464 | 3866793612 | 4350489494 | 2903222 | SRX22100891 | SRS19166017 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.94676 | 0.94707 | 0.02568 | 0.0244 | 0.77236 | 0.77593 | 0.48374 | 0.47691 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28576 | 28576 | SRR26395050 | SRX22100883 | SRS19166009 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell Iso seq | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 3|BioSampleModel:Model organism or animal | PacBio Iso seq of zebrafish: 64 cell | DR 003 | DR 003 | Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | PACBIO_SMRT | Sequel | SRP466518 | cell64_1.ccs.fq.gz cell64_2.ccs.fq.gz | fastq fastq | 2829660788.0 | 1238867.0 | cell64 1.ccs.fq.gz | 0:2284.07 | A:765802910;C:646754322;G:668768985;T:748334571;N:0 | 2284 | 765802910 | 646754322 | 668768985 | 748334571 | 0 | SRX22100883 | SRS19166009 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 1 | 0.37504 | 0.00108 | 0.91149 | 0.48939 | 1913 | T | long read | pacbio | pacbio_modern | full_length | poly_a | unknown | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 28935 | 28935 | SRR26845669 | SRX22541151 | SRS19550737 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 2hour wt 75mM s4u r2 | GSM7903257 | tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 2hour wt 75mM s4u r2 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 2 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF] | GSM7903257 | GSM7903257: zebrafish 2hour wt 75mM s4u r2; Danio rerio; RNA Seq | GSM7903257 r1 | GSM7903257 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s2h_2.fastq.gz | fastq | 4440596805.0 | 43966305.0 | GSM7903257 r1 | 0:101 | A:1543708731;C:806593065;G:905733733;T:1182095254;N:2466022 | 101 | 1543708731 | 806593065 | 905733733 | 1182095254 | 2466022 | SRX22541151 | SRS19550737 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.63778 | 0.15677 | 0.82676 | 0.61166 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28936 | 28936 | SRR26845670 | SRX22541150 | SRS19550735 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 2hour wt 75mM s4u r1 | GSM7903256 | tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 2hour wt 75mM s4u r1 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 2 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF] | GSM7903256 | GSM7903256: zebrafish 2hour wt 75mM s4u r1; Danio rerio; RNA Seq | GSM7903256 r1 | GSM7903256 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s2h_1.fastq.gz | fastq | 4689849655.0 | 46434155.0 | GSM7903256 r1 | 0:101 | A:1611038201;C:846984275;G:953714532;T:1275424861;N:2687786 | 101 | 1611038201 | 846984275 | 953714532 | 1275424861 | 2687786 | SRX22541150 | SRS19550735 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.67301 | 0.15612 | 0.82171 | 0.63462 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28937 | 28937 | SRR26845671 | SRX22541149 | SRS19550733 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 1hour wt 75mM s4u r3 | GSM7903255 | tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 1hour wt 75mM s4u r3 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 1 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF] | GSM7903255 | GSM7903255: zebrafish 1hour wt 75mM s4u r3; Danio rerio; RNA Seq | GSM7903255 r1 | GSM7903255 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s1h_3.fastq.gz | fastq | 5540992108.0 | 54861308.0 | GSM7903255 r1 | 0:101 | A:1856189531;C:1011042624;G:1124613529;T:1546055477;N:3090947 | 101 | 1856189531 | 1011042624 | 1124613529 | 1546055477 | 3090947 | SRX22541149 | SRS19550733 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.72187 | 0.16436 | 0.82416 | 0.64431 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28938 | 28938 | SRR26845672 | SRX22541148 | SRS19550734 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 1hour wt 75mM s4u r2 | GSM7903254 | tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 1hour wt 75mM s4u r2 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 1 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF] | GSM7903254 | GSM7903254: zebrafish 1hour wt 75mM s4u r2; Danio rerio; RNA Seq | GSM7903254 r1 | GSM7903254 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s1h_2.fastq.gz | fastq | 4572239397.0 | 45269697.0 | GSM7903254 r1 | 0:101 | A:1530268631;C:831534079;G:915378596;T:1292534173;N:2523918 | 101 | 1530268631 | 831534079 | 915378596 | 1292534173 | 2523918 | SRX22541148 | SRS19550734 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.72394 | 0.15187 | 0.81753 | 0.63236 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28939 | 28939 | SRR26845673 | SRX22541147 | SRS19550732 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 1hour wt 75mM s4u r1 | GSM7903253 | tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 1hour wt 75mM s4u r1 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 1 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF] | GSM7903253 | GSM7903253: zebrafish 1hour wt 75mM s4u r1; Danio rerio; RNA Seq | GSM7903253 r1 | GSM7903253 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s1h_1.fastq.gz | fastq | 4271986597.0 | 42296897.0 | GSM7903253 r1 | 0:101 | A:1447221671;C:787487923;G:887526673;T:1147409594;N:2340736 | 101 | 1447221671 | 787487923 | 887526673 | 1147409594 | 2340736 | SRX22541147 | SRS19550732 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.68805 | 0.18469 | 0.83175 | 0.62945 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 36258 | 36258 | SRR062659 | SRX025027 | SRS085806 | SRP003165 | PRJNA127881 | High throughput sequencing of mRNA from oocyte 1 cell 16/32 cells 128/256 cells 3.5hpf and 5.3hpf zebrafish embryos Wild type; AB line | GSE22830 | Transcriptome Analysis | mRNA seq based approach to determine the transcriptome dynamics during early development To study the mechanisms regulating this developmental event in zebrafish we applied RNA deep sequencing technology and generated comprehensive transcriptome profiles of 6 developmental stages from oocyte to early gastrulation. We determined the expression levels of maternal and zygotic transcripts and clustered them based on expression pattern. We identified a large number of novel transcribed regions in un annotated regions of the genome as well as splice variants with an estimated frequency of 40 75% during early zebrafish embryogenesis. Our data constitute a useful resource for developmental studies gene discovery and genome annotation. Overall design: RNA was extracted from pooled embryos of desired stages and one RNA seq library was generated for each sample. Totally 6 stages were selected: Maternal 1cell 16/32 cells 128/256 cells 3.5hpf and 5.3hpf | pubmed:21555364;pubmed:24586560;pubmed:23676078 | 16/32 cells | GSM564429 | tissue:developing embryos|background:AB; wild type|developmental stage:mixure of 16/32 cell embryos | 16/32 cells | ABI pipeline BioScope v1.0.1 Data analysis: The SOLiD generated RNA Seq reads was in 50bp length and an initial filtering process was taken to remove any non desirable contamination sequences such as rRNA tRNA and repeats etc. A seed and extension mapping approach was developed to map the 50bp reads into reference genome zv7 and also into the respective zv7 refGene annotation separately. During mapping of the reads to the refGene annotation a splice junction database fasta file is generated to which the reads are mapped to. This database contains known and putative junction sequences created by taking 46bp from the joining ends of adjacent and non adjacent exons for each gene and putting them together simulating the genomic sequences of known and putative junctions respectively. The first 25bp of the 50bp read was used as the seed for alignment for each read. When an alignment cannot be found using these 25bp seed the seed window is shifted and the next 25bp seed is taken from the 21st to the 45th base of the read. An extension step follows when the seed is able to map and a score generated for each extended base to determine best alignment. A merging step is performed on the genome mapping and splice junction mapping to determine a set of alignments for each read from which a unique alignment is found based on the score generated for these alignments. Mapping parameters: Mapping was done using Applied Biosystems’ SOLiD BioScope alignment for whole transcriptome analysis pipeline. Two mismatches were allowed in the 25bp color space seed sequence with extension alignment performed to find the full mapping location. A score is computed for each mapping location and any location that scored <22 were filtered. Generation of gff and bedgraph files: GFF files were produced by parsing the output BAM format and extracted for unique alignments with score >22. The bedgraph files are then produced with the resulting gff file. | developing embryos | Embryos were frozen at the desired developmental stages and RNAs was extracted for sequencing. | mRNA seq was performed by Mission Biotech Taiwan. SOLiD sequencing libraries were prepared using the Whole Transcriptome Library Preparation for SOLiD™ Sequencing kit ABI according to manufacturer’s instructions. About 200 280 µg of total RNAs were used as starting materials which were subjected to polyA selection using Applied Biosystems PolyA Purist Kit AM1916 fragmentation and library construction using distinct adapters for each library SOLiD Barcoding. From each library equal volumes were pooled together and sequenced in SOLiD3 ABI platform generating 50bp tags. | Zebrafish embryos AB background collected just post fertilization were reared and harvested at desired time points. Unfertilized oocytes were collected by squeezing the abdomen of spawning females. Harvested embryos were snap frozen in liquid nitrogen and stored in −80°C. Total RNA was extracted from whole embryos using Trizol Invitrogen according to manufacturer’s instructions. RNA concentrations were determined using NanoDrop 2000 Thermo Scientific. Integrity of RNA samples were determined using Agilent RNA 6000 Nano chip and size separated using Agilent 2100 Bioanalyzer. Total RNA obtained per 100 embryos at each developmental stage was calculated for data normalization purposes. | background:AB; wild type|developmental stage:mixure of 16/32 cell embryos | GSM564429 | GSM564429: 16/32 cells | GSM564429: 16/32 cells | GSM564429: 16/32 cells | 1 | GEO Accession:GSM564429 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD System 3.0 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP003165 | 1792238300.0 | 35844766.0 | GSM564429 1 | 0:50 | 50 | SRX025027 | SRS085806 | SRA022850 | GEO | Computational and Systems Biology, Genome Institute of Singapore | 1 | 0.6993 | 0.04019 | 0.83763 | 0.50284 | 50 | B | usable mapping rate | legacy | early | full_length | poly_a | unknown | bulk | unknown | unknown | Singapore | 2010-07-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||
| 36355 | 36355 | SRR372788 | SRX107384 | SRS280824 | SRP009426 | PRJNA154389 | Comprehensive identification of long non coding RNAs expressed during zebrafish embryogenesis [RNA seq] | GSE32898 | Transcriptome Analysis | Long non coding RNAs lncRNAs comprise a diverse class of transcripts that structurally resemble mRNAs but do not encode proteins. Recent genome wide studies in human and mouse have annotated lncRNAs expressed in cell lines and adult tissues but a systematic analysis of lncRNAs expressed during vertebrate embryogenesis has been elusive. To identify lncRNAs with potential functions in vertebrate embryogenesis we performed a time series of RNA Seq experiments at eight stages during early zebrafish development. We reconstructed 56 535 high confidence transcripts in 28 912 loci recovering the vast majority of expressed RefSeq transcripts while identifying thousands of novel isoforms and expressed loci. We defined a stringent set of 1 133 non coding multi exonic transcripts expressed during embryogenesis. These include long intergenic ncRNAs lincRNAs intronic overlapping lncRNAs exonic antisense overlapping lncRNAs and precursors for small RNAs sRNAs. Zebrafish lncRNAs share many of the characteristics of their mammalian counterparts: relatively short length low exon number low expression and conservation levels comparable to introns. Subsets of lncRNAs carry chromatin signatures characteristic of genes with developmental functions. The temporal expression profile of lncRNAs revealed two novel properties: lncRNAs are expressed in narrower time windows than protein coding genes and are specifically enriched in early stage embryos. In addition several lncRNAs show tissue specific expression and distinct subcellular localization patterns. Integrative computational analyses associated individual lncRNAs with specific pathways and functions ranging from cell cycle regulation to morphogenesis. Our study provides the first comprehensive identification of lncRNAs in a vertebrate embryo and forms the foundation for future genetic genomic and evolutionary studies. Overall design: RNA Seq for 8 zebrafish developmental stages 2 lanes for each stage 3 for shield. | parent bioproject:PRJNA146503 | pubmed:22110045;pubmed:23698349 | 2 4cell 2 | GSM831504 | source name:2 4cell RNA Seq|tissue:embryo|development stage:embryogenesis: 2 4 cell stage|stdev for insert size:1301.769583 | 2 4cell 2 | Th summary result files of he developmental transcriptome of all samples are available as supplementary information with the paper. | 2 4cell RNA Seq | Total RNA was isolated using the standard Trizol Invitrogen protocol. Two rounds of PolyA+ RNA purification were performed for each sample using the PolyAPuristTM MAG kit Ambion. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bioanalyzer. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed in Levin et al. 2010. | Zebrafish embryos were dechorionated at the 1 cell stage followed by incubation at 28C. | tissue:embryo|developmental stage:embryogenesis: 2 4 cell stage|average insert size fragment length:673.36217|stdev for insert size:1301.769583 | GSM831504 | GSM831504: 2 4cell 2 | GSM831504: 2 4cell 2 | GSM831504: 2 4cell 2 | 1 | GEO Accession:GSM831504 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>152</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>77</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP009426 | 9256767320.0 | 60899785.0 | GSM831504 1 | 0:76 1:76 | A:2412461359;C:2170215834;G:2234888308;T:2438303823;N:897996 | 76 | 76 | 2412461359 | 2170215834 | 2234888308 | 2438303823 | 897996 | SRX107384 | SRS280824 | SRA048184 | GEO | Sandelin, Dep. of Biology, University of Copenhagen | 2 | 0.93703 | 0.94416 | 0.03525 | 0.03149 | 0.80129 | 0.79188 | 0.49723 | 0.49656 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Denmark | 2011-11-11 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||
| 36356 | 36356 | SRR372787 | SRX107383 | SRS280823 | SRP009426 | PRJNA154389 | Comprehensive identification of long non coding RNAs expressed during zebrafish embryogenesis [RNA seq] | GSE32898 | Transcriptome Analysis | Long non coding RNAs lncRNAs comprise a diverse class of transcripts that structurally resemble mRNAs but do not encode proteins. Recent genome wide studies in human and mouse have annotated lncRNAs expressed in cell lines and adult tissues but a systematic analysis of lncRNAs expressed during vertebrate embryogenesis has been elusive. To identify lncRNAs with potential functions in vertebrate embryogenesis we performed a time series of RNA Seq experiments at eight stages during early zebrafish development. We reconstructed 56 535 high confidence transcripts in 28 912 loci recovering the vast majority of expressed RefSeq transcripts while identifying thousands of novel isoforms and expressed loci. We defined a stringent set of 1 133 non coding multi exonic transcripts expressed during embryogenesis. These include long intergenic ncRNAs lincRNAs intronic overlapping lncRNAs exonic antisense overlapping lncRNAs and precursors for small RNAs sRNAs. Zebrafish lncRNAs share many of the characteristics of their mammalian counterparts: relatively short length low exon number low expression and conservation levels comparable to introns. Subsets of lncRNAs carry chromatin signatures characteristic of genes with developmental functions. The temporal expression profile of lncRNAs revealed two novel properties: lncRNAs are expressed in narrower time windows than protein coding genes and are specifically enriched in early stage embryos. In addition several lncRNAs show tissue specific expression and distinct subcellular localization patterns. Integrative computational analyses associated individual lncRNAs with specific pathways and functions ranging from cell cycle regulation to morphogenesis. Our study provides the first comprehensive identification of lncRNAs in a vertebrate embryo and forms the foundation for future genetic genomic and evolutionary studies. Overall design: RNA Seq for 8 zebrafish developmental stages 2 lanes for each stage 3 for shield. | parent bioproject:PRJNA146503 | pubmed:22110045;pubmed:23698349 | 2 4cell 1 | GSM831503 | source name:2 4cell RNA Seq|tissue:embryo|developmental stage:embryogenesis: 2 4 cell stage|stdev for insert size:1336.039246 | 2 4cell 1 | Th summary result files of he developmental transcriptome of all samples are available as supplementary information with the paper. | 2 4cell RNA Seq | Total RNA was isolated using the standard Trizol Invitrogen protocol. Two rounds of PolyA+ RNA purification were performed for each sample using the PolyAPuristTM MAG kit Ambion. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bioanalyzer. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed in Levin et al. 2010. | Zebrafish embryos were dechorionated at the 1 cell stage followed by incubation at 28C. | tissue:embryo|developmental stage:embryogenesis: 2 4 cell stage|average insert size fragment length:710.502832|stdev for insert size:1336.039246 | GSM831503 | GSM831503: 2 4cell 1 | GSM831503: 2 4cell 1 | GSM831503: 2 4cell 1 | 1 | GEO Accession:GSM831503 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>152</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>77</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP009426 | 6454083552.0 | 42461076.0 | GSM831503 1 | 0:76 1:76 | A:1659789336;C:1511027834;G:1564153032;T:1683582419;N:35530931 | 76 | 76 | 1659789336 | 1511027834 | 1564153032 | 1683582419 | 35530931 | SRX107383 | SRS280823 | SRA048184 | GEO | Sandelin, Dep. of Biology, University of Copenhagen | 2 | 0.82115 | 0.94097 | 0.02927 | 0.02775 | 0.84362 | 0.79864 | 0.49872 | 0.49708 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Denmark | 2011-11-11 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||
| 36408 | 36408 | SRR546817 | SRX180747 | SRS358988 | SRP013950 | PRJNA169500 | Danio rerio embryonic promoterome | PRJNA169500 | Transcriptome Analysis | Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development. | pubmed:24531765 | Zebrafish wild type AB strain embryo 2 cells stage | D. rerio 2 cells embryo | D. rerio 2 cells embryo | RNAseq D. rerio 2 cells embryo | RNAseq D. rerio 2 cells embryo | 1 | 1 | RNA-Seq | TRANSCRIPTOMIC | unspecified | PAIRED | ILLUMINA | Illumina Genome Analyzer IIx | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>152</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>77</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP013950 | 2799828144.0 | 18419922.0 | RNAseq D. rerio 2 cells embryo | 0:76 1:76 | A:678251421;C:711410510;G:729905459;T:677312772;N:2947982 | 76 | 76 | 678251421 | 711410510 | 729905459 | 677312772 | 2947982 | SRX180747 | SRS358988 | SRA055273 | University of Bergen | ZEPROME consortium | 2 | 0.9498 | 0.94704 | 0.02363 | 0.02442 | 0.7988 | 0.80221 | 0.48657 | 0.49361 | 76 | 76 | B | B | biological fallback assumption | illumina | early_illumina | unknown | unknown | unknown | bulk | unknown | unknown | Unknown | 2015-07-22 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 36422 | 36422 | SRR516548 | SRX156334 | SRS347202 | SRP013950 | PRJNA169500 | Danio rerio embryonic promoterome | PRJNA169500 | Transcriptome Analysis | Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development. | pubmed:24531765 | Zebrafish wild type AB strain embryo 64 cells stage | D. rerio 64 cells embryo | D. rerio 64 cells embryo | CAGE D. rerio 64 cells embryo | CAGE D. rerio 64 cells embryo | D. rerio 64 cells embryo | 1 | OTHER | TRANSCRIPTOMIC | CAGE | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>27</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP013950 | CAGE_64cells.fastq | fastq | 162784188.0 | 6029044.0 | CAGE D. rerio 64 cells embryo | 0:27 | A:41192860;C:36547869;G:46848833;T:38194626;N:0 | 27 | 41192860 | 36547869 | 46848833 | 38194626 | 0 | SRX156334 | SRS347202 | SRA055273 | University of Bergen | ZEPROME consortium | B | usable mapping rate | illumina | early_illumina | unknown | cage | unknown | bulk | unknown | unknown | Unknown | 2013-08-31 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||||
| 36694 | 36694 | SRR801679 | SRX258160 | SRS406291 | SRP020469 | PRJNA195909 | RNA sequencing project for zebrafish embryo and larva development | GSE45706 | Transcriptome Analysis | Zebrafish is an important model system for the study of vertebrate embryonic development and adaptive immunese response. recent yrs have seen great advancement in the understanding of the regulatory mechanisms during zebrafish embryogenesis and immune processes yet large gaps still remain in the functional pathways critical for each developmental stage especially for the late embryonic development. We sequenced the polyA extracted mRNA from 9 stages covering 7 major developmental periods of zebrafish. Whole genome gene expression pattern were analyzed to reveal unknown pathways or factors with implicated roles during each stage of vertebrate development. Overall design: Analysis of total mRNA by highthroughput sequencing in 9 stages covering 7 periods during the embryonic and larval development of zebrafish | pubmed:23700457;pubmed:26891128 | source: Zebrafish embryos at the 64 cell stage | GSM1112155: 64 cell 2 hpf | GSM1112155 | strain:AB|developmental stage:64 cell 2 hpf|tissue:embryo | 64 cell 2 hpf | Primary processing by SOLiD 3.0 online software The short SOLiD reads were aligned against the zebrafish genome build Zv9 using the software package Bioscope v1.2 obtained from Life Techlogies. Reads per kilobase of transcript per million mapped reads RPKM were calculated using an in house developed perl script which is available upon request. Genome build: Zv9 Supplementary files format and content: tab delimited text files including RPKM values for gene models from the genome annotation release Ensembl 62 of the Zv9 assembly | Zebrafish embryos at the 64 cell stage | Liquid nitrogen rapid cooling methods were used for zebrafish embryos and larvae euthanasia. | Total RNA was extracted from each stage of about 2000 embryos or larvae using Trizol Invitrogen Carlsbad CA USA methods according to the manufacturer’s instruction. RNA quality was evaluated by gel electrophoresis and the concentration was measured with NanoDrop 2000 Thermo Scientific,Waltham MA USA.The aliquots were stored at 80 oC. A protocol/kit available from Life Technologies with minor modifications was used to construct mRNA seq libraries. First the total RNA was estimated on an Agilent 2100 Bioanalyzer Agilent Technologies Waldbronn Germany. Second The ribosomal RNA removal steps were replaced by two rounds of polyA purification with the first round using the PolyATtract® mRNA Isolation Systems Promega Madison WI USA and the second round using the PolyAPurist™ Kit Ambion Austin TX USA. About 0.8 μg of mRNA was fragmented with 10min at 37 oC RNase III treatment. The fragmented mRNA were ligated with adaptor Mix A subsequently used for reverse transcription. The first strand cDNA were separated using 6% TBE Urea Gel Invitrogen Carlsbad CA USA and 100–200 nt fraction was recovered. The fractionated cDNA were subjected to 11 15 cycles of PCR amplification with the PCR products purified to yield the SOLiD Fragment Library ready for emulsion PCR. Emulsion PCR was performed using 600 pg of the library. All experiments were performed on full sequencing slides. | Zebrafish embryos and larvae were collected and maintained at approximately 28.5°C and were staged according to their morphological features and hours h or days dpf as described previously Kimmel et al. 1995 | strain:AB|developmental stage:64 cell 2 hpf|tissue:embryo | GSM1112155 | GSM1112155: 64 cell 2 hpf; Danio rerio; RNA Seq | GSM1112155 1 | 1 | GEO Accession:GSM1112155 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD System 3.0 | SRP020469 | D_rerio_64cell_F3.csfasta.bz2 D_rerio_64cell_F3_QV.qual.bz2 | SOLiD_native SOLiD_native | 11793112050.0 | 235862241.0 | GSM1112155 r1 | 0:50 | 0:2729453191;1:3189868180;2:3325229431;3:2482063391;.:66497857 | 50 | SRX258160 | SRS406291 | SRA072427 | GEO | Shanghai Chenshan Botanical Garden | 1 | 0.56575 | 0.01697 | 0.8538 | 0.48681 | 50 | B | usable mapping rate | legacy | early | unknown | poly_a | unknown | bulk | unknown | unknown | China | 2013-04-02 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 37128 | 37128 | SRR953522 | SRX336167 | SRS470740 | SRP028862 | PRJNA215266 | Danio rerio Transcriptome or Gene expression | PRJNA215266 | Other | During early vertebrate development various small non coding RNAs sRNAs such as MicroRNAs miRNAs and Piwi interacting RNAs piRNAs are dynamically expressed for orchestrating the maternal to zygotic transition MZT. Systematic analysis of expression profiles of zebrafish small RNAome will be greatly helpful for understanding the sRNA regulation during embryonic development. | small RNA sequencing for zebrafish early development | General Sample for zebrafish | zebrafish early development | breed:wild type zebrafish | 16 cell of zebrafish development | 16 cell stage | 1 | Total RNA from embryos was isolated using Trizol reagent Invitrogen. RNAs were fractioned on 15% denaturing polyacrylamide gels and small RNAs were isolated and purified. Subsequently small RNAs were ligated with both a 5’ adapter and 3’ adapter for reverse transcription using SuperscriptTM II reverse transcription kit Invitrogen following the manufacturer's instructions at 42 oC for 1 h and 70 oC for 15 min. post that the reverse transcribed product cDNA was amplified by the following PCR program: a 15 cycle reaction at 98 oC for 30 sec followed by 15 cycles consisting of 10 sec at 98 oC 15 sec at 72 oC and then 10 min at 72 oC. post obtaining a 92bp DNA band on 6% denaturing PAGE gels the PCR products were enriched by ethanol precipitation and purified using Spin X filter columns Fisher. | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>49</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP028862 | s16-cell.fq | fastq | 857702468.0 | 17504132.0 | 16 cell stage | 0:49 | A:188518867;C:188172489;G:222316155;T:258636924;N:58033 | 49 | 188518867 | 188172489 | 222316155 | 258636924 | 58033 | SRX336167 | SRS470740 | SRA098041 | Huazhong University of Science and Technology|cuckoo | Huazhong University of Science and Technology | 1 | 3e-05 | 1e-05 | 0.99993 | 1.0 | 49 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | China | 2015-07-22 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||
| 37234 | 37234 | SRR1146564 | SRX451693 | SRS544829 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre 155 2hpf PAL | GSM1316816 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre 155 2hpf PAL | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1316816 | GSM1316816: Dre 155 2hpf PAL; Danio rerio; RNA Seq | GSM1316816 | 1 | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | GEO Accession:GSM1316816 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP033369 | Dre_155_2hpf_PAL_sequences.txt.gz | fastq | 359788448.0 | 8775328.0 | GSM1316816 r1 | 0:41 | A:85325483;C:54760617;G:79441969;T:135974691;N:4285688 | 41 | 85325483 | 54760617 | 79441969 | 135974691 | 4285688 | SRX451693 | SRS544829 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.55281 | 0.12799 | 0.85399 | 0.57589 | 41 | B | usable mapping rate | illumina | early_illumina | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2014-01-29 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 37235 | 37235 | SRR1146563 | SRX451692 | SRS544828 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre 132 2hpf PAL | GSM1316815 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre 132 2hpf PAL | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1316815 | GSM1316815: Dre 132 2hpf PAL; Danio rerio; RNA Seq | GSM1316815 | 1 | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | GEO Accession:GSM1316815 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP033369 | Dre_132_2hpf_PAL_sequences.txt.gz | fastq | 381247110.0 | 9298710.0 | GSM1316815 r1 | 0:41 | A:89344310;C:58798497;G:80235521;T:148523775;N:4345007 | 41 | 89344310 | 58798497 | 80235521 | 148523775 | 4345007 | SRX451692 | SRS544828 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.56455 | 0.12077 | 0.86628 | 0.56964 | 41 | B | usable mapping rate | illumina | early_illumina | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2014-01-29 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 37236 | 37236 | SRR1146562 | SRX451691 | SRS544827 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre mock 2hpf PAL | GSM1316814 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre mock 2hpf PAL | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1316814 | GSM1316814: Dre mock 2hpf PAL; Danio rerio; RNA Seq | GSM1316814 | 1 | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | GEO Accession:GSM1316814 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP033369 | Dre_mock_2hpf_PAL_sequences.txt.gz | fastq | 377647351.0 | 9210911.0 | GSM1316814 r1 | 0:41 | A:87549066;C:56716380;G:81391312;T:147721892;N:4268701 | 41 | 87549066 | 56716380 | 81391312 | 147721892 | 4268701 | SRX451691 | SRS544827 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.55884 | 0.12609 | 0.85731 | 0.55373 | 41 | B | usable mapping rate | illumina | early_illumina | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2014-01-29 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 37243 | 37243 | SRR1039875 | SRX384685 | SRS508883 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre 155 2hpf RPF | GSM1276556 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre 155 2hpf RPF | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1276556 | GSM1276556: Dre 155 2hpf RPF; Danio rerio; RNA Seq | GSM1276556 | 1 | Libraries were constructed exactly as described in Guo et al. 2010 GSE22004 RNA seq | GEO Accession:GSM1276556 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033369 | Dre_155_2hpf_RPF_GCCAAT-s_2_1_sequence.txt | fastq | 1183731400.0 | 29593285.0 | GSM1276556 r1 | 0:40 | A:294292314;C:281794141;G:332579260;T:274773786;N:291899 | 40 | 294292314 | 281794141 | 332579260 | 274773786 | 291899 | SRX384685 | SRS508883 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.04234 | 0.00777 | 0.94795 | 0.7945 | 40 | B | usable mapping rate | illumina | hiseq_era | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2013-11-27 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 37244 | 37244 | SRR1039874 | SRX384684 | SRS508884 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre 132 2hpf RPF | GSM1276555 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre 132 2hpf RPF | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1276555 | GSM1276555: Dre 132 2hpf RPF; Danio rerio; RNA Seq | GSM1276555 | 1 | Libraries were constructed exactly as described in Guo et al. 2010 GSE22004 RNA seq | GEO Accession:GSM1276555 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033369 | Dre_132_2hpf_RPF_ACAGTG-s_2_1_sequence.txt | fastq | 1178603560.0 | 29465089.0 | GSM1276555 r1 | 0:40 | A:298397078;C:284717833;G:331869329;T:263329002;N:290318 | 40 | 298397078 | 284717833 | 331869329 | 263329002 | 290318 | SRX384684 | SRS508884 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.05095 | 0.00846 | 0.94111 | 0.79521 | 40 | B | usable mapping rate | illumina | hiseq_era | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2013-11-27 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 37245 | 37245 | SRR1039873 | SRX384683 | SRS508882 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre mock 2hpf RPF | GSM1276554 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre mock 2hpf RPF | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1276554 | GSM1276554: Dre mock 2hpf RPF; Danio rerio; RNA Seq | GSM1276554 | 1 | Libraries were constructed exactly as described in Guo et al. 2010 GSE22004 RNA seq | GEO Accession:GSM1276554 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033369 | Dre_mock_2hpf_RPF_TGACCA-s_2_1_sequence.txt | fastq | 1257344320.0 | 31433608.0 | GSM1276554 r1 | 0:40 | A:319961841;C:298218672;G:353470235;T:285387581;N:305991 | 40 | 319961841 | 298218672 | 353470235 | 285387581 | 305991 | SRX384683 | SRS508882 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.05737 | 0.00848 | 0.93438 | 0.7865 | 40 | B | usable mapping rate | illumina | hiseq_era | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2013-11-27 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 37252 | 37252 | SRR1039866 | SRX384676 | SRS508876 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre 155 2hpf RNA | GSM1276547 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre 155 2hpf RNA | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1276547 | GSM1276547: Dre 155 2hpf RNA; Danio rerio; RNA Seq | GSM1276547 | 1 | Libraries were constructed exactly as described in Guo et al. 2010 GSE22004 RNA seq | GEO Accession:GSM1276547 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033369 | Dre_155_2hpf_RNA_TTAGGC-s_2_1_sequence.txt | fastq | 1243480640.0 | 31087016.0 | GSM1276547 r1 | 0:40 | A:325925243;C:289644106;G:350484223;T:277122127;N:304941 | 40 | 325925243 | 289644106 | 350484223 | 277122127 | 304941 | SRX384676 | SRS508876 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.10159 | 0.02157 | 0.94219 | 0.88654 | 40 | B | usable mapping rate | illumina | hiseq_era | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2013-11-27 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 37253 | 37253 | SRR1039865 | SRX384675 | SRS508874 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre 132 2hpf RNA | GSM1276546 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre 132 2hpf RNA | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1276546 | GSM1276546: Dre 132 2hpf RNA; Danio rerio; RNA Seq | GSM1276546 | 1 | Libraries were constructed exactly as described in Guo et al. 2010 GSE22004 RNA seq | GEO Accession:GSM1276546 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033369 | Dre_132_2hpf_RNA_CGATGT-s_2_1_sequence.txt | fastq | 1217939000.0 | 30448475.0 | GSM1276546 r1 | 0:40 | A:327334752;C:270710404;G:337575390;T:282017485;N:300969 | 40 | 327334752 | 270710404 | 337575390 | 282017485 | 300969 | SRX384675 | SRS508874 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.11 | 0.02114 | 0.93361 | 0.88345 | 40 | B | usable mapping rate | illumina | hiseq_era | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2013-11-27 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 37254 | 37254 | SRR1039864 | SRX384674 | SRS508873 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre mock 2hpf RNA | GSM1276545 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre mock 2hpf RNA | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1276545 | GSM1276545: Dre mock 2hpf RNA; Danio rerio; RNA Seq | GSM1276545 | 1 | Libraries were constructed exactly as described in Guo et al. 2010 GSE22004 RNA seq | GEO Accession:GSM1276545 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033369 | Dre_mock_2hpf_RNA_ATCACG-s_2_1_sequence.txt | fastq | 1384195040.0 | 34604876.0 | GSM1276545 r1 | 0:40 | A:366234626;C:308760792;G:383307152;T:325550882;N:341588 | 40 | 366234626 | 308760792 | 383307152 | 325550882 | 341588 | SRX384674 | SRS508873 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.11468 | 0.02277 | 0.93275 | 0.89488 | 40 | B | usable mapping rate | illumina | hiseq_era | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2013-11-27 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 38352 | 38352 | SRR1785164 | SRX864135 | SRS834996 | SRP053099 | PRJNA274362 | Transcriptomics analysis of gene expression in 10 embryo development stages of Danio rerio | GSE65556 | Transcriptome Analysis | RNA was isolated from Danio embryo cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. All samples showed a RIN RNA integrity number of higher than 9. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer's protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 101 bp. Sequencing chemistry v2 Illumina was used and samples were multiplexed in two samples per lane. Overall design: Examination of gene expressive levels in embryo development of Danio | 64 cell rep1 | GSM1600040 | tissue:Danio embryo cells|developmental stage:embryo|cell type:64 cell | 64 cell rep1 | Reads were aligned to theZv9 genome assembly using TopHat v2.0.9 For each sample RPKM was computed as the number of reads which map per kilobase of exon model per million mapped reads for each gene. Genome build: Zv9 Supplementary files format and content: RPKM for each gene in each development stage | Danio embryo cells | RNA was isolated from Danio cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100 Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 50 bp. | developmental stage:embryo|cell type:64 cell | GSM1600040 | GSM1600040: 64 cell rep1; Danio rerio; RNA Seq | GSM1600040 | 1 | RNA was isolated from Danio cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100 Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 50 bp. | GEO Accession:GSM1600040 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP053099 | W6T_1.fastq.gz | fastq | 8895665799.0 | 88075899.0 | GSM1600040 r1 | 0:101 | A:2214065560;C:2252759233;G:2253964784;T:2174045976;N:830246 | 101 | 2214065560 | 2252759233 | 2253964784 | 2174045976 | 830246 | SRX864135 | SRS834996 | SRA236187 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 1 | 0.96228 | 0.0252 | 0.77481 | 0.4855 | 101 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | bulk | bulk | China | 2015-02-03 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 38353 | 38353 | SRR1785163 | SRX864134 | SRS834991 | SRP053099 | PRJNA274362 | Transcriptomics analysis of gene expression in 10 embryo development stages of Danio rerio | GSE65556 | Transcriptome Analysis | RNA was isolated from Danio embryo cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. All samples showed a RIN RNA integrity number of higher than 9. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer's protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 101 bp. Sequencing chemistry v2 Illumina was used and samples were multiplexed in two samples per lane. Overall design: Examination of gene expressive levels in embryo development of Danio | 16 cell rep1 | GSM1600039 | tissue:Danio embryo cells|developmental stage:embryo|cell type:16 cell | 16 cell rep1 | Reads were aligned to theZv9 genome assembly using TopHat v2.0.9 For each sample RPKM was computed as the number of reads which map per kilobase of exon model per million mapped reads for each gene. Genome build: Zv9 Supplementary files format and content: RPKM for each gene in each development stage | Danio embryo cells | RNA was isolated from Danio cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100 Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 50 bp. | developmental stage:embryo|cell type:16 cell | GSM1600039 | GSM1600039: 16 cell rep1; Danio rerio; RNA Seq | GSM1600039 | 1 | RNA was isolated from Danio cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100 Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 50 bp. | GEO Accession:GSM1600039 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP053099 | W5T_1.fastq.gz | fastq | 8981816880.0 | 88928880.0 | GSM1600039 r1 | 0:101 | A:2337146004;C:2178908640;G:2150713936;T:2314829776;N:218524 | 101 | 2337146004 | 2178908640 | 2150713936 | 2314829776 | 218524 | SRX864134 | SRS834991 | SRA236187 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 1 | 0.94918 | 0.02746 | 0.76264 | 0.50197 | 101 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | bulk | bulk | China | 2015-02-03 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 38354 | 38354 | SRR1785162 | SRX864133 | SRS834990 | SRP053099 | PRJNA274362 | Transcriptomics analysis of gene expression in 10 embryo development stages of Danio rerio | GSE65556 | Transcriptome Analysis | RNA was isolated from Danio embryo cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. All samples showed a RIN RNA integrity number of higher than 9. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer's protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 101 bp. Sequencing chemistry v2 Illumina was used and samples were multiplexed in two samples per lane. Overall design: Examination of gene expressive levels in embryo development of Danio | 4 cell rep1 | GSM1600038 | tissue:Danio embryo cells|developmental stage:embryo|cell type:4 cell | 4 cell rep1 | Reads were aligned to theZv9 genome assembly using TopHat v2.0.9 For each sample RPKM was computed as the number of reads which map per kilobase of exon model per million mapped reads for each gene. Genome build: Zv9 Supplementary files format and content: RPKM for each gene in each development stage | Danio embryo cells | RNA was isolated from Danio cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100 Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 50 bp. | developmental stage:embryo|cell type:4 cell | GSM1600038 | GSM1600038: 4 cell rep1; Danio rerio; RNA Seq | GSM1600038 | 1 | RNA was isolated from Danio cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100 Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 50 bp. | GEO Accession:GSM1600038 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP053099 | W4T_1.fastq.gz | fastq | 13975600381.0 | 138372281.0 | GSM1600038 r1 | 0:101 | A:3535785422;C:3493456274;G:3501455121;T:3443583783;N:1319781 | 101 | 3535785422 | 3493456274 | 3501455121 | 3443583783 | 1319781 | SRX864133 | SRS834990 | SRA236187 | GEO | Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS) | 1 | 0.96034 | 0.01453 | 0.80397 | 0.48159 | 101 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | bulk | bulk | China | 2015-02-03 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 40218 | 40218 | SRR2982510 | SRX1471511 | SRS1197399 | SRP067139 | PRJNA305418 | RiboZero mRNA seq across zebrafish development for study of uORFs | PRJNA305418 | Other | Untranslated mRNA regionsUTRs are key mediators of post transcriptional regulation. Previous studies have predicted thousands of ORFs in five prime'UTRs the vast majority of which have unknown function. We present a systematic analysis of the translation and function of upstream open reading framesuORFs across vertebrates. Combining high resolution ribosome footprinting and phasing we find that i uORFs are pervasive within vertebrate transcriptomes ii the majority show signatures of active translation and iii uORFs act as potent regulators of translation and RNA levels with a similar magnitude to miRNAs. Evolution has targeted sequence features to mitigate the effects of constitutively repressive uORFs. Finally we observe that the regulatory potential of uORFs on individual genes is conserved across species. These results provide insight into the regulatory code within mRNA leader sequences and their capacity to modulate translation across vertebrates.The mRNA seq data contained in this archive were used along with ribosome profiling data to calculate translation efficiency values. | 2hpf | AG00244 mrna r0 2h | strain:TUAB|age:2hpf|sex:pooled male and female|tissue:embryo|genotype:wt|BioSampleModel:Model organism or animal | AG00244 mrna r0 2h | 2h mRNA R0 | 1 | Twenty embryos per condition were collected from the same clutch from where the ribosome profiling timeseries was conducted.Bazzini et al 2014 Total RNA was isolated using 1mL of Trizol following manufacturer instructions. Ribosomal RNAs were depleted using Ribo Zero Epicentre/Illumina. Strand specific single end library was constructed according to the Illumina Sample Preparation Kit protocol using standard TruSeq adapters Libraries were prepared and sequenced in an Illumina Hi SEQ single end 75nt reads | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>75</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP067139 | AG00244_SEQ0039_R1.fastq.gz | fastq | 1010085524.0 | 13290599.0 | 2h mRNA R0 run1 | 0:76 | A:196715560;C:309406513;G:286228000;T:217670217;N:65234 | 76 | 196715560 | 309406513 | 286228000 | 217670217 | 65234 | SRX1471511 | SRS1197399 | SRA314809 | Yale University|Giraldez Lab | Yale University | 1 | 0.89974 | 0.14215 | 0.79488 | 0.72171 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | trueseq | bulk | unknown | unknown | United States | 2015-12-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 40252 | 40252 | SRR3038046 | SRX1494241 | SRS1217114 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf preZGA rep3 | GSM1976590 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN | IgG iCLIP zf preZGA rep3 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNTGGCNN | GSM1976590 | GSM1976590: IgG iCLIP zf preZGA rep3; Danio rerio; OTHER | GSM1976590 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976590 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNTGGCNN_20130812_hnRNPA1_4.fq.gz | fastq | 600183932.0 | 7897157.0 | GSM1976590 r1 | 0:76 | A:173843237;C:131372689;G:170729621;T:124187689;N:50696 | 76 | 173843237 | 131372689 | 170729621 | 124187689 | 50696 | SRX1494241 | SRS1217114 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.14511 | 0.03659 | 0.9332 | 0.651 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40253 | 40253 | SRR3038045 | SRX1494240 | SRS1217115 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf preZGA rep2 | GSM1976589 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNCCGGNN | IgG iCLIP zf preZGA rep2 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNCCGGNN | GSM1976589 | GSM1976589: IgG iCLIP zf preZGA rep2; Danio rerio; OTHER | GSM1976589 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976589 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNCCGGNN_20130812_hnRNPA1_5.fq.gz | fastq | 612280168.0 | 8056318.0 | GSM1976589 r1 | 0:76 | A:175101988;C:144456623;G:172272609;T:120400014;N:48934 | 76 | 175101988 | 144456623 | 172272609 | 120400014 | 48934 | SRX1494240 | SRS1217115 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.05322 | 0.01649 | 0.97656 | 0.67242 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40254 | 40254 | SRR3038044 | SRX1494239 | SRS1217116 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | IgG iCLIP zf preZGA rep1 | GSM1976588 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN | IgG iCLIP zf preZGA rep1 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti IgG|barcode sequence:NNNGGCGNN | GSM1976588 | GSM1976588: IgG iCLIP zf preZGA rep1; Danio rerio; OTHER | GSM1976588 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976588 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_IgG_Drembryo_wt_IgGcontrol_Dr_NNNGGCGNN_20130812_hnRNPA1_1.fq-3.gz | fastq | 12806760.0 | 168510.0 | GSM1976588 r1 | 0:76 | A:3652525;C:2758781;G:3842061;T:2552042;N:1351 | 76 | 3652525 | 2758781 | 3842061 | 2552042 | 1351 | SRX1494239 | SRS1217116 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.02784 | 0.01181 | 0.99813 | 0.68217 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40259 | 40259 | SRR3038039 | SRX1494234 | SRS1217121 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf preZGA rep3 | GSM1976583 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN | hnRNP A1 iCLIP zf preZGA rep3 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNCAATNN | GSM1976583 | GSM1976583: hnRNP A1 iCLIP zf preZGA rep3; Danio rerio; OTHER | GSM1976583 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976583 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNCAATNN_20130812_hnRNPA1_3.fq.gz | fastq | 1944912200.0 | 25590950.0 | GSM1976583 r1 | 0:76 | A:611172831;C:390755201;G:517844203;T:424973726;N:166239 | 76 | 611172831 | 390755201 | 517844203 | 424973726 | 166239 | SRX1494234 | SRS1217121 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.23819 | 0.06019 | 0.85318 | 0.72811 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40260 | 40260 | SRR3038038 | SRX1494233 | SRS1217122 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf preZGA rep2 | GSM1976582 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN | hnRNP A1 iCLIP zf preZGA rep2 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNTTGTNN | GSM1976582 | GSM1976582: hnRNP A1 iCLIP zf preZGA rep2; Danio rerio; OTHER | GSM1976582 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976582 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNTTGTNN_20130812_hnRNPA1_6.fq.gz | fastq | 1804236124.0 | 23739949.0 | GSM1976582 r1 | 0:76 | A:520750722;C:337743522;G:499109535;T:446481275;N:151070 | 76 | 520750722 | 337743522 | 499109535 | 446481275 | 151070 | SRX1494233 | SRS1217122 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.25184 | 0.06217 | 0.85687 | 0.67912 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 40261 | 40261 | SRR3038037 | SRX1494232 | SRS1217123 | SRP067641 | PRJNA306648 | Dynamic RNA protein interactions underlie the zebrafish maternal to zygotic transition | GSE76212 | Other | We adapted the iCLIP method to zebrafish embryos to investigate activities of Hnrnpa1 during the maternal to zygotic transition Overall design: 3 and 4 biological replicates from zebrafish embryos before preZGA and during ZGA zygotic genome activation respectively post UV crosslinking. Negative control samples include 3 IgG replicates of UV crosslinked samples for both developmental stages examined | pubmed:28381614 | hnRNP A1 iCLIP zf preZGA rep1 | GSM1976581 | tissue:zebrafish embryo|developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN | hnRNP A1 iCLIP zf preZGA rep1 | Basecalls performed using CASAVA version 1.4 For detail on data processing see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 Genome build: Zv9 version 75 Supplementary files format and content: .bed files describing significant crosslink sites derived from unique contain G in the file name and multi mapped contain M in the file name reads for combined replicates for each individual developmental stages and negative controls. | zebrafish embryo | Zebrafish embryos at the desired developmental stages were irradiated with UV light 254 nm to in vivo crosslink RNA protein interactions. | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | Zebrafish embryos were raised from WT AB strain and maintained using standard conditions. | developmental stage:preZGA 32 cell stage|antibody:anti hnRNP A1|barcode sequence:NNNGGTTNN | GSM1976581 | GSM1976581: hnRNP A1 iCLIP zf preZGA rep1; Danio rerio; OTHER | GSM1976581 | 1 | Zebrafish embryos were lysed and lysates treated with RNaseI to obtain optimal length of RNA fragments for cDNA library preparation. hnRNP A1 RNA complexes were immunopurified using mouse anti hnRNP A1 antibody and protein G dynabeads Invitrogen. Anti IgG antibody Sigma was used for negative control immunopurifications. post RNA dephosphorylation three prime end linker ligation was performed. Protein RNA complexes were resolved on SDS PAGE and transferred to the nitrocellulose membrane. Region of the membrane above the predicted size of hnRNP A1 was cut and RNA extracted using proteise K treatment. Subsequently RNA was reverse transcribed using RT primers harboring a barcode. cDNA was separated into three size selected fractions using 6% TBE Urea gel Life Technologies and circularized by ssDNA circligase. Specific oligo was annealed for BamHI restriction site formation. cDNA was linearized by BamHI digestion. Final cDNA libraries were generated by PCR amplification.. For more details see: König et al. 2010: iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nat Struct Mol Biol PMID:20601959 | GEO Accession:GSM1976581 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP067641 | iCLIP_hnRNPA1_Drembryo_wt_hnRNPA1_Dr_NNNGGTTNN_20130812_hnRNPA1_2.fq.gz | fastq | 2155200476.0 | 28357901.0 | GSM1976581 r1 | 0:76 | A:646739355;C:394864638;G:606938658;T:506474548;N:183277 | 76 | 646739355 | 394864638 | 606938658 | 506474548 | 183277 | SRX1494232 | SRS1217123 | SRA320959 | GEO | Molecular Biophysics and Biochemistry, Yale University | 1 | 0.24207 | 0.05859 | 0.84747 | 0.70564 | 76 | B | usable mapping rate | illumina | hiseq_era | 3prime | other | unknown | bulk | clip | iclip | United States | 2015-12-21 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 41391 | 41391 | SRR4375176 | SRX2226710 | SRS1732686 | SRP090954 | PRJNA345638 | RESA identifies mRNA regulatory sequences with high resolution | PRJNA345638 | Other | Gene expression is regulated extensively at the level of mRNA stability localization and translation. However decoding functional RNA regulatory features remains a limitation to understanding post transcriptional regulation in vivo. Here we developed RNA Element Selection Assay RESA a method that selects RNA elements based on their activity in vivo and uses high throughput sequencing to provide quantitative measurement of their regulatory function with near nucleotide resolution. We implemented RESA to identify sequence elements modulating mRNA stability during zebrafish embryogenesis. RESA provides a sensitive and quantitative measure of microRNA activity in vivo and also identifies novel regulatory sequences. To uncover specific sequence requirements within regulatory elements we developed a bisulfite mediated nucleotide conversion strategy for large scale mutational analysis RESA bisulfite. Finally we used the versatile RESA platform to map candidate protein RNA interactions in vivo RESA CLIP. The RESA platform can be broadly applicable to uncover the regulatory features shaping gene expression and cellular function. | RESA Seq WT 64c pA r3 B2 | resa AG01061 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:500utr|molecule:RNA|selection:pA|replicate:2|BioSampleModel:Model organism or animal | RESA Seq WT 64c pA r3 B2 | AG01061.1 | AG01061.1 | 1 | RNA-Seq | TRANSCRIPTOMIC | unspecified | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP090954 | AG01061.1_R1.fastq.gz AG01061.1_R2.fastq.gz | fastq fastq | 724448416.0 | 4766108.0 | AG01061.1 R2.fastq.gz | 0:76 1:76 | A:224701149;C:138989041;G:139762199;T:220977796;N:18231 | 76 | 76 | 224701149 | 138989041 | 139762199 | 220977796 | 18231 | SRX2226710 | SRS1732686 | SRA482696 | Yale University|Genetics | Yale University | 2 | 0.84913 | 0.84756 | 0.03557 | 0.03568 | 0.97153 | 0.97116 | 0.47281 | 0.46157 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2016-10-06 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 41402 | 41402 | SRR4375094 | SRX2226666 | SRS1732677 | SRP090954 | PRJNA345638 | RESA identifies mRNA regulatory sequences with high resolution | PRJNA345638 | Other | Gene expression is regulated extensively at the level of mRNA stability localization and translation. However decoding functional RNA regulatory features remains a limitation to understanding post transcriptional regulation in vivo. Here we developed RNA Element Selection Assay RESA a method that selects RNA elements based on their activity in vivo and uses high throughput sequencing to provide quantitative measurement of their regulatory function with near nucleotide resolution. We implemented RESA to identify sequence elements modulating mRNA stability during zebrafish embryogenesis. RESA provides a sensitive and quantitative measure of microRNA activity in vivo and also identifies novel regulatory sequences. To uncover specific sequence requirements within regulatory elements we developed a bisulfite mediated nucleotide conversion strategy for large scale mutational analysis RESA bisulfite. Finally we used the versatile RESA platform to map candidate protein RNA interactions in vivo RESA CLIP. The RESA platform can be broadly applicable to uncover the regulatory features shaping gene expression and cellular function. | RESA Seq WT 64c pA r3 B1 | resa AG01060 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:500utr|molecule:RNA|selection:pA|replicate:1|BioSampleModel:Model organism or animal | RESA Seq WT 64c pA r3 B1 | AG01060.1 | AG01060.1 | 1 | RNA-Seq | TRANSCRIPTOMIC | unspecified | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP090954 | AG01060.1_R1.fastq.gz AG01060.1_R2.fastq.gz | fastq fastq | 531097120.0 | 3494060.0 | AG01060.1 R1.fastq.gz | 0:76 1:76 | A:164891814;C:101739900;G:102440303;T:162011179;N:13924 | 76 | 76 | 164891814 | 101739900 | 102440303 | 162011179 | 13924 | SRX2226666 | SRS1732677 | SRA482696 | Yale University|Genetics | Yale University | 2 | 0.84523 | 0.84587 | 0.03561 | 0.03503 | 0.9723 | 0.97161 | 0.46204 | 0.47901 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2016-12-31 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 41417 | 41417 | SRR4423119 | SRX2245303 | SRS1745853 | SRP091534 | PRJNA347637 | Danio rerio and Xenopus laevis Raw sequence reads | PRJNA347637 | Other | To study the transcriptome during development | Time course 1 Dr | strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:64 cells|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal | RNA Seq of Zebrafish: 64 cells2 hpf | 347 1 | 347 1 | Libraries were generated according to the manufacturers’ protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress™ RNA Seq bar coding kit Thermo Fisher Scientific. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP091534 | S01large.fastq | fastq | 406838773.0 | 3451573.0 | S01large.fastq | 0:117.87 | A:90440106;C:114282886;G:115318720;T:86797061;N:0 | 117 | 90440106 | 114282886 | 115318720 | 86797061 | 0 | SRX2245303 | SRS1745853 | SRA485147 | Universiteit van Amsterdam|SILS | Universiteit van Amsterdam | 1 | 0.9203 | 0.10547 | 0.93095 | 0.75003 | 158 | B | usable mapping rate | ion_torrent | ion_torrent | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Netherlands | 2016-10-19 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||||
| 41432 | 41432 | SRR4423104 | SRX2245288 | SRS1745853 | SRP091534 | PRJNA347637 | Danio rerio and Xenopus laevis Raw sequence reads | PRJNA347637 | Other | To study the transcriptome during development | Time course 1 Dr | strain:not applicable|isolate:not applicable|breed:ABTL|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:64 cells|sex:not determined|tissue:single embryo|BioSampleModel:Model organism or animal | miRNA Seq of Zebrafish: 64 cells2 hpf | 348 1 | 348 1 | Libraries were generated according to the manufacturers’ protocols using the Ion Total RNA Seq Kit v2 and the Ion Xpress™ RNA Seq bar coding kit Thermo Fisher Scientific. A few modifications were made during purification steps in the small RNAseq to allow sequencing of longer RNAs up to 200 nt than with standard sRNA protocols. Namely: 153 µl ethanol instead of 120 µl during purification of cDNA and 134 µl ethanol instead of 110 µl in protocol. | miRNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ION_TORRENT | Ion Torrent Proton | SRP091534 | S01small.fastq | fastq | 91910627.0 | 1396009.0 | S01small.fastq | 0:65.84 | A:21663404;C:25661192;G:25069267;T:19516764;N:0 | 65 | 21663404 | 25661192 | 25069267 | 19516764 | 0 | SRX2245288 | SRS1745853 | SRA485147 | Universiteit van Amsterdam|SILS | Universiteit van Amsterdam | 1 | 0.56828 | 0.1715 | 0.92435 | 0.90047 | 34 | B | usable mapping rate | ion_torrent | ion_torrent | unknown | small_rna | unknown | bulk | unknown | unknown | Netherlands | 2016-10-19 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||||
| 41556 | 41556 | SRR5017067 | SRX2345562 | SRS1796129 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input 64cell rep2 | GSM2390020 | tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type | input 64cell rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:64 cell embryos|strain:AB wild type | GSM2390020 | GSM2390020: input 64cell rep2; Danio rerio; RIP Seq | GSM2390020 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390020 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_64cell_rep2.fastq.gz | fastq | 3598782386.0 | 38284919.0 | GSM2390020 r1 | 0:94 | A:953869445;C:864903757;G:875832539;T:903947732;N:228913 | 94 | 953869445 | 864903757 | 875832539 | 903947732 | 228913 | SRX2345562 | SRS1796129 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.04289 | 0.00757 | 0.9418 | 0.6078 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41557 | 41557 | SRR5017066 | SRX2345561 | SRS1796141 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | input 64cell rep1 | GSM2390019 | tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type | input 64cell rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:64 cell embryos|strain:AB wild type | GSM2390019 | GSM2390019: input 64cell rep1; Danio rerio; RIP Seq | GSM2390019 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390019 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | input_64cell_rep1.fastq.gz | fastq | 3538898746.0 | 37647859.0 | GSM2390019 r1 | 0:94 | A:916878511;C:870431252;G:873611680;T:877750503;N:226800 | 94 | 916878511 | 870431252 | 873611680 | 877750503 | 226800 | SRX2345561 | SRS1796141 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03397 | 0.00616 | 0.95268 | 0.62545 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41558 | 41558 | SRR5017065 | SRX2345560 | SRS1796153 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip 64cell rep2 | GSM2390018 | tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type | ip 64cell rep2 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:64 cell embryos|strain:AB wild type | GSM2390018 | GSM2390018: ip 64cell rep2; Danio rerio; RIP Seq | GSM2390018 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390018 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_64cell_rep2.fastq.gz | fastq | 3530677976.0 | 37560404.0 | GSM2390018 r1 | 0:94 | A:966880666;C:841411144;G:858285224;T:862983808;N:1117134 | 94 | 966880666 | 841411144 | 858285224 | 862983808 | 1117134 | SRX2345560 | SRS1796153 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.04775 | 0.00421 | 0.92845 | 0.5748 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 41559 | 41559 | SRR5017064 | SRX2345559 | SRS1796135 | SRP093295 | PRJNA353372 | N6 methyladenosine dynamics during early vertebrate embryogenesis | GSE89815 | Other | Early vertebrate embryogenesis is characterized by extensive post transcriptional regulation during the maternal to zygotic transition. The N6 methyladenosine m6A modifications on mRNA has been shown to affect both translation and stability of transcripts. Here we investigate the m6A topology during early vertebrate embryogenesis and its association with RNA stability translation efficiency and effect on miR 430 degradation kinetics. Notably we find a strong association of m6A with cytoplasmic polyadenylation and translational efficiency prior to zygotic genome activation. Genes required for zygotic genome activation such as nanog and pou5f3 display dynamic m6A levels. post zygotic genome activation m6A is associated with improved stability and dampens the effect of miR 430 mediated degradation. Through sequence analyses we identified enrichment of motifs for RNA binding proteins involved in translational regulation and RNA degradation. We propose a role for m6A in multiple mRNA regulatory mechanisms for the first time in an in vivo system and improve our understanding of the combinatorial code behind the complex post transcriptional regulation of reprogramming during early vertebrate development. Overall design: Examination of m6A in four different developmental stages | ip 64cell rep1 | GSM2390017 | tissue:Embryos|developmental stage:64 cell embryos|strain:AB wild type | ip 64cell rep1 | Base calling The sequencing output from each of the 4 lanes the sequencing run was trimmed 7 nucleotides in the 5’end and de multiplexed 4 samples in each lane. Reads were mapped to Zv10 using the STAR aligner Dobin et al. 2013 with options seedSearchStartLmax 15 clip3pNbases 10 clip5pNbases 10 outFilterMultimapNmax 20 outFilterMismatchNoverLmax 0.05 outFilterMatchNminOverLread 0.0 outFilterMatchNmin 15 outFilterScoreMinOverLread 0.0. We performed peak calling and detection of differentially methylated genes using ExomePeak Meng et al. 2013. Genome build: Zv10 Supplementary files format and content: Bed files with enriched regions from each developmental stage and txt file with raw and normalized read counts for each gene using the input samples | Embryos | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | Embryos from the AB wild type strain were obtained from the NMBU zebrafish facility where the zebrafish were kept at 28±1°C on a 14 10 hour light dark cycle at a density of 5 10 fish/L. System water SW was prepared from particle and active charcoal filtrated tap water deionized by reverse osmosis RO and kept sterile by UV irradiation. The water was conditioned to a conductivity of 500µS/cm general hardness GH 4 5 and pH 7.5 by addition of 155g synthetic sea salt Instant Ocean Blacksburg USA 53g sodium carbonate and 15g calcium chloride Sigma Aldrich per liter RO water. Adult fish were fed with Gemma Micro 300 Skretting Stavanger Norway dry feed twice a day and live artemia Scanbur Karlslunde Denmark once a day. Health monitoring was by daily inspection use of sentinel fish sent for pathology ZIRC Eugene Oregon and water microbiology analysis NMBU Vetbio Oslo every six month. Adult fish were allowed to mate for 30 minutes in standard 1L breeding tanks Aquatic Habitats Apopka FL. Harvested embryos were kept in autoclaved SW at 28 °C harvested by snap freezing liquid nitrogen and visually controlled for stage and lack of abnormalities at the selected time points. All experiments were performed according to Norwegian Animal Welfare Act 2009 the EU Directive 2010/63. | developmental stage:64 cell embryos|strain:AB wild type | GSM2390017 | GSM2390017: ip 64cell rep1; Danio rerio; RIP Seq | GSM2390017 | 1 | We isolated total RNA from 4 stages 1 cell/20 minutes post fertilization 2 4 and 6 hpf in batches of 200 embryos using TRIzol Invitrogen cat.no. 15596 018. We added ERCC spike in RNA TermoFisher scientific cat.no. 4456740 to the trizol. For each sequencing library two batches of total RNA from 200 embryos were merged and enriched for polyA+ RNA using Dynabeads® mRNA Purification Kit Ambion #61006. The m6A RIP experiment was carried out as previously described Ke et al. 2015 and the protocol can be found in supplementary file 1. Briefly polyA+ enriched RNA was partially fragmented by alkaline hydrolysis ethanol precipitated and SDS PAGE size selected for 20 80nt. Part of the fragmented RNA was used as input and the rest was immunoprecipitated at 4oC for 2 h using Dynabeads Protein A Life Technologies # 10008D conjugated anti m6A antibody Synaptic systems # 202003. post stringent washing the bound RNA was eluted with 0.5mg/ml N6 methyladenosine sodium salt Sigma Aldrich # M2780 ethanol precipitated and resuspended with RNase free water. The eluted RNA and input RNA were subjected to 3’pre adenylated DNA liker ligation with T4 RNA ligase2 truncated KQ NEB #M0373L at 16 oC over night. The sequencing library was constructed with bromodeoxyuridine BrdU CLIP protocol described in Weyn Vanhentenryck et al. 2014 with improved RT primers indicated in Ke et al. 2015. | GEO Accession:GSM2390017 | RIP-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP093295 | ip_64cell_rep1.fastq.gz | fastq | 3912003734.0 | 41617061.0 | GSM2390017 r1 | 0:94 | A:1040276279;C:945311584;G:953598043;T:971589029;N:1228799 | 94 | 1040276279 | 945311584 | 953598043 | 971589029 | 1228799 | SRX2345559 | SRS1796135 | SRA492943 | GEO | Klungland Lab, Dept of microbiology, Oslo University Hospital | 1 | 0.03544 | 0.00268 | 0.93914 | 0.53712 | 94 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Norway | 2016-11-14 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||
| 43071 | 43071 | SRR7264575 | SRX4168722 | SRS3380686 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: DMS Seq WT 64c CHX B1;DMS Seq WT 64c CHX B2 | Raw multiplex: dmsseq AG01273;dmsseq AG01274 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo cyclohex|molecule:RNA|selection:pA|condition:DMS|replicate group:18|replicate:1;2|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: DMS Seq WT 64c CHX B1;DMS Seq WT 64c CHX B2 | AG01273.4;AG01274.4 | AG01273.4;AG01274.4 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | HWKVWADXX_JBCZ103_023_R1.fastq.gz | fastq | 7514617040.0 | 98876540.0 | HWKVWADXX JBCZ103 023 R1.fastq.gz | 0:76 | A:2401597632;C:1861527917;G:1834777254;T:1415956870;N:757367 | 76 | 2401597632 | 1861527917 | 1834777254 | 1415956870 | 757367 | SRX4168722 | SRS3380686 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.0 | 0.0 | 1.0 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-05 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||||
| 43072 | 43072 | SRR7264576 | SRX4168721 | SRS3380689 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: RPF patA WT 64c RPF B1;RPF patA WT 64c RPF B2 | Raw multiplex: ribo seq pata AG01409;ribo seq pata AG01410 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:cyclohex|molecule:RNA|condition:RPF 28nt|replicate group:19|replicate:1;2|barcode:CACA;TCTC|BioSampleModel:Model organism or animal | Raw multiplex: RPF patA WT 64c RPF B1;RPF patA WT 64c RPF B2 | AG01409.1;AG01410.1 | AG01409.1;AG01410.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | C7MPPANXX_JBDL115_014_R1.fastq.gz | fastq | 4944760108.0 | 65062633.0 | C7MPPANXX JBDL115 014 R1.fastq.gz | 0:76 | A:1280812305;C:1385761238;G:1441128504;T:836702863;N:355198 | 76 | 1280812305 | 1385761238 | 1441128504 | 836702863 | 355198 | SRX4168721 | SRS3380689 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.0 | 0.0 | 1.0 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||||
| 43073 | 43073 | SRR7264577 | SRX4168720 | SRS3380688 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: RPF patA WT 64c PatA RPF B1;RPF patA WT 64c PatA RPF B2 | Raw multiplex: ribo seq pata AG01411;ribo seq pata AG01412 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:cyclohex PatA|molecule:RNA|condition:RPF 28nt|replicate group:20|replicate:1;2|barcode:CACA;TCTC|BioSampleModel:Model organism or animal | Raw multiplex: RPF patA WT 64c PatA RPF B1;RPF patA WT 64c PatA RPF B2 | AG01411.1;AG01412.1 | AG01411.1;AG01412.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | C7MPPANXX_JBDM116_015_R1.fastq.gz | fastq | 10995071544.0 | 144671994.0 | C7MPPANXX JBDM116 015 R1.fastq.gz | 0:76 | A:2850888928;C:3075001734;G:3215965099;T:1852417694;N:798089 | 76 | 2850888928 | 3075001734 | 3215965099 | 1852417694 | 798089 | SRX4168720 | SRS3380688 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.0 | 0.0 | 1.0 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-05 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||||
| 43074 | 43074 | SRR7264578 | SRX4168719 | SRS3380687 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: DMS Seq PatA WT 64c DMS B1;DMS Seq PatA WT 64c DMS B2 | Raw multiplex: dmsseq pata AG01426;dmsseq pata AG01427 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS|molecule:RNA|selection:pA|condition:DMS|replicate group:21|replicate:1;2|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: DMS Seq PatA WT 64c DMS B1;DMS Seq PatA WT 64c DMS B2 | AG01426.1;AG01427.1 | AG01426.1;AG01427.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | C7MPPANXX_JBDF109_027_R1.fastq.gz | fastq | 446991948.0 | 5881473.0 | C7MPPANXX JBDF109 027 R1.fastq.gz | 0:76 | A:146192524;C:109441919;G:103882304;T:87445288;N:29913 | 76 | 146192524 | 109441919 | 103882304 | 87445288 | 29913 | SRX4168719 | SRS3380687 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 2e-05 | 1e-05 | 1.0 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||||
| 43075 | 43075 | SRR7264579 | SRX4168718 | SRS3380687 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: DMS Seq PatA WT 64c DMS B1;DMS Seq PatA WT 64c DMS B2 | Raw multiplex: dmsseq pata AG01426;dmsseq pata AG01427 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS|molecule:RNA|selection:pA|condition:DMS|replicate group:21|replicate:1;2|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: DMS Seq PatA WT 64c DMS B1;DMS Seq PatA WT 64c DMS B2 | AG01426.2;AG01427.2 | AG01426.2;AG01427.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | HVJC2ADXX_JBDF109_027_R1.fastq.gz | fastq | 447485492.0 | 5887967.0 | HVJC2ADXX JBDF109 027 R1.fastq.gz | 0:76 | A:146683880;C:109166579;G:104154702;T:87473352;N:6979 | 76 | 146683880 | 109166579 | 104154702 | 87473352 | 6979 | SRX4168718 | SRS3380687 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.0023 | 0.00034 | 0.99326 | 0.57567 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43076 | 43076 | SRR7264580 | SRX4168717 | SRS3380687 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: DMS Seq PatA WT 64c DMS B1;DMS Seq PatA WT 64c DMS B2 | Raw multiplex: dmsseq pata AG01426;dmsseq pata AG01427 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS|molecule:RNA|selection:pA|condition:DMS|replicate group:21|replicate:1;2|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: DMS Seq PatA WT 64c DMS B1;DMS Seq PatA WT 64c DMS B2 | AG01426.3;AG01427.3 | AG01426.3;AG01427.3 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | HVJ2TADXX_JBDF109_027_R1.fastq.gz | fastq | 4740289176.0 | 62372226.0 | HVJ2TADXX JBDF109 027 R1.fastq.gz | 0:76 | A:1552060471;C:1156267615;G:1104246757;T:927209997;N:504336 | 76 | 1552060471 | 1156267615 | 1104246757 | 927209997 | 504336 | SRX4168717 | SRS3380687 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.00235 | 0.00026 | 0.99379 | 0.60051 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-05 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43077 | 43077 | SRR7264581 | SRX4168716 | SRS3380687 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: DMS Seq PatA WT 64c DMS B1;DMS Seq PatA WT 64c DMS B2 | Raw multiplex: dmsseq pata AG01426;dmsseq pata AG01427 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS|molecule:RNA|selection:pA|condition:DMS|replicate group:21|replicate:1;2|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: DMS Seq PatA WT 64c DMS B1;DMS Seq PatA WT 64c DMS B2 | AG01426.4;AG01427.4 | AG01426.4;AG01427.4 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | HJTYNBCXX_JBDF109_NOBCX_R1.fastq.gz | fastq | 6776423036.0 | 89163461.0 | HJTYNBCXX JBDF109 NOBCX R1.fastq.gz | 0:76 | A:2212424663;C:1653496002;G:1573846163;T:1336100302;N:555906 | 76 | 2212424663 | 1653496002 | 1573846163 | 1336100302 | 555906 | SRX4168716 | SRS3380687 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 3e-05 | 2e-05 | 1.0 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||||
| 43078 | 43078 | SRR7264582 | SRX4168715 | SRS3380683 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: DMS Seq PatA WT 64c PatA DMS B1;DMS Seq PatA WT 64c PatA DMS B2 | Raw multiplex: dmsseq pata AG01428;dmsseq pata AG01429 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS PatA|molecule:RNA|selection:pA|condition:DMS|replicate group:22|replicate:1;2|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: DMS Seq PatA WT 64c PatA DMS B1;DMS Seq PatA WT 64c PatA DMS B2 | AG01428.1;AG01429.1 | AG01428.1;AG01429.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | C7MPPANXX_JBDG110_013_R1.fastq.gz | fastq | 1593732388.0 | 20970163.0 | C7MPPANXX JBDG110 013 R1.fastq.gz | 0:76 | A:517196379;C:393268952;G:372639155;T:310521534;N:106368 | 76 | 517196379 | 393268952 | 372639155 | 310521534 | 106368 | SRX4168715 | SRS3380683 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 2e-05 | 0.0 | 0.99997 | 1.0 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43079 | 43079 | SRR7264583 | SRX4168714 | SRS3380683 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: DMS Seq PatA WT 64c PatA DMS B1;DMS Seq PatA WT 64c PatA DMS B2 | Raw multiplex: dmsseq pata AG01428;dmsseq pata AG01429 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS PatA|molecule:RNA|selection:pA|condition:DMS|replicate group:22|replicate:1;2|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: DMS Seq PatA WT 64c PatA DMS B1;DMS Seq PatA WT 64c PatA DMS B2 | AG01428.2;AG01429.2 | AG01428.2;AG01429.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | HVJC2ADXX_JBDG110_013_R1.fastq.gz | fastq | 1268326988.0 | 16688513.0 | HVJC2ADXX JBDG110 013 R1.fastq.gz | 0:76 | A:411772190;C:312434121;G:297408612;T:246654231;N:57834 | 76 | 411772190 | 312434121 | 297408612 | 246654231 | 57834 | SRX4168714 | SRS3380683 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 1e-05 | 0.0 | 0.99997 | 0.0 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43080 | 43080 | SRR7264584 | SRX4168713 | SRS3380683 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: DMS Seq PatA WT 64c PatA DMS B1;DMS Seq PatA WT 64c PatA DMS B2 | Raw multiplex: dmsseq pata AG01428;dmsseq pata AG01429 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS PatA|molecule:RNA|selection:pA|condition:DMS|replicate group:22|replicate:1;2|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: DMS Seq PatA WT 64c PatA DMS B1;DMS Seq PatA WT 64c PatA DMS B2 | AG01428.3;AG01429.3 | AG01428.3;AG01429.3 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | HVJ2TADXX_JBDG110_013_R1.fastq.gz | fastq | 1149592188.0 | 15126213.0 | HVJ2TADXX JBDG110 013 R1.fastq.gz | 0:76 | A:373090462;C:283151050;G:269811169;T:223419849;N:119658 | 76 | 373090462 | 283151050 | 269811169 | 223419849 | 119658 | SRX4168713 | SRS3380683 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.00222 | 0.0002 | 0.99362 | 0.55643 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-05 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43081 | 43081 | SRR7264585 | SRX4168712 | SRS3380686 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: DMS Seq WT 64c CHX B1;DMS Seq WT 64c CHX B2 | Raw multiplex: dmsseq AG01273;dmsseq AG01274 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo cyclohex|molecule:RNA|selection:pA|condition:DMS|replicate group:18|replicate:1;2|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: DMS Seq WT 64c CHX B1;DMS Seq WT 64c CHX B2 | AG01273.3;AG01274.3 | AG01273.3;AG01274.3 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | HVJ7NADXX_JBCZ103_023_R1.fastq.gz | fastq | 882016024.0 | 11605474.0 | HVJ7NADXX JBCZ103 023 R1.fastq.gz | 0:76 | A:278837606;C:213606139;G:214029888;T:175477675;N:64716 | 76 | 278837606 | 213606139 | 214029888 | 175477675 | 64716 | SRX4168712 | SRS3380686 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 6e-05 | 4e-05 | 0.99995 | 1.0 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43082 | 43082 | SRR7264586 | SRX4168711 | SRS3380686 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: DMS Seq WT 64c CHX B1;DMS Seq WT 64c CHX B2 | Raw multiplex: dmsseq AG01273;dmsseq AG01274 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo cyclohex|molecule:RNA|selection:pA|condition:DMS|replicate group:18|replicate:1;2|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: DMS Seq WT 64c CHX B1;DMS Seq WT 64c CHX B2 | AG01273.2;AG01274.2 | AG01273.2;AG01274.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | HVK53ADXX_JBCZ103_023_R1.fastq.gz | fastq | 2614864056.0 | 34406106.0 | HVK53ADXX JBCZ103 023 R1.fastq.gz | 0:76 | A:832670351;C:647746556;G:639758530;T:494461931;N:226688 | 76 | 832670351 | 647746556 | 639758530 | 494461931 | 226688 | SRX4168711 | SRS3380686 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 5e-05 | 2e-05 | 0.99993 | 0.0 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43085 | 43085 | SRR7264589 | SRX4168708 | SRS3380686 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: DMS Seq WT 64c CHX B1;DMS Seq WT 64c CHX B2 | Raw multiplex: dmsseq AG01273;dmsseq AG01274 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo cyclohex|molecule:RNA|selection:pA|condition:DMS|replicate group:18|replicate:1;2|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: DMS Seq WT 64c CHX B1;DMS Seq WT 64c CHX B2 | AG01273.1;AG01274.1 | AG01273.1;AG01274.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | HMHGVADXX_JBCZ103_023_R1.fastq.gz | fastq | 2819768568.0 | 37102218.0 | HMHGVADXX JBCZ103 023 R1.fastq.gz | 0:76 | A:900945260;C:699348182;G:689446355;T:529699985;N:328786 | 76 | 900945260 | 699348182 | 689446355 | 529699985 | 328786 | SRX4168708 | SRS3380686 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.0 | 0.0 | 1.0 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||||
| 43091 | 43091 | SRR7264595 | SRX4168702 | SRS3380683 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: DMS Seq PatA WT 64c PatA DMS B1;DMS Seq PatA WT 64c PatA DMS B2 | Raw multiplex: dmsseq pata AG01428;dmsseq pata AG01429 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS PatA|molecule:RNA|selection:pA|condition:DMS|replicate group:22|replicate:1;2|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: DMS Seq PatA WT 64c PatA DMS B1;DMS Seq PatA WT 64c PatA DMS B2 | AG01428.5;AG01429.5 | AG01428.5;AG01429.5 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | HJTYNBCXX_JBDG110_NOBCX_R1.fastq.gz | fastq | 8473348224.0 | 111491424.0 | HJTYNBCXX JBDG110 NOBCX R1.fastq.gz | 0:76 | A:2738474380;C:2086110939;G:1986494866;T:1661471870;N:796169 | 76 | 2738474380 | 2086110939 | 1986494866 | 1661471870 | 796169 | SRX4168702 | SRS3380683 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 3e-05 | 2e-05 | 1.0 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-05 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||||
| 43092 | 43092 | SRR7264596 | SRX4168701 | SRS3380683 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | Raw multiplex: DMS Seq PatA WT 64c PatA DMS B1;DMS Seq PatA WT 64c PatA DMS B2 | Raw multiplex: dmsseq pata AG01428;dmsseq pata AG01429 | strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS PatA|molecule:RNA|selection:pA|condition:DMS|replicate group:22|replicate:1;2|barcode:CACA;AGAG|BioSampleModel:Model organism or animal | Raw multiplex: DMS Seq PatA WT 64c PatA DMS B1;DMS Seq PatA WT 64c PatA DMS B2 | AG01428.4;AG01429.4 | AG01428.4;AG01429.4 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | HVJ7NADXX_JBDG110_013_R1.fastq.gz | fastq | 1317100672.0 | 17330272.0 | HVJ7NADXX JBDG110 013 R1.fastq.gz | 0:76 | A:424319849;C:318879376;G:308835829;T:264971153;N:94465 | 76 | 424319849 | 318879376 | 308835829 | 264971153 | 94465 | SRX4168701 | SRS3380683 | SRA715414 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 9e-05 | 5e-05 | 0.99995 | 0.2 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-05 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43099 | 43099 | SRR5893058 | SRX3058787 | SRS2404528 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | mRNA Seq R0 patA WT 64c PatA RPF input B2 | mrna seq pata AG01431 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:PatA|molecule:RNA|selection:r0|condition:input|replicate group:23|replicate:2|BioSampleModel:Model organism or animal | mRNA Seq R0 patA WT 64c PatA RPF input B2 | AG01431.1 | AG01431.1 | RNA | RNA-Seq | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01431.1_R1.fastq.gz | fastq | 935580824.0 | 12310274.0 | AG01431.1 R1.fastq.gz | 0:76 | A:188726598;C:276745094;G:258235229;T:211815415;N:58488 | 76 | 188726598 | 276745094 | 258235229 | 211815415 | 58488 | SRX3058787 | SRS2404528 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.89193 | 0.09644 | 0.7849 | 0.69832 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43100 | 43100 | SRR5893059 | SRX3058786 | SRS2404528 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | mRNA Seq R0 patA WT 64c PatA RPF input B2 | mrna seq pata AG01431 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:PatA|molecule:RNA|selection:r0|condition:input|replicate group:23|replicate:2|BioSampleModel:Model organism or animal | mRNA Seq R0 patA WT 64c PatA RPF input B2 | AG01431.2 | AG01431.2 | RNA | RNA-Seq | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01431.2_R1.fastq.gz | fastq | 2550535528.0 | 33559678.0 | AG01431.2 R1.fastq.gz | 0:76 | A:541016830;C:720948568;G:664552003;T:623742439;N:275688 | 76 | 541016830 | 720948568 | 664552003 | 623742439 | 275688 | SRX3058786 | SRS2404528 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.90466 | 0.10321 | 0.77595 | 0.60561 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43101 | 43101 | SRR5893060 | SRX3058785 | SRS2404530 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | mRNA Seq R0 patA WT 64c RPF input B1 | mrna seq pata AG01432 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|molecule:mRNA|selection:r0|condition:input|replicate group:24|replicate:1|BioSampleModel:Model organism or animal | mRNA Seq R0 patA WT 64c RPF input B1 | AG01432.1 | AG01432.1 | mRNA | RNA-Seq | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01432.1_R1.fastq.gz | fastq | 2796444700.0 | 36795325.0 | AG01432.1 R1.fastq.gz | 0:76 | A:663756831;C:716464328;G:666812843;T:749363967;N:46731 | 76 | 663756831 | 716464328 | 666812843 | 749363967 | 46731 | SRX3058785 | SRS2404530 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.85828 | 0.09273 | 0.75534 | 0.50507 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43102 | 43102 | SRR5893061 | SRX3058784 | SRS2404531 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | mRNA Seq R0 patA WT 64c RPF input B2 | mrna seq pata AG01433 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|molecule:mRNA|selection:r0|condition:input|replicate group:24|replicate:2|BioSampleModel:Model organism or animal | mRNA Seq R0 patA WT 64c RPF input B2 | AG01433.1 | AG01433.1 | mRNA | RNA-Seq | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01433.1_R1.fastq.gz | fastq | 3208682532.0 | 42219507.0 | AG01433.1 R1.fastq.gz | 0:76 | A:715292036;C:869176418;G:807214698;T:816945712;N:53668 | 76 | 715292036 | 869176418 | 807214698 | 816945712 | 53668 | SRX3058784 | SRS2404531 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.85439 | 0.09801 | 0.76597 | 0.58538 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43103 | 43103 | SRR5893062 | SRX3058783 | SRS2404532 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c DMScontrol in vitro | dmsseq AG00876 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:water in vitro|molecule:RNA|selection:pA|condition:control|replicate group:13|replicate:1|BioSampleModel:Model organism or animal | DMS Seq WT 64c DMScontrol in vitro | AG00876.2 | AG00876.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG00876.2_R1.fastq.gz | fastq | 139395856.0 | 1834156.0 | AG00876.2 R1.fastq.gz | 0:76 | A:37323535;C:39047425;G:34144869;T:28873865;N:6162 | 76 | 37323535 | 39047425 | 34144869 | 28873865 | 6162 | SRX3058783 | SRS2404532 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.00316 | 0.00094 | 0.99318 | 0.54676 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43104 | 43104 | SRR5893063 | SRX3058782 | SRS2404532 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c DMScontrol in vitro | dmsseq AG00876 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:water in vitro|molecule:RNA|selection:pA|condition:control|replicate group:13|replicate:1|BioSampleModel:Model organism or animal | DMS Seq WT 64c DMScontrol in vitro | AG00876.1 | AG00876.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG00876.1_R1.fastq.gz | fastq | 23244372.0 | 305847.0 | AG00876.1 R1.fastq.gz | 0:76 | A:6246268;C:6429695;G:5629550;T:4937550;N:1309 | 76 | 6246268 | 6429695 | 5629550 | 4937550 | 1309 | SRX3058782 | SRS2404532 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.02737 | 0.00562 | 0.96288 | 0.52983 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43115 | 43115 | SRR5893082 | SRX3058763 | SRS2404539 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | mRNA Seq R0 patA WT 64c PatA RPF input B1 | mrna seq pata AG01430 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:PatA|molecule:RNA|selection:r0|condition:input|replicate group:23|replicate:1|BioSampleModel:Model organism or animal | mRNA Seq R0 patA WT 64c PatA RPF input B1 | AG01430.2 | AG01430.2 | RNA | RNA-Seq | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01430.2_R1.fastq.gz | fastq | 3133028560.0 | 41224060.0 | AG01430.2 R1.fastq.gz | 0:76 | A:672361176;C:875054552;G:808035984;T:777238497;N:338351 | 76 | 672361176 | 875054552 | 808035984 | 777238497 | 338351 | SRX3058763 | SRS2404539 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.88898 | 0.09238 | 0.77234 | 0.6234 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43116 | 43116 | SRR5893083 | SRX3058762 | SRS2404539 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | mRNA Seq R0 patA WT 64c PatA RPF input B1 | mrna seq pata AG01430 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:PatA|molecule:RNA|selection:r0|condition:input|replicate group:23|replicate:1|BioSampleModel:Model organism or animal | mRNA Seq R0 patA WT 64c PatA RPF input B1 | AG01430.1 | AG01430.1 | RNA | RNA-Seq | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01430.1_R1.fastq.gz | fastq | 898114724.0 | 11817299.0 | AG01430.1 R1.fastq.gz | 0:76 | A:187456862;C:260421633;G:242938837;T:207239930;N:57462 | 76 | 187456862 | 260421633 | 242938837 | 207239930 | 57462 | SRX3058762 | SRS2404539 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.87315 | 0.08685 | 0.78117 | 0.65305 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2017-08-03 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43117 | 43117 | SRR5893084 | SRX3058761 | SRS2404540 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq PatA WT 64c PatA DMS B2 | dmsseq pata AG01429 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS PatA|molecule:RNA|selection:pA|condition:DMS|replicate group:22|replicate:2|BioSampleModel:Model organism or animal | DMS Seq PatA WT 64c PatA DMS B2 | AG01429.1 | AG01429.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01429.1_R1.fastq.gz | fastq | 193152200.0 | 7929129.0 | AG01429.1 R1.fastq.gz | 0:24.36 1:0 | A:53713978;C:42339303;G:46822608;T:50276290;N:21 | 24 | 0 | 53713978 | 42339303 | 46822608 | 50276290 | 21 | SRX3058761 | SRS2404540 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.69688 | 0.0423 | 0.76621 | 0.51286 | 37 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43118 | 43118 | SRR5893085 | SRX3058760 | SRS2404541 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq PatA WT 64c PatA DMS B1 | dmsseq pata AG01428 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS PatA|molecule:RNA|selection:pA|condition:DMS|replicate group:22|replicate:1|BioSampleModel:Model organism or animal | DMS Seq PatA WT 64c PatA DMS B1 | AG01428.5 | AG01428.5 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01428.5_R1.fastq.gz | fastq | 1471415118.0 | 60775933.0 | AG01428.5 R1.fastq.gz | 0:24.21 1:0 | A:427869397;C:311916291;G:327280051;T:404336571;N:12808 | 24 | 0 | 427869397 | 311916291 | 327280051 | 404336571 | 12808 | SRX3058760 | SRS2404541 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.69068 | 0.05351 | 0.76625 | 0.51244 | 19 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43119 | 43119 | SRR5893086 | SRX3058759 | SRS2404541 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq PatA WT 64c PatA DMS B1 | dmsseq pata AG01428 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS PatA|molecule:RNA|selection:pA|condition:DMS|replicate group:22|replicate:1|BioSampleModel:Model organism or animal | DMS Seq PatA WT 64c PatA DMS B1 | AG01428.4 | AG01428.4 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01428.4_R1.fastq.gz | fastq | 208326774.0 | 8582890.0 | AG01428.4 R1.fastq.gz | 0:24.27 1:0 | A:60934366;C:43916600;G:46106309;T:57368748;N:751 | 24 | 0 | 60934366 | 43916600 | 46106309 | 57368748 | 751 | SRX3058759 | SRS2404541 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.68998 | 0.05396 | 0.76374 | 0.51059 | 17 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43120 | 43120 | SRR5893087 | SRX3058758 | SRS2404541 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq PatA WT 64c PatA DMS B1 | dmsseq pata AG01428 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS PatA|molecule:RNA|selection:pA|condition:DMS|replicate group:22|replicate:1|BioSampleModel:Model organism or animal | DMS Seq PatA WT 64c PatA DMS B1 | AG01428.3 | AG01428.3 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01428.3_R1.fastq.gz | fastq | 201183036.0 | 8321263.0 | AG01428.3 R1.fastq.gz | 0:24.18 1:0 | A:58823768;C:42490237;G:44567988;T:55298599;N:2444 | 24 | 0 | 58823768 | 42490237 | 44567988 | 55298599 | 2444 | SRX3058758 | SRS2404541 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.6871 | 0.05281 | 0.76575 | 0.51538 | 30 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43121 | 43121 | SRR5893088 | SRX3058757 | SRS2404540 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq PatA WT 64c PatA DMS B2 | dmsseq pata AG01429 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS PatA|molecule:RNA|selection:pA|condition:DMS|replicate group:22|replicate:2|BioSampleModel:Model organism or animal | DMS Seq PatA WT 64c PatA DMS B2 | AG01429.5 | AG01429.5 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01429.5_R1.fastq.gz | fastq | 1025355643.0 | 41973110.0 | AG01429.5 R1.fastq.gz | 0:24.43 1:0 | A:286439080;C:223476222;G:247260097;T:268171035;N:9209 | 24 | 0 | 286439080 | 223476222 | 247260097 | 268171035 | 9209 | SRX3058757 | SRS2404540 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.69958 | 0.04484 | 0.76558 | 0.51603 | 29 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43122 | 43122 | SRR5893089 | SRX3058756 | SRS2404540 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq PatA WT 64c PatA DMS B2 | dmsseq pata AG01429 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS PatA|molecule:RNA|selection:pA|condition:DMS|replicate group:22|replicate:2|BioSampleModel:Model organism or animal | DMS Seq PatA WT 64c PatA DMS B2 | AG01429.4 | AG01429.4 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01429.4_R1.fastq.gz | fastq | 145578062.0 | 5944282.0 | AG01429.4 R1.fastq.gz | 0:24.49 1:0 | A:40943195;C:31523692;G:34943324;T:38167309;N:542 | 24 | 0 | 40943195 | 31523692 | 34943324 | 38167309 | 542 | SRX3058756 | SRS2404540 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.70235 | 0.04557 | 0.76341 | 0.5093 | 38 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43123 | 43123 | SRR5893090 | SRX3058755 | SRS2404540 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq PatA WT 64c PatA DMS B2 | dmsseq pata AG01429 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS PatA|molecule:RNA|selection:pA|condition:DMS|replicate group:22|replicate:2|BioSampleModel:Model organism or animal | DMS Seq PatA WT 64c PatA DMS B2 | AG01429.3 | AG01429.3 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01429.3_R1.fastq.gz | fastq | 140022273.0 | 5737910.0 | AG01429.3 R1.fastq.gz | 0:24.40 1:0 | A:39343164;C:30378209;G:33656711;T:36642421;N:1768 | 24 | 0 | 39343164 | 30378209 | 33656711 | 36642421 | 1768 | SRX3058755 | SRS2404540 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.69621 | 0.04502 | 0.764 | 0.51161 | 28 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43124 | 43124 | SRR5893091 | SRX3058754 | SRS2404540 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq PatA WT 64c PatA DMS B2 | dmsseq pata AG01429 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS PatA|molecule:RNA|selection:pA|condition:DMS|replicate group:22|replicate:2|BioSampleModel:Model organism or animal | DMS Seq PatA WT 64c PatA DMS B2 | AG01429.2 | AG01429.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01429.2_R1.fastq.gz | fastq | 155400644.0 | 6350801.0 | AG01429.2 R1.fastq.gz | 0:24.47 1:0 | A:43541418;C:33799983;G:37361242;T:40698001;N:0 | 24 | 0 | 43541418 | 33799983 | 37361242 | 40698001 | 0 | SRX3058754 | SRS2404540 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.70153 | 0.04589 | 0.76495 | 0.51164 | 21 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43127 | 43127 | SRR5893094 | SRX3058751 | SRS2404542 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c in vivo | dmsseq AG01042 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo|molecule:RNA|selection:pA|condition:DMS|replicate group:14|replicate:1|BioSampleModel:Model organism or animal | DMS Seq WT 64c in vivo | AG01042.1 | AG01042.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG01042.1_R1.fastq.gz | fastq | 126429566.0 | 5343149.0 | AG01042.1 R1.fastq.gz | 0:23.66 1:0 | A:33794193;C:29213503;G:32293032;T:31128226;N:612 | 23 | 0 | 33794193 | 29213503 | 32293032 | 31128226 | 612 | SRX3058751 | SRS2404542 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.60436 | 0.07589 | 0.78179 | 0.58081 | 23 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43128 | 43128 | SRR5893095 | SRX3058750 | SRS2404542 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c in vivo | dmsseq AG01042 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo|molecule:RNA|selection:pA|condition:DMS|replicate group:14|replicate:1|BioSampleModel:Model organism or animal | DMS Seq WT 64c in vivo | AG01042.2 | AG01042.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG01042.2_R1.fastq.gz | fastq | 43162881.0 | 1835075.0 | AG01042.2 R1.fastq.gz | 0:23.52 1:0 | A:11533531;C:9954515;G:11073245;T:10599502;N:2088 | 23 | 0 | 11533531 | 9954515 | 11073245 | 10599502 | 2088 | SRX3058750 | SRS2404542 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.58191 | 0.07361 | 0.78255 | 0.5884 | 27 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43129 | 43129 | SRR5893096 | SRX3058749 | SRS2404532 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c DMScontrol in vitro | dmsseq AG00876 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:water in vitro|molecule:RNA|selection:pA|condition:control|replicate group:13|replicate:1|BioSampleModel:Model organism or animal | DMS Seq WT 64c DMScontrol in vitro | AG00876.3 | AG00876.3 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG00876.3_R1.fastq.gz | fastq | 981554972.0 | 12915197.0 | AG00876.3 R1.fastq.gz | 0:76 | A:261237433;C:277515571;G:240090014;T:202665429;N:46525 | 76 | 261237433 | 277515571 | 240090014 | 202665429 | 46525 | SRX3058749 | SRS2404532 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 2e-05 | 0.0 | 0.99995 | 1.0 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 43130 | 43130 | SRR5893097 | SRX3058748 | SRS2404532 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c DMScontrol in vitro | dmsseq AG00876 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:water in vitro|molecule:RNA|selection:pA|condition:control|replicate group:13|replicate:1|BioSampleModel:Model organism or animal | DMS Seq WT 64c DMScontrol in vitro | AG00876.4 | AG00876.4 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG00876.4_R1.fastq.gz | fastq | 662935688.0 | 8722838.0 | AG00876.4 R1.fastq.gz | 0:76 | A:176751346;C:187148186;G:162147575;T:136873146;N:15435 | 76 | 176751346 | 187148186 | 162147575 | 136873146 | 15435 | SRX3058748 | SRS2404532 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.0 | 0.0 | 1.0 | 76 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||||
| 43131 | 43131 | SRR5893098 | SRX3058747 | SRS2404542 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c in vivo | dmsseq AG01042 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo|molecule:RNA|selection:pA|condition:DMS|replicate group:14|replicate:1|BioSampleModel:Model organism or animal | DMS Seq WT 64c in vivo | AG01042.5 | AG01042.5 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG01042.5_R1.fastq.gz | fastq | 1080031154.0 | 45488589.0 | AG01042.5 R1.fastq.gz | 0:23.74 1:0 | A:290744683;C:247189003;G:273714462;T:268297982;N:85024 | 23 | 0 | 290744683 | 247189003 | 273714462 | 268297982 | 85024 | SRX3058747 | SRS2404542 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.60791 | 0.07492 | 0.77979 | 0.58326 | 29 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43132 | 43132 | SRR5893099 | SRX3058746 | SRS2404542 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c in vivo | dmsseq AG01042 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo|molecule:RNA|selection:pA|condition:DMS|replicate group:14|replicate:1|BioSampleModel:Model organism or animal | DMS Seq WT 64c in vivo | AG01042.6 | AG01042.6 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG01042.6_R1.fastq.gz | fastq | 283394970.0 | 12033965.0 | AG01042.6 R1.fastq.gz | 0:23.55 1:0 | A:76195456;C:65114236;G:72044677;T:70039067;N:1534 | 23 | 0 | 76195456 | 65114236 | 72044677 | 70039067 | 1534 | SRX3058746 | SRS2404542 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.59876 | 0.07667 | 0.78135 | 0.58397 | 33 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43133 | 43133 | SRR5893100 | SRX3058745 | SRS2404542 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c in vivo | dmsseq AG01042 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo|molecule:RNA|selection:pA|condition:DMS|replicate group:14|replicate:1|BioSampleModel:Model organism or animal | DMS Seq WT 64c in vivo | AG01042.3 | AG01042.3 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG01042.3_R1.fastq.gz | fastq | 635217690.0 | 26879456.0 | AG01042.3 R1.fastq.gz | 0:23.63 1:0 | A:169915710;C:146718321;G:161940079;T:156641690;N:1890 | 23 | 0 | 169915710 | 146718321 | 161940079 | 156641690 | 1890 | SRX3058745 | SRS2404542 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.60186 | 0.07604 | 0.78186 | 0.58928 | 29 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43134 | 43134 | SRR5893101 | SRX3058744 | SRS2404542 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c in vivo | dmsseq AG01042 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo|molecule:RNA|selection:pA|condition:DMS|replicate group:14|replicate:1|BioSampleModel:Model organism or animal | DMS Seq WT 64c in vivo | AG01042.4 | AG01042.4 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG01042.4_R1.fastq.gz | fastq | 737360617.0 | 31187809.0 | AG01042.4 R1.fastq.gz | 0:23.64 1:0 | A:197816552;C:169921394;G:187620043;T:181992000;N:10628 | 23 | 0 | 197816552 | 169921394 | 187620043 | 181992000 | 10628 | SRX3058744 | SRS2404542 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.60088 | 0.07706 | 0.78046 | 0.547 | 15 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43137 | 43137 | SRR5893104 | SRX3058741 | SRS2404544 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c in vivo | dmsseq AG01046 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo|molecule:RNA|selection:pA|condition:DMS|replicate group:14|replicate:2|BioSampleModel:Model organism or animal | DMS Seq WT 64c in vivo | AG01046.1 | AG01046.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG01046.1_R1.fastq.gz | fastq | 104571264.0 | 4565699.0 | AG01046.1 R1.fastq.gz | 0:22.90 1:0 | A:26920338;C:24177052;G:26506298;T:26967196;N:380 | 22 | 0 | 26920338 | 24177052 | 26506298 | 26967196 | 380 | SRX3058741 | SRS2404544 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.5641 | 0.06574 | 0.78437 | 0.58268 | 15 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43138 | 43138 | SRR5893105 | SRX3058740 | SRS2404544 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c in vivo | dmsseq AG01046 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo|molecule:RNA|selection:pA|condition:DMS|replicate group:14|replicate:2|BioSampleModel:Model organism or animal | DMS Seq WT 64c in vivo | AG01046.2 | AG01046.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG01046.2_R1.fastq.gz | fastq | 34508189.0 | 1516870.0 | AG01046.2 R1.fastq.gz | 0:22.75 1:0 | A:8891670;C:7954125;G:8796911;T:8864593;N:890 | 22 | 0 | 8891670 | 7954125 | 8796911 | 8864593 | 890 | SRX3058740 | SRS2404544 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.54153 | 0.06305 | 0.7852 | 0.5792 | 19 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43139 | 43139 | SRR5893106 | SRX3058739 | SRS2404544 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c in vivo | dmsseq AG01046 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo|molecule:RNA|selection:pA|condition:DMS|replicate group:14|replicate:2|BioSampleModel:Model organism or animal | DMS Seq WT 64c in vivo | AG01046.3 | AG01046.3 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG01046.3_R1.fastq.gz | fastq | 559711334.0 | 24457578.0 | AG01046.3 R1.fastq.gz | 0:22.88 1:0 | A:144168923;C:129246711;G:141668875;T:144625154;N:1671 | 22 | 0 | 144168923 | 129246711 | 141668875 | 144625154 | 1671 | SRX3058739 | SRS2404544 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.56488 | 0.06449 | 0.7838 | 0.57611 | 20 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43140 | 43140 | SRR5893107 | SRX3058738 | SRS2404544 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c in vivo | dmsseq AG01046 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo|molecule:RNA|selection:pA|condition:DMS|replicate group:14|replicate:2|BioSampleModel:Model organism or animal | DMS Seq WT 64c in vivo | AG01046.4 | AG01046.4 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG01046.4_R1.fastq.gz | fastq | 639006387.0 | 27909373.0 | AG01046.4 R1.fastq.gz | 0:22.90 1:0 | A:165043321;C:147246240;G:161359572;T:165354476;N:2778 | 22 | 0 | 165043321 | 147246240 | 161359572 | 165354476 | 2778 | SRX3058738 | SRS2404544 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.56251 | 0.06604 | 0.78417 | 0.57986 | 18 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43141 | 43141 | SRR5893108 | SRX3058737 | SRS2404544 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c in vivo | dmsseq AG01046 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo|molecule:RNA|selection:pA|condition:DMS|replicate group:14|replicate:2|BioSampleModel:Model organism or animal | DMS Seq WT 64c in vivo | AG01046.5 | AG01046.5 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG01046.5_R1.fastq.gz | fastq | 810814539.0 | 35324852.0 | AG01046.5 R1.fastq.gz | 0:22.95 1:0 | A:209392559;C:186085613;G:205018734;T:210262020;N:55613 | 22 | 0 | 209392559 | 186085613 | 205018734 | 210262020 | 55613 | SRX3058737 | SRS2404544 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.57046 | 0.06498 | 0.78423 | 0.5699 | 22 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43142 | 43142 | SRR5893109 | SRX3058736 | SRS2404544 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c in vivo | dmsseq AG01046 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo|molecule:RNA|selection:pA|condition:DMS|replicate group:14|replicate:2|BioSampleModel:Model organism or animal | DMS Seq WT 64c in vivo | AG01046.6 | AG01046.6 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2500 | SRP114782 | AG01046.6_R1.fastq.gz | fastq | 364856161.0 | 16004319.0 | AG01046.6 R1.fastq.gz | 0:22.80 1:0 | A:94562115;C:83891926;G:92182690;T:94217438;N:1992 | 22 | 0 | 94562115 | 83891926 | 92182690 | 94217438 | 1992 | SRX3058736 | SRS2404544 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.56018 | 0.06351 | 0.78421 | 0.58178 | 15 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43172 | 43172 | SRR5893139 | SRX3058706 | SRS2404557 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c CHX B1 | dmsseq AG01273 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo cyclohex|molecule:RNA|selection:pA|condition:DMS|replicate group:18|replicate:1|BioSampleModel:Model organism or animal | DMS Seq WT 64c CHX B1 | AG01273.1 | AG01273.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01273.1_R1.fastq.gz | fastq | 205385355.0 | 9210408.0 | AG01273.1 R1.fastq.gz | 0:22.30 1:0 | A:55663483;C:47328873;G:50322223;T:52066694;N:4082 | 22 | 0 | 55663483 | 47328873 | 50322223 | 52066694 | 4082 | SRX3058706 | SRS2404557 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.60509 | 0.06208 | 0.78417 | 0.57855 | 26 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43173 | 43173 | SRR5893140 | SRX3058705 | SRS2404557 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c CHX B1 | dmsseq AG01273 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo cyclohex|molecule:RNA|selection:pA|condition:DMS|replicate group:18|replicate:1|BioSampleModel:Model organism or animal | DMS Seq WT 64c CHX B1 | AG01273.2 | AG01273.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01273.2_R1.fastq.gz | fastq | 187794014.0 | 8402532.0 | AG01273.2 R1.fastq.gz | 0:22.35 1:0 | A:51237074;C:43080418;G:45763165;T:47701058;N:12299 | 22 | 0 | 51237074 | 43080418 | 45763165 | 47701058 | 12299 | SRX3058705 | SRS2404557 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.60944 | 0.06401 | 0.78393 | 0.58071 | 22 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43174 | 43174 | SRR5893141 | SRX3058704 | SRS2404558 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | RPF patA WT 64c PatA RPF B2 | ribo seq pata AG01412 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:cyclohex PatA|molecule:RNA|condition:RPF 28nt|replicate group:20|replicate:2|BioSampleModel:Model organism or animal | RPF patA WT 64c PatA RPF B2 | AG01412.1 | AG01412.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01412.1_R1.fastq.gz | fastq | 2162256802.0 | 75040267.0 | AG01412.1 R1.fastq.gz | 0:28.81 1:0 | A:347363501;C:619335399;G:838844065;T:356708961;N:4876 | 28 | 0 | 347363501 | 619335399 | 838844065 | 356708961 | 4876 | SRX3058704 | SRS2404558 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.97696 | 0.23102 | 0.98936 | 0.86543 | 27 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43175 | 43175 | SRR5893142 | SRX3058703 | SRS2404559 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | RPF patA WT 64c PatA RPF B1 | ribo seq pata AG01411 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:cyclohex PatA|molecule:RNA|condition:RPF 28nt|replicate group:20|replicate:1|BioSampleModel:Model organism or animal | RPF patA WT 64c PatA RPF B1 | AG01411.1 | AG01411.1 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01411.1_R1.fastq.gz | fastq | 1910107983.0 | 66035087.0 | AG01411.1 R1.fastq.gz | 0:28.93 1:0 | A:300687332;C:552860495;G:739754137;T:316801751;N:4268 | 28 | 0 | 300687332 | 552860495 | 739754137 | 316801751 | 4268 | SRX3058703 | SRS2404559 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.97889 | 0.23202 | 0.98924 | 0.90161 | 25 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||||
| 43176 | 43176 | SRR5893143 | SRX3058702 | SRS2404560 | SRP114782 | PRJNA397065 | mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis | PRJNA397065 | Other | RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis. | DMS Seq WT 64c CHX B2 | dmsseq AG01274 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS in vivo cyclohex|molecule:RNA|selection:pA|condition:DMS|replicate group:18|replicate:2|BioSampleModel:Model organism or animal | DMS Seq WT 64c CHX B2 | AG01274.2 | AG01274.2 | RNA | OTHER | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP114782 | AG01274.2_R1.fastq.gz | fastq | 459461300.0 | 20542141.0 | AG01274.2 R1.fastq.gz | 0:22.37 1:0 | A:124126012;C:105390527;G:112976938;T:116937505;N:30318 | 22 | 0 | 124126012 | 105390527 | 112976938 | 116937505 | 30318 | SRX3058702 | SRS2404560 | SRA596275 | Yale_Giraldez|Genetics | Yale_Giraldez_Group | 1 | 0.59447 | 0.06348 | 0.7821 | 0.57589 | 20 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2018-06-07 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;