RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

480 rows where devstage_curation = "Cleavage" and experiment.library_strategy = "RNA-Seq"

✎ View and edit SQL

This data as json, CSV (advanced)

experiment.library_selection 6

tissue_curation 5

technology 5

experiment.platform 5

experiment.library_source 2

experiment.library_layout 2

experiment.library_strategy 1

  • RNA-Seq · 480 ✖

devstage_curation_coarse 1

devstage_curation 1

  • Cleavage · 480 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
71 71 DRR032753 DRX029559 DRS049958 DRP003810 PRJDB3785 EXPANDE project DRP003810 Other EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.     mRNA extracted from pooled embryos of 114 individuals Dr 8cell 2 SAMD00028150   sample name:Dr 8cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male female and mixed                 Illumina HiSeq 2000 sequencing of SAMD00028150 DRX029559 Dr 8cell 2 1 Total RNA QIAGEN RNeasy followed by TruSeq   RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003810 Illumina HiSeq 2000 sequencing of SAMD00028150       3708921900.0 37089219.0 DRR032753 0:100 1:0 A:985502141;C:874161613;G:869551685;T:979663686;N:42775 100 0     985502141 874161613 869551685 979663686 42775 DRX029559 DRS049958 DRA003460 UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo 1 0.93329   0.02366   0.78896   0.47447   100   B   usable mapping rate illumina hiseq_era unknown other trueseq bulk unknown unknown   Japan 2017-09-20 Cleavage Embryo Whole Organism All anatomical structures
72 72 DRR032752 DRX029558 DRS049957 DRP003810 PRJDB3785 EXPANDE project DRP003810 Other EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.     mRNA extracted from pooled embryos of 96 individuals Dr 8cell 1 SAMD00028149   sample name:Dr 8cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male female and mixed                 Illumina HiSeq 2000 sequencing of SAMD00028149 DRX029558 Dr 8cell 1 1 Total RNA QIAGEN RNeasy followed by TruSeq   RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003810 Illumina HiSeq 2000 sequencing of SAMD00028149       3666991200.0 36669912.0 DRR032752 0:100 1:0 A:976118513;C:862559696;G:858017821;T:970254302;N:40868 100 0     976118513 862559696 858017821 970254302 40868 DRX029558 DRS049957 DRA003460 UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo 1 0.934   0.02403   0.78877   0.46902   100   B   usable mapping rate illumina hiseq_era unknown other trueseq bulk unknown unknown   Japan 2017-09-20 Cleavage Embryo Whole Organism All anatomical structures
86 86 DRR032738 DRX029544 DRS049943 DRP003810 PRJDB3785 EXPANDE project DRP003810 Other EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.     mRNA extracted from pooled embryos of 100 individuals Dr 32cell 2 SAMD00028135   sample name:Dr 32cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male female and mixed                 Illumina HiSeq 2000 sequencing of SAMD00028135 DRX029544 Dr 32cell 2 1 Total RNA QIAGEN RNeasy followed by TruSeq   RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003810 Illumina HiSeq 2000 sequencing of SAMD00028135       3678713000.0 36787130.0 DRR032738 0:100 1:0 A:981005900;C:863203049;G:859660640;T:974807835;N:35576 100 0     981005900 863203049 859660640 974807835 35576 DRX029544 DRS049943 DRA003460 UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo 1 0.93302   0.02468   0.77441   0.47485   100   B   usable mapping rate illumina hiseq_era unknown other trueseq bulk unknown unknown   Japan 2017-09-20 Cleavage Embryo Whole Organism All anatomical structures
87 87 DRR032737 DRX029543 DRS049942 DRP003810 PRJDB3785 EXPANDE project DRP003810 Other EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.     mRNA extracted from pooled embryos of 95 individuals Dr 32cell 1 SAMD00028134   sample name:Dr 32cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male female and mixed                 Illumina HiSeq 2000 sequencing of SAMD00028134 DRX029543 Dr 32cell 1 1 Total RNA QIAGEN RNeasy followed by TruSeq   RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003810 Illumina HiSeq 2000 sequencing of SAMD00028134       3870906500.0 38709065.0 DRR032737 0:100 1:0 A:1030407751;C:909948718;G:905608620;T:1024897443;N:43968 100 0     1030407751 909948718 905608620 1024897443 43968 DRX029543 DRS049942 DRA003460 UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo 1 0.93364   0.02484   0.77307   0.47588   100   B   usable mapping rate illumina hiseq_era unknown other trueseq bulk unknown unknown   Japan 2017-09-20 Cleavage Embryo Whole Organism All anatomical structures
90 90 DRR032734 DRX029540 DRS049939 DRP003810 PRJDB3785 EXPANDE project DRP003810 Other EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.     mRNA extracted from pooled embryos of 107 individuals Dr 2cell 2 SAMD00028131   sample name:Dr 2cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male female and mixed                 Illumina HiSeq 2000 sequencing of SAMD00028131 DRX029540 Dr 2cell 2 1 Total RNA QIAGEN RNeasy followed by TruSeq   RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003810 Illumina HiSeq 2000 sequencing of SAMD00028131       3687517000.0 36875170.0 DRR032734 0:100 1:0 A:975272080;C:873518282;G:869743434;T:968941851;N:41353 100 0     975272080 873518282 869743434 968941851 41353 DRX029540 DRS049939 DRA003460 UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo 1 0.93204   0.02088   0.81639   0.47553   100   B   usable mapping rate illumina hiseq_era unknown other trueseq bulk unknown unknown   Japan 2017-09-20 Cleavage Embryo Whole Organism All anatomical structures
91 91 DRR032733 DRX029539 DRS049938 DRP003810 PRJDB3785 EXPANDE project DRP003810 Other EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.     mRNA extracted from pooled embryos of 108 individuals Dr 2cell 1 SAMD00028130   sample name:Dr 2cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male female and mixed                 Illumina HiSeq 2000 sequencing of SAMD00028130 DRX029539 Dr 2cell 1 1 Total RNA QIAGEN RNeasy followed by TruSeq   RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> DRP003810 Illumina HiSeq 2000 sequencing of SAMD00028130       4156651100.0 41566511.0 DRR032733 0:100 1:0 A:1099943617;C:985498415;G:978884426;T:1092278665;N:45977 100 0     1099943617 985498415 978884426 1092278665 45977 DRX029539 DRS049938 DRA003460 UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo 1 0.93452   0.02198   0.81197   0.47342   100   B   usable mapping rate illumina hiseq_era unknown other trueseq bulk unknown unknown   Japan 2017-09-20 Cleavage Embryo Whole Organism All anatomical structures
3155 3155 ERR1410225 ERX1481464 ERS1021813 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool12 SAMEA3714664 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714664|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:11Z|INSDC status:public|Submitter Id:e9237f50 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCAGCTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e9237f50 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#24 15565967 Illumina sequencing of library 15565967 constructed from sample accession ERS1021813 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCAGCTC. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#24.cram cram 682856330.0 5252741.0 SC RUN 18730 4#24 0:55 1:75 A:168217714;C:139075008;G:141169282;T:234338870;N:55456 55 75     168217714 139075008 141169282 234338870 55456 ERX1481464 ERS1021813 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.22601 0.6266 0.06302 0.07433 0.95848 0.87767 0.77147 0.72121 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3156 3156 ERR1410224 ERX1481463 ERS1021812 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool11 SAMEA3714663 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714663|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:10Z|INSDC status:public|Submitter Id:e91834b0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACTAGTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e91834b0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#23 15565966 Illumina sequencing of library 15565966 constructed from sample accession ERS1021812 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACTAGTC. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#23.cram cram 784669730.0 6035921.0 SC RUN 18730 4#23 0:55 1:75 A:193369040;C:154930839;G:157589012;T:278718023;N:62816 55 75     193369040 154930839 157589012 278718023 62816 ERX1481463 ERS1021812 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.22113 0.66423 0.05856 0.07177 0.95899 0.86705 0.76036 0.71777 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3157 3157 ERR1410223 ERX1481462 ERS1021811 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool10 SAMEA3714662 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714662|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:10Z|INSDC status:public|Submitter Id:e90c9bf0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCAGATTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e90c9bf0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#22 15565965 Illumina sequencing of library 15565965 constructed from sample accession ERS1021811 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCAGATTC. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#22.cram cram 1247901590.0 9599243.0 SC RUN 18730 4#22 0:55 1:75 A:314703461;C:244320464;G:241561095;T:447214667;N:101903 55 75     314703461 244320464 241561095 447214667 101903 ERX1481462 ERS1021811 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.20694 0.62963 0.04856 0.05487 0.95763 0.87026 0.7137 0.71273 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3158 3158 ERR1410222 ERX1481461 ERS1021810 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool9 SAMEA3714661 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714661|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:09Z|INSDC status:public|Submitter Id:e8fe4410 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TATGCCAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8fe4410 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#21 15565964 Illumina sequencing of library 15565964 constructed from sample accession ERS1021810 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TATGCCAG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#21.cram cram 1160974880.0 8930576.0 SC RUN 18730 4#21 0:55 1:75 A:287583127;C:233701395;G:225242195;T:414354028;N:94135 55 75     287583127 233701395 225242195 414354028 94135 ERX1481461 ERS1021810 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.20242 0.60852 0.05828 0.06484 0.95568 0.87456 0.67452 0.38749 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3159 3159 ERR1410221 ERX1481460 ERS1021809 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool8 SAMEA3714660 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714660|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:08Z|INSDC status:public|Submitter Id:e8f2d260 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGGCTCAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8f2d260 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#20 15565963 Illumina sequencing of library 15565963 constructed from sample accession ERS1021809 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGGCTCAG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#20.cram cram 1041644630.0 8012651.0 SC RUN 18730 4#20 0:55 1:75 A:250361997;C:216927117;G:209137594;T:365137042;N:80880 55 75     250361997 216927117 209137594 365137042 80880 ERX1481460 ERS1021809 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.23722 0.6381 0.05317 0.07562 0.95503 0.87671 0.75995 0.72353 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3160 3160 ERR1410220 ERX1481459 ERS1021808 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool7 SAMEA3714659 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714659|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:08Z|INSDC status:public|Submitter Id:e8e787c0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCATTGAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8e787c0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#19 15565962 Illumina sequencing of library 15565962 constructed from sample accession ERS1021808 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCATTGAG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#19.cram cram 1002402180.0 7710786.0 SC RUN 18730 4#19 0:55 1:75 A:249654737;C:203437995;G:194586976;T:354640685;N:81787 55 75     249654737 203437995 194586976 354640685 81787 ERX1481459 ERS1021808 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.21081 0.61197 0.04352 0.05852 0.9529 0.86815 0.65385 0.64824 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3161 3161 ERR1410219 ERX1481458 ERS1021807 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool6 SAMEA3714658 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714658|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:07Z|INSDC status:public|Submitter Id:e8dc3d20 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGTATGCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8dc3d20 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#18 15565961 Illumina sequencing of library 15565961 constructed from sample accession ERS1021807 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGTATGCG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#18.cram cram 1001271050.0 7702085.0 SC RUN 18730 4#18 0:55 1:75 A:249131077;C:206043698;G:193568917;T:352446609;N:80749 55 75     249131077 206043698 193568917 352446609 80749 ERX1481458 ERS1021807 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.22004 0.6117 0.05313 0.0656 0.95095 0.8758 0.70135 0.69364 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3162 3162 ERR1410218 ERX1481457 ERS1021806 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool5 SAMEA3714657 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714657|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:06Z|INSDC status:public|Submitter Id:e8b183a0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCCAGTCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8b183a0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#17 15565960 Illumina sequencing of library 15565960 constructed from sample accession ERS1021806 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCCAGTCG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#17.cram cram 1240938140.0 9545678.0 SC RUN 18730 4#17 0:55 1:75 A:302318036;C:249218633;G:246601321;T:442702025;N:98125 55 75     302318036 249218633 246601321 442702025 98125 ERX1481457 ERS1021806 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.23057 0.63523 0.05319 0.067 0.95213 0.86695 0.69753 0.68537 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3163 3163 ERR1410217 ERX1481456 ERS1021805 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool4 SAMEA3714656 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714656|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:06Z|INSDC status:public|Submitter Id:e8ab9030 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAAGTTCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8ab9030 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#16 15565959 Illumina sequencing of library 15565959 constructed from sample accession ERS1021805 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAAGTTCG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#16.cram cram 942829030.0 7252531.0 SC RUN 18730 4#16 0:55 1:75 A:225274547;C:196341691;G:188483755;T:332654028;N:75009 55 75     225274547 196341691 188483755 332654028 75009 ERX1481456 ERS1021805 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.21889 0.64365 0.04363 0.07265 0.95181 0.87478 0.70501 0.69162 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3164 3164 ERR1410216 ERX1481455 ERS1021804 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool3 SAMEA3714655 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714655|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:05Z|INSDC status:public|Submitter Id:e8a5eae0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCAGGAGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8a5eae0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#15 15565958 Illumina sequencing of library 15565958 constructed from sample accession ERS1021804 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCAGGAGG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#15.cram cram 992671030.0 7635931.0 SC RUN 18730 4#15 0:55 1:75 A:241776762;C:210080049;G:195284057;T:345448849;N:81313 55 75     241776762 210080049 195284057 345448849 81313 ERX1481455 ERS1021804 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.21439 0.6195 0.04725 0.05379 0.95191 0.87606 0.67336 0.65016 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3165 3165 ERR1410215 ERX1481454 ERS1021803 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool2 SAMEA3714654 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714654|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:05Z|INSDC status:public|Submitter Id:e89cc320 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCTCACGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e89cc320 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#14 15565957 Illumina sequencing of library 15565957 constructed from sample accession ERS1021803 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCTCACGG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#14.cram cram 1234311910.0 9494707.0 SC RUN 18730 4#14 0:55 1:75 A:301439259;C:257228602;G:244500849;T:431043241;N:99959 55 75     301439259 257228602 244500849 431043241 99959 ERX1481454 ERS1021803 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.19348 0.62337 0.04021 0.05986 0.95574 0.87941 0.67064 0.69696 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3166 3166 ERR1410214 ERX1481453 ERS1021802 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool1 SAMEA3714653 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714653|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:04Z|INSDC status:public|Submitter Id:e897ba10 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACTTCGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e897ba10 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#13 15565956 Illumina sequencing of library 15565956 constructed from sample accession ERS1021802 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACTTCGG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#13.cram cram 1039867140.0 7998978.0 SC RUN 18730 4#13 0:55 1:75 A:252384576;C:218519074;G:206578085;T:362298880;N:86525 55 75     252384576 218519074 206578085 362298880 86525 ERX1481453 ERS1021802 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.18713 0.60956 0.05049 0.0817 0.95556 0.87618 0.66594 0.68034 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3167 3167 ERR1410213 ERX1481452 ERS1021801 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 12 SAMEA3714652 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714652|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:04Z|INSDC status:public|Submitter Id:e89262e0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGAACTGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e89262e0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#12 15565955 Illumina sequencing of library 15565955 constructed from sample accession ERS1021801 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGAACTGG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#12.cram cram 1071792020.0 8244554.0 SC RUN 18730 4#12 0:55 1:75 A:266291261;C:216074486;G:207838804;T:381495628;N:91841 55 75     266291261 216074486 207838804 381495628 91841 ERX1481452 ERS1021801 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.19027 0.64477 0.0489 0.06997 0.95268 0.86371 0.66594 0.67162 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3168 3168 ERR1410212 ERX1481451 ERS1021800 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 11 SAMEA3714651 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714651|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:03Z|INSDC status:public|Submitter Id:e88d59d0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTGGTATG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88d59d0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#11 15565954 Illumina sequencing of library 15565954 constructed from sample accession ERS1021800 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTGGTATG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#11.cram cram 686164570.0 5278189.0 SC RUN 18730 4#11 0:55 1:75 A:165352345;C:146328635;G:134343947;T:240083817;N:55826 55 75     165352345 146328635 134343947 240083817 55826 ERX1481451 ERS1021800 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.22823 0.61844 0.08567 0.10696 0.95106 0.86797 0.62805 0.63179 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3169 3169 ERR1410211 ERX1481450 ERS1021799 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 10 SAMEA3714650 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714650|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:03Z|INSDC status:public|Submitter Id:e88829b0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAACGCTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88829b0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#10 15565953 Illumina sequencing of library 15565953 constructed from sample accession ERS1021799 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAACGCTG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#10.cram cram 889043870.0 6838799.0 SC RUN 18730 4#10 0:55 1:75 A:223435089;C:179282347;G:171273337;T:314981588;N:71509 55 75     223435089 179282347 171273337 314981588 71509 ERX1481450 ERS1021799 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.19054 0.6472 0.0467 0.06495 0.953 0.86519 0.68221 0.68725 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3170 3170 ERR1410210 ERX1481449 ERS1021798 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 9 SAMEA3714649 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714649|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:02Z|INSDC status:public|Submitter Id:e88320a0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCGAAGTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88320a0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#9 15565952 Illumina sequencing of library 15565952 constructed from sample accession ERS1021798 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCGAAGTG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#9.cram cram 987809940.0 7598538.0 SC RUN 18730 4#9 0:55 1:75 A:248484130;C:197140774;G:188385871;T:353715305;N:83860 55 75     248484130 197140774 188385871 353715305 83860 ERX1481449 ERS1021798 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.2215 0.62639 0.05009 0.06362 0.94959 0.86689 0.63702 0.63984 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3171 3171 ERR1410209 ERX1481448 ERS1021797 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 8 SAMEA3714648 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714648|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:02Z|INSDC status:public|Submitter Id:e87d5440 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCCATTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e87d5440 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#8 15565951 Illumina sequencing of library 15565951 constructed from sample accession ERS1021797 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCCATTG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#8.cram cram 991993340.0 7630718.0 SC RUN 18730 4#8 0:55 1:75 A:248601530;C:201637312;G:190701521;T:350971271;N:81706 55 75     248601530 201637312 190701521 350971271 81706 ERX1481448 ERS1021797 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.18071 0.60546 0.04372 0.05614 0.95556 0.87182 0.64904 0.68316 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3172 3172 ERR1410208 ERX1481447 ERS1021796 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 7 SAMEA3714647 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714647|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e871e290 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAGTCTTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e871e290 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#7 15565950 Illumina sequencing of library 15565950 constructed from sample accession ERS1021796 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAGTCTTG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#7.cram cram 1355591770.0 10427629.0 SC RUN 18730 4#7 0:55 1:75 A:333761549;C:285155703;G:270975293;T:465589806;N:109419 55 75     333761549 285155703 270975293 465589806 109419 ERX1481447 ERS1021796 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.19403 0.63995 0.03449 0.07104 0.957 0.88641 0.73288 0.71598 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3173 3173 ERR1410207 ERX1481446 ERS1021795 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 6 SAMEA3714646 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714646|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e86670e0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGTGGTTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e86670e0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#6 15565949 Illumina sequencing of library 15565949 constructed from sample accession ERS1021795 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGTGGTTG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#6.cram cram 1121411330.0 8626241.0 SC RUN 18730 4#6 0:55 1:75 A:275436070;C:245845272;G:219970219;T:380067436;N:92333 55 75     275436070 245845272 219970219 380067436 92333 ERX1481446 ERS1021795 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.185 0.59026 0.03934 0.06143 0.95268 0.88968 0.59393 0.69736 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3174 3174 ERR1410206 ERX1481445 ERS1021794 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 5 SAMEA3714645 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714645|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e85b2640 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCCTCAAT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e85b2640 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#5 15565948 Illumina sequencing of library 15565948 constructed from sample accession ERS1021794 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCCTCAAT. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#5.cram cram 852544290.0 6558033.0 SC RUN 18730 4#5 0:55 1:75 A:202033234;C:177211087;G:169900063;T:303332405;N:67501 55 75     202033234 177211087 169900063 303332405 67501 ERX1481445 ERS1021794 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.21445 0.62891 0.0753 0.09655 0.95278 0.86929 0.61569 0.48656 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3175 3175 ERR1410205 ERX1481444 ERS1021793 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 4 SAMEA3714644 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714644|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:00Z|INSDC status:public|Submitter Id:e84f8d80 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACAGGAT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e84f8d80 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#4 15565947 Illumina sequencing of library 15565947 constructed from sample accession ERS1021793 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACAGGAT. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#4.cram cram 989803880.0 7613876.0 SC RUN 18730 4#4 0:55 1:75 A:241562947;C:196888151;G:193862254;T:357404172;N:86356 55 75     241562947 196888151 193862254 357404172 86356 ERX1481444 ERS1021793 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.27131 0.63988 0.04128 0.04919 0.95923 0.88292 0.81011 0.7508 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3176 3176 ERR1410204 ERX1481443 ERS1021792 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 3 SAMEA3714643 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714643|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:00Z|INSDC status:public|Submitter Id:e8441bd0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAGTGACT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8441bd0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#3 15565946 Illumina sequencing of library 15565946 constructed from sample accession ERS1021792 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAGTGACT. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#3.cram cram 1144202930.0 8801561.0 SC RUN 18730 4#3 0:55 1:75 A:278906912;C:230946498;G:229591661;T:404660425;N:97434 55 75     278906912 230946498 229591661 404660425 97434 ERX1481443 ERS1021792 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.24055 0.6437 0.04616 0.05861 0.9554 0.88221 0.30306 0.73916 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3177 3177 ERR1410203 ERX1481442 ERS1021791 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 2 SAMEA3714642 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714642|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:41:59Z|INSDC status:public|Submitter Id:e8385c00 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCCTGCT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8385c00 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#2 15565945 Illumina sequencing of library 15565945 constructed from sample accession ERS1021791 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCCTGCT. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#2.cram cram 1459339960.0 11225692.0 SC RUN 18730 4#2 0:55 1:75 A:361580033;C:294777861;G:295641568;T:507221717;N:118781 55 75     361580033 294777861 295641568 507221717 118781 ERX1481442 ERS1021791 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.25446 0.64481 0.04258 0.05864 0.95473 0.88562 0.32211 0.75437 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3178 3178 ERR1410202 ERX1481441 ERS1021790 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 1 SAMEA3714641 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714641|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:41:58Z|INSDC status:public|Submitter Id:e73ff240 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGCGATCT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e73ff240 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#1 15565944 Illumina sequencing of library 15565944 constructed from sample accession ERS1021790 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGCGATCT. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#1.cram cram 869624210.0 6689417.0 SC RUN 18730 4#1 0:55 1:75 A:211816407;C:178380016;G:176641186;T:302714073;N:72528 55 75     211816407 178380016 176641186 302714073 72528 ERX1481441 ERS1021790 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.26789 0.63129 0.0568 0.09239 0.95978 0.88978 0.82999 0.78005 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3788 3788 ERR1442900 ERX1513277 ERS1079219 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 F SAMEA3892085 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 2#70 16564972 Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence GATCTCTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_2#70.cram cram 364410400.0 1822052.0 SC RUN 19912 2#70 0:100 1:100 A:96471898;C:85460940;G:85739185;T:96152266;N:586111 100 100     96471898 85460940 85739185 96152266 586111 ERX1513277 ERS1079219 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96377 0.96719 0.0976 0.09955 0.79667 0.79693 0.58832 0.58226 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3789 3789 ERR1442899 ERX1513276 ERS1079218 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 E SAMEA3892084 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 2#69 16564960 Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence GGTGAGTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_2#69.cram cram 312144800.0 1560724.0 SC RUN 19912 2#69 0:100 1:100 A:82044388;C:74027006;G:73985684;T:81583681;N:504041 100 100     82044388 74027006 73985684 81583681 504041 ERX1513276 ERS1079218 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96275 0.9677 0.10631 0.10791 0.79496 0.79535 0.57643 0.57303 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3790 3790 ERR1442898 ERX1513275 ERS1079217 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 D SAMEA3892083 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 2#68 16564948 Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TGCGTGAA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_2#68.cram cram 330453000.0 1652265.0 SC RUN 19912 2#68 0:100 1:100 A:87696659;C:77248972;G:77394239;T:87578108;N:535022 100 100     87696659 77248972 77394239 87578108 535022 ERX1513275 ERS1079217 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96171 0.96419 0.10779 0.11047 0.79902 0.80018 0.57383 0.56925 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3791 3791 ERR1442897 ERX1513274 ERS1079216 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 C SAMEA3892082 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 2#67 16564936 Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TACCACCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_2#67.cram cram 327261000.0 1636305.0 SC RUN 19912 2#67 0:100 1:100 A:87523901;C:75771535;G:75871608;T:87573282;N:520674 100 100     87523901 75771535 75871608 87573282 520674 ERX1513274 ERS1079216 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.95986 0.96354 0.1123 0.11468 0.80156 0.80229 0.58372 0.58338 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3792 3792 ERR1442896 ERX1513273 ERS1079215 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 B SAMEA3892081 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 2#66 16564924 Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TGAAGCCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_2#66.cram cram 328496600.0 1642483.0 SC RUN 19912 2#66 0:100 1:100 A:86841947;C:77278436;G:77262516;T:86589805;N:523896 100 100     86841947 77278436 77262516 86589805 523896 ERX1513273 ERS1079215 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96091 0.96535 0.1279 0.13047 0.79805 0.79857 0.58551 0.58209 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3878 3878 ERR1442810 ERX1513187 ERS1079219 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 F SAMEA3892085 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 1#70 16564972 Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence GATCTCTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_1#70.cram cram 364912600.0 1824563.0 SC RUN 19912 1#70 0:100 1:100 A:96642496;C:85588675;G:85883202;T:96301393;N:496834 100 100     96642496 85588675 85883202 96301393 496834 ERX1513187 ERS1079219 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96362 0.96689 0.09725 0.09882 0.79592 0.79703 0.59097 0.5784 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3879 3879 ERR1442809 ERX1513186 ERS1079218 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 E SAMEA3892084 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 1#69 16564960 Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence GGTGAGTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_1#69.cram cram 312470400.0 1562352.0 SC RUN 19912 1#69 0:100 1:100 A:82160555;C:74100532;G:74069193;T:81696066;N:444054 100 100     82160555 74100532 74069193 81696066 444054 ERX1513186 ERS1079218 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96376 0.96859 0.10642 0.1079 0.79417 0.79474 0.5752 0.57 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3880 3880 ERR1442808 ERX1513185 ERS1079217 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 D SAMEA3892083 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 1#68 16564948 Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TGCGTGAA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_1#68.cram cram 330554000.0 1652770.0 SC RUN 19912 1#68 0:100 1:100 A:87747224;C:77298685;G:77439701;T:87616982;N:451408 100 100     87747224 77298685 77439701 87616982 451408 ERX1513185 ERS1079217 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96163 0.96436 0.10875 0.1111 0.79928 0.79965 0.57561 0.5708 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3881 3881 ERR1442807 ERX1513184 ERS1079216 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 C SAMEA3892082 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 1#67 16564936 Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TACCACCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_1#67.cram cram 327019400.0 1635097.0 SC RUN 19912 1#67 0:100 1:100 A:87453957;C:75726607;G:75847551;T:87546870;N:444415 100 100     87453957 75726607 75847551 87546870 444415 ERX1513184 ERS1079216 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96147 0.9625 0.11258 0.11475 0.79825 0.79924 0.58372 0.56917 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3882 3882 ERR1442806 ERX1513183 ERS1079215 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 B SAMEA3892081 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 1#66 16564924 Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TGAAGCCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_1#66.cram cram 327613800.0 1638069.0 SC RUN 19912 1#66 0:100 1:100 A:86594522;C:77121933;G:77114321;T:86338082;N:444942 100 100     86594522 77121933 77114321 86338082 444942 ERX1513183 ERS1079215 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.9614 0.96527 0.12823 0.13043 0.79762 0.79922 0.58597 0.5851 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3968 3968 ERR1442720 ERX1513097 ERS1079219 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 F SAMEA3892085 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 2#70 16564972 Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence GATCTCTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_2#70.cram cram 371283800.0 1856419.0 SC RUN 19850 2#70 0:100 1:100 A:98443439;C:87187703;G:87417381;T:98100142;N:135135 100 100     98443439 87187703 87417381 98100142 135135 ERX1513097 ERS1079219 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96411 0.96451 0.09692 0.09902 0.79657 0.7964 0.58932 0.57779 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3969 3969 ERR1442719 ERX1513096 ERS1079218 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 E SAMEA3892084 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 2#69 16564960 Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence GGTGAGTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_2#69.cram cram 318491400.0 1592457.0 SC RUN 19850 2#69 0:100 1:100 A:83845999;C:75642375;G:75561647;T:83330437;N:110942 100 100     83845999 75642375 75561647 83330437 110942 ERX1513096 ERS1079218 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96388 0.96834 0.10544 0.10741 0.79336 0.79417 0.57217 0.56939 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3970 3970 ERR1442718 ERX1513095 ERS1079217 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 D SAMEA3892083 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 2#68 16564948 Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TGCGTGAA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_2#68.cram cram 335548800.0 1677744.0 SC RUN 19850 2#68 0:100 1:100 A:89188408;C:78543202;G:78653253;T:89044211;N:119726 100 100     89188408 78543202 78653253 89044211 119726 ERX1513095 ERS1079217 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96211 0.96612 0.10777 0.11055 0.79724 0.79876 0.57249 0.43044 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3971 3971 ERR1442717 ERX1513094 ERS1079216 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 C SAMEA3892082 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 2#67 16564936 Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TACCACCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_2#67.cram cram 331952200.0 1659761.0 SC RUN 19850 2#67 0:100 1:100 A:88872903;C:76957606;G:77065688;T:88935012;N:120991 100 100     88872903 76957606 77065688 88935012 120991 ERX1513094 ERS1079216 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96191 0.96393 0.11342 0.11468 0.799 0.79908 0.58219 0.58045 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3972 3972 ERR1442716 ERX1513093 ERS1079215 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 B SAMEA3892081 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 2#66 16564924 Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TGAAGCCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_2#66.cram cram 333024200.0 1665121.0 SC RUN 19850 2#66 0:100 1:100 A:88172616;C:78454066;G:78393792;T:87885914;N:117812 100 100     88172616 78454066 78393792 87885914 117812 ERX1513093 ERS1079215 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96249 0.96556 0.1289 0.13166 0.79945 0.79961 0.58336 0.58063 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
4058 4058 ERR1442630 ERX1513007 ERS1079219 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 F SAMEA3892085 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 1#70 16564972 Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence GATCTCTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_1#70.cram cram 371578800.0 1857894.0 SC RUN 19850 1#70 0:100 1:100 A:98533022;C:87264222;G:87555118;T:98151909;N:74529 100 100     98533022 87264222 87555118 98151909 74529 ERX1513007 ERS1079219 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.9636 0.96761 0.09699 0.09916 0.79525 0.79553 0.58618 0.57988 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
4059 4059 ERR1442629 ERX1513006 ERS1079218 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 E SAMEA3892084 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 1#69 16564960 Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence GGTGAGTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_1#69.cram cram 318342200.0 1591711.0 SC RUN 19850 1#69 0:100 1:100 A:83801083;C:75621628;G:75578752;T:83271737;N:69000 100 100     83801083 75621628 75578752 83271737 69000 ERX1513006 ERS1079218 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96351 0.96877 0.10486 0.10713 0.79423 0.79444 0.57288 0.57375 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
4060 4060 ERR1442628 ERX1513005 ERS1079217 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 D SAMEA3892083 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 1#68 16564948 Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TGCGTGAA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_1#68.cram cram 334846000.0 1674230.0 SC RUN 19850 1#68 0:100 1:100 A:88989528;C:78413149;G:78541907;T:88833028;N:68388 100 100     88989528 78413149 78541907 88833028 68388 ERX1513005 ERS1079217 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96197 0.96681 0.10873 0.11111 0.79805 0.7992 0.57474 0.57198 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
4061 4061 ERR1442627 ERX1513004 ERS1079216 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 C SAMEA3892082 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 1#67 16564936 Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TACCACCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_1#67.cram cram 332077800.0 1660389.0 SC RUN 19850 1#67 0:100 1:100 A:88958890;C:76946124;G:77079866;T:89022508;N:70412 100 100     88958890 76946124 77079866 89022508 70412 ERX1513004 ERS1079216 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96162 0.96369 0.11367 0.11586 0.7992 0.79855 0.58505 0.58088 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
4062 4062 ERR1442626 ERX1513003 ERS1079215 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 B SAMEA3892081 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 1#66 16564924 Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TGAAGCCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_1#66.cram cram 332776400.0 1663882.0 SC RUN 19850 1#66 0:100 1:100 A:88108657;C:78400833;G:78371292;T:87823689;N:71929 100 100     88108657 78400833 78371292 87823689 71929 ERX1513003 ERS1079215 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96154 0.96535 0.12909 0.13161 0.79815 0.79959 0.58756 0.58417 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
8090 8090 ERR034125 ERX012651 ERS032266 ERP000635 PRJEB2512 The Zebrafish transcriptome during early development KI-BN-JKE-DRERIO-RNASEQ-2011 Transcriptome Analysis Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions.     RNA extracted from zebrafish embryo at 16 cell stage zebrafish embryo 16 cell SAMEA791631 Department of Biosciences and Nutrition, Karolinska Institutet, Sweden ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791631|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 16cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 16cell|sex:mixed|strain:Tuebingen                 Transcriptome profiling of early zebrafish development KI BN JKE DRERIO RNASEQ 2011 16cell JKE Drerio rna seq Transcriptome profiling of 16 cell stage of zebrafish embryos. Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems.   RNA-Seq TRANSCRIPTOMIC RANDOM SINGLE ABI_SOLID AB SOLiD System 3.0 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> ERP000635 AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16 KI-BN-JKE-DRERIO-RNASEQ-2011-16cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-16cell_QV.qual.gz SOLiD_native SOLiD_native 4256756500.0 85135130.0 KI BN JKE DRERIO RNASEQ 2011 16cell 0:50   50                 ERX012651 ERS032266 ERA029959 KI-BN|Department of Biosciences and Nutrition Department of Biosciences and Nutrition, Karolinska Institutet, Sweden 1 0.57946   0.08115   0.91896   0.72164   50   B   usable mapping rate legacy early unknown random_priming unknown bulk unknown unknown   Sweden 2011-06-09 Cleavage Embryo Embryo Imprecise All anatomical structures
9296 9296 ERR202508 ERX177193 ERS092407 ERP001280 PRJEB2925 maternal to Zygotic Transition maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 Transcriptome Analysis During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.         SAMEA1570569 SC ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:T/LF|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:29Z|External Id:SAMEA1570569|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:29Z|INSDC status:public|Submitter Id:2C TotRNA sc 2012 02 06T13:12:17Z 1121923|common name:zebrafish|sample description:RNA seq|sample name:2C TotRNA sc 2012 02 06T13:12:17Z 1121923|scientific name:Danio rerio|strain:T/LF                 1 SC EXP 6683 2 2532385 Illumina sequencing of library 2532385 constructed from sample accession ERS092407 for study accession ERP001280. Illumina cDNA protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP001280 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 6683_2.bam bam 11463941550.0 76426277.0 SC RUN 6683 2 0:75 1:75 A:2384324967;C:3291391074;G:3291238330;T:2457078635;N:39908544 75 75     2384324967 3291391074 3291238330 2457078635 39908544 ERX177193 ERS092407 ERA176708 SC Wellcome Sanger Institute 2 0.96484 0.95918 0.35968 0.35526 0.88404 0.88485 0.84949 0.8524 75 75 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2012-11-28 Cleavage Embryo Whole Organism All anatomical structures
9298 9298 ERR202506 ERX177191 ERS092405 ERP001280 PRJEB2925 maternal to Zygotic Transition maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 Transcriptome Analysis During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.         SAMEA1570534 SC ArrayExpress DevelopmentalStage:16 cell|ArrayExpress Genotype:T/LF|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:25Z|External Id:SAMEA1570534|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:25Z|INSDC status:public|Submitter Id:16C stan pro sc 2012 02 06T13:12:14Z 1121921|common name:zebrafish|sample description:RNA seq|sample name:16C stan pro sc 2012 02 06T13:12:14Z 1121921|scientific name:Danio rerio|strain:T/LF                 1 SC EXP 6317 5 2532383 Illumina sequencing of library 2532383 constructed from sample accession ERS092405 for study accession ERP001280. Illumina cDNA protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP001280 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 6317_5.bam bam 7092438300.0 47282922.0 SC RUN 6317 5 0:75 1:75 A:1947926886;C:1582039071;G:1595096528;T:1959471222;N:7904593 75 75     1947926886 1582039071 1595096528 1959471222 7904593 ERX177191 ERS092405 ERA176708 SC Wellcome Sanger Institute 2 0.90801 0.90631 0.0426 0.04216 0.78486 0.78539 0.4795 0.47872 75 75 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2012-11-28 Cleavage Embryo Whole Organism All anatomical structures
9301 9301 ERR202503 ERX177188 ERS092094 ERP001280 PRJEB2925 maternal to Zygotic Transition maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 Transcriptome Analysis During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.         SAMEA1570566 SC ArrayExpress DevelopmentalStage:64 cell|ArrayExpress Genotype:SAT/WIK|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:31Z|External Id:SAMEA1570566|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:31Z|INSDC status:public|Submitter Id:SAT b sc 2012 02 06T13:05:45Z 998060|common name:zebrafish|sample description:RNA seq|sample name:SAT b sc 2012 02 06T13:05:45Z 998060|scientific name:Danio rerio|strain:SAT                 1 SC EXP 5552 6 1476240 Illumina sequencing of library 1476240 constructed from sample accession ERS092094 for study accession ERP001280. Illumina cDNA protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina Genome Analyzer II   ERP001280 Illumina Genome Analyzer II paired end sequencing ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 5552_6.bam bam 3031861428.0 28072791.0 SC RUN 5552 6 0:54 1:54 A:827548202;C:685397282;G:689217947;T:827560833;N:2137164 54 54     827548202 685397282 689217947 827560833 2137164 ERX177188 ERS092094 ERA176708 SC Wellcome Sanger Institute 2 0.88709 0.8867 0.04219 0.04381 0.76836 0.76978 0.48688 0.48607 54 54 B B biological fallback assumption illumina early_illumina unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2012-11-28 Cleavage Embryo Whole Organism All anatomical structures
9304 9304 ERR202500 ERX177185 ERS092093 ERP001280 PRJEB2925 maternal to Zygotic Transition maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 Transcriptome Analysis During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.         SAMEA1570541 SC ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:SAT/WIK|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:13Z|External Id:SAMEA1570541|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:13Z|INSDC status:public|Submitter Id:SAT a sc 2012 02 06T13:05:43Z 998059|common name:zebrafish|sample description:RNA seq|sample name:SAT a sc 2012 02 06T13:05:43Z 998059|scientific name:Danio rerio|strain:SAT                 1 SC EXP 5540 7 1392795 Illumina sequencing of library 1392795 constructed from sample accession ERS092093 for study accession ERP001280. Illumina cDNA protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina Genome Analyzer II   ERP001280 Illumina Genome Analyzer II paired end sequencing ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 5540_7.bam bam 4139896608.0 38332376.0 SC RUN 5540 7 0:54 1:54 A:1123995667;C:935834208;G:933659183;T:1138309303;N:8098247 54 54     1123995667 935834208 933659183 1138309303 8098247 ERX177185 ERS092093 ERA176708 SC Wellcome Sanger Institute 2 0.89473 0.89261 0.0475 0.0496 0.80413 0.80551 0.49672 0.49064 54 54 B B biological fallback assumption illumina early_illumina unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2012-11-28 Cleavage Embryo Whole Organism All anatomical structures
9308 9308 ERR202496 ERX177181 ERS092089 ERP001280 PRJEB2925 maternal to Zygotic Transition maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 Transcriptome Analysis During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.         SAMEA1570537 SC ArrayExpress DevelopmentalStage:64 cell|ArrayExpress Genotype:WIK/SAT|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:15Z|External Id:SAMEA1570537|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:15Z|INSDC status:public|Submitter Id:WIK b sc 2012 02 06T13:05:39Z 998055|common name:zebrafish|sample description:RNA seq|sample name:WIK b sc 2012 02 06T13:05:39Z 998055|scientific name:Danio rerio|strain:WIK                 1 SC EXP 5540 2 1392791 Illumina sequencing of library 1392791 constructed from sample accession ERS092089 for study accession ERP001280. Illumina cDNA protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina Genome Analyzer II   ERP001280 Illumina Genome Analyzer II paired end sequencing ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 5540_2.bam bam 3934066536.0 36426542.0 SC RUN 5540 2 0:54 1:54 A:1089272408;C:875257818;G:871131618;T:1090449345;N:7955347 54 54     1089272408 875257818 871131618 1090449345 7955347 ERX177181 ERS092089 ERA176708 SC Wellcome Sanger Institute 2 0.92002 0.92014 0.04875 0.05104 0.76061 0.76161 0.4821 0.48296 54 54 B B biological fallback assumption illumina early_illumina unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2012-11-28 Cleavage Embryo Whole Organism All anatomical structures
9309 9309 ERR202495 ERX177180 ERS092088 ERP001280 PRJEB2925 maternal to Zygotic Transition maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 Transcriptome Analysis During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.         SAMEA1570572 SC ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:WIK/SAT|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:31Z|External Id:SAMEA1570572|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:31Z|INSDC status:public|Submitter Id:WIK a sc 2012 02 06T13:05:37Z 998054|common name:zebrafish|sample description:RNA seq|sample name:WIK a sc 2012 02 06T13:05:37Z 998054|scientific name:Danio rerio|strain:WIK                 1 SC EXP 5540 1 1392790 Illumina sequencing of library 1392790 constructed from sample accession ERS092088 for study accession ERP001280. Illumina cDNA protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina Genome Analyzer II   ERP001280 Illumina Genome Analyzer II paired end sequencing ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 5540_1.bam bam 4120158204.0 38149613.0 SC RUN 5540 1 0:54 1:54 A:1165514767;C:896704109;G:892695229;T:1156428740;N:8815359 54 54     1165514767 896704109 892695229 1156428740 8815359 ERX177180 ERS092088 ERA176708 SC Wellcome Sanger Institute 2 0.9228 0.92241 0.05498 0.05795 0.79091 0.79235 0.50034 0.50151 54 54 B B biological fallback assumption illumina early_illumina unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2012-11-28 Cleavage Embryo Whole Organism All anatomical structures
9726 9726 ERR3841993 ERX3854555 ERS3555998 ERP116106 PRJEB33323 Deconstructing the individual steps of vertebrate translation initiation ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 Other In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03     64 cell 2 SAMEA5752539 Computational Biology Unit ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752539|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:2|common name:zebrafish|dev stage:64 cell|sample name:2|scientific name:Danio rerio                 NextSeq 500 sequencing ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 3 64 cell 3 OTHER RNA Seq   RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA NextSeq 500   ERP116106 NextSeq 500 sequencing ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14     1579307816.0 20780366.0 ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 3 0:76 A:589876602;C:380048242;G:392473318;T:216893826;N:15828 76       589876602 380048242 392473318 216893826 15828 ERX3854555 ERS3555998 ERA2359305 Computational Biology Unit|European Nucleotide Archive Computational Biology Unit 1 0.15411   0.04564   0.97883   0.55376   76   B   usable mapping rate illumina nextseq unknown other unknown bulk unknown unknown   Unknown 2019-07-03 Cleavage Embryo Undetermined Embryo Imprecise
9727 9727 ERR3841992 ERX3854554 ERS3556003 ERP116106 PRJEB33323 Deconstructing the individual steps of vertebrate translation initiation ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 Other In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03     64 cell 4Ei 10 SAMEA5752544 Computational Biology Unit ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752544|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:7|common name:zebrafish|dev stage:64 cell|sample name:7|scientific name:Danio rerio                 NextSeq 500 sequencing ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 2 64 cell 4Ei OTHER RNA Seq   RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA NextSeq 500   ERP116106 NextSeq 500 sequencing ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14     1213585480.0 15968230.0 ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 2 0:76 A:548456563;C:244465528;G:271963808;T:148687764;N:11817 76       548456563 244465528 271963808 148687764 11817 ERX3854554 ERS3556003 ERA2359305 Computational Biology Unit|European Nucleotide Archive Computational Biology Unit 1 0.21973   0.10926   0.97419   0.44348   76   B   usable mapping rate illumina nextseq unknown other unknown bulk unknown unknown   Unknown 2019-07-03 Cleavage Embryo Undetermined Embryo Imprecise
9728 9728 ERR3841991 ERX3854553 ERS3555997 ERP116106 PRJEB33323 Deconstructing the individual steps of vertebrate translation initiation ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 Other In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03     64 cell 1 SAMEA5752538 Computational Biology Unit ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752538|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:1|common name:zebrafish|dev stage:64 cell|sample name:1|scientific name:Danio rerio                 NextSeq 500 sequencing ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:405 1 64 cell 1 OTHER RNA Seq   RNA-Seq TRANSCRIPTOMIC other SINGLE ILLUMINA NextSeq 500   ERP116106 NextSeq 500 sequencing ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14     1494930944.0 19670144.0 ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 1 0:76 A:543017836;C:366974203;G:367027373;T:217896401;N:15131 76       543017836 366974203 367027373 217896401 15131 ERX3854553 ERS3555997 ERA2359305 Computational Biology Unit|European Nucleotide Archive Computational Biology Unit 1 0.2544   0.08957   0.96568   0.55681   76   B   usable mapping rate illumina nextseq unknown other unknown bulk unknown unknown   Unknown 2019-07-03 Cleavage Embryo Undetermined Embryo Imprecise
9919 9919 ERR5167510 ERX4972431 ERS5593364 ERP122761 PRJEB39265 RNA dynamics during zebrafish development ena-STUDY-CENTER FOR GENOMIC REGULATION (CRG)-06-07-2020-15:41:43:771-1183 Other RNA dynamics during early zebrafish development ENA FIRST PUBLIC:2022 07 05|ENA LAST UPDATE:2022 07 05     cDNA WT 2hpf rep1 JD T20 PDPN191089   ENA FIRST PUBLIC:2022 07 05T12:06:34Z|organism:Danio rerio|ENA LAST UPDATE:2022 07 05T12:06:34Z|scientific name:Danio rerio|common name:zebrafish|ENA FIRST PUBLIC:2022 07 05|ENA LAST UPDATE:2022 07 05                 PromethION sequencing ena EXPERIMENT CENTER FOR GENOMIC REGULATION CRG 21 01 2021 22:16:50:154 1 unspecified 1     RNA-Seq TRANSCRIPTOMIC Oligo-dT SINGLE OXFORD_NANOPORE PromethION   ERP122761 PromethION sequencing ENA FIRST PUBLIC:2022 07 05|ENA LAST UPDATE:2022 07 05         ena RUN CENTER FOR GENOMIC REGULATION CRG 21 01 2021 22:16:50:154 1                       ERX4972431   ERA3319053 CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive CENTER FOR GENOMIC REGULATION (CRG)                             ont ont unknown poly_a unknown bulk unknown unknown   Spain 2022-07-05 Cleavage Embryo Undetermined Embryo Imprecise
24550 24550 ERR964668 ERX1041631 ERS792102 ERP011038 PRJEB9889 The Zebrafish transcriptome during early development ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22 Other Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation.       KI BN JKE DRERIO RNASEQ SAMEA3484817 KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484817|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 16cell|common name:zebrafish|dev stage:16 cell|sample name:KI BN JKE DRERIO RNASEQ 2009 16cell|strain:Tuebingen                 AB SOLiD System 3.0 sequencing ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:870 2 unspecified 1     RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD System 3.0   ERP011038 AB SOLiD System 3.0 sequencing ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16 KI-BN-JKE-DRERIO-RNASEQ-20090709-16cell_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20090709-16cell_F3_QV.qual.gz SOLiD_native SOLiD_native 5278508300.0 105570166.0 ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:871 2 0:50 0:1410981717;1:1203936808;2:1415708111;3:1223403795;.:24477869 50                 ERX1041631 ERS792102 ERA458495 KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 1 0.71371   0.09346   0.91539   0.73015   50   B   usable mapping rate legacy early full_length random_priming unknown bulk unknown unknown   Sweden 2015-07-15 Cleavage Embryo Undetermined Embryo Imprecise
24553 24553 ERR964672 ERX1041635 ERS792102 ERP011038 PRJEB9889 The Zebrafish transcriptome during early development ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22 Other Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation.       KI BN JKE DRERIO RNASEQ SAMEA3484817 KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484817|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 16cell|common name:zebrafish|dev stage:16 cell|sample name:KI BN JKE DRERIO RNASEQ 2009 16cell|strain:Tuebingen                 AB SOLiD System 3.0 sequencing ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:872 6 unspecified 1     RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD System 3.0   ERP011038 AB SOLiD System 3.0 sequencing ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16 KI-BN-JKE-DRERIO-RNASEQ-20091014-16cell_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20091014-16cell_F3_QV.qual.gz SOLiD_native SOLiD_native 2719433200.0 54388664.0 ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:872 6 0:50 0:699731678;1:628745158;2:754903505;3:633574679;.:2478180 50                 ERX1041635 ERS792102 ERA458495 KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 1 0.73214   0.09566   0.90836   0.74043   50   B   usable mapping rate legacy early full_length random_priming unknown bulk unknown unknown   Sweden 2015-07-15 Cleavage Embryo Undetermined Embryo Imprecise
28560 28560 SRR26395034 SRX22100899 SRS19166025 SRP466518 PRJNA1028258 Zygotic activation of transposable elements during zebrafish early embryogenesis PRJNA1028258 Other Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.   pubmed:40246845     64 cell RNA seq rep8   strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 8|BioSampleModel:Model organism or animal                 Illumina RNA seq of zebrafish: 64 cell replicate8 DR 035 DR 035 mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA HiSeq X Ten   SRP466518     C64-8_1.fq.gz C64-8_2.fq.gz fastq fastq 13755975120.0 50948056.0 C64 8 1.fq.gz 0:135 1:135 A:3658420874;C:3226727105;G:3239474262;T:3628930832;N:2422047 135 135     3658420874 3226727105 3239474262 3628930832 2422047 SRX22100899 SRS19166025 SRA1731898 University of Michigan|Computational Medicine and Bioinformatics University of Michigan 2 0.92463 0.92386 0.0253 0.02389 0.77441 0.77851 0.48196 0.47927 135 135 B B biological fallback assumption illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   United States 2023-10-16 Cleavage Embryo Embryo Imprecise All anatomical structures
28561 28561 SRR26395035 SRX22100898 SRS19166024 SRP466518 PRJNA1028258 Zygotic activation of transposable elements during zebrafish early embryogenesis PRJNA1028258 Other Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.   pubmed:40246845     64 cell RNA seq rep7   strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 7|BioSampleModel:Model organism or animal                 Illumina RNA seq of zebrafish: 64 cell replicate7 DR 034 DR 034 mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA HiSeq X Ten   SRP466518     C64-7_1.fq.gz C64-7_2.fq.gz fastq fastq 14250954780.0 52781314.0 C64 7 1.fq.gz 0:135 1:135 A:3810945650;C:3320623800;G:3339892194;T:3776960886;N:2532250 135 135     3810945650 3320623800 3339892194 3776960886 2532250 SRX22100898 SRS19166024 SRA1731898 University of Michigan|Computational Medicine and Bioinformatics University of Michigan 2 0.93734 0.93685 0.02705 0.02576 0.77553 0.7791 0.47481 0.47745 135 135 B B biological fallback assumption illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   United States 2023-10-16 Cleavage Embryo Embryo Imprecise All anatomical structures
28562 28562 SRR26395036 SRX22100897 SRS19166023 SRP466518 PRJNA1028258 Zygotic activation of transposable elements during zebrafish early embryogenesis PRJNA1028258 Other Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.   pubmed:40246845     64 cell RNA seq rep6   strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 6|BioSampleModel:Model organism or animal                 Illumina RNA seq of zebrafish: 64 cell replicate6 DR 033 DR 033 mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA HiSeq X Ten   SRP466518     C64-6_1.fq.gz C64-6_2.fq.gz fastq fastq 14251193190.0 52782197.0 C64 6 1.fq.gz 0:135 1:135 A:3801408063;C:3332053069;G:3345233238;T:3769986735;N:2512085 135 135     3801408063 3332053069 3345233238 3769986735 2512085 SRX22100897 SRS19166023 SRA1731898 University of Michigan|Computational Medicine and Bioinformatics University of Michigan 2 0.94348 0.94342 0.02571 0.02414 0.77112 0.77492 0.48218 0.4777 135 135 B B biological fallback assumption illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   United States 2023-10-16 Cleavage Embryo Embryo Imprecise All anatomical structures
28563 28563 SRR26395037 SRX22100896 SRS19166022 SRP466518 PRJNA1028258 Zygotic activation of transposable elements during zebrafish early embryogenesis PRJNA1028258 Other Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.   pubmed:40246845     64 cell RNA seq rep5   strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 5|BioSampleModel:Model organism or animal                 Illumina RNA seq of zebrafish: 64 cell replicate5 DR 032 DR 032 mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA HiSeq X Ten   SRP466518     C64-5_1.fq.gz C64-5_2.fq.gz fastq fastq 15142948650.0 56084995.0 C64 5 1.fq.gz 0:135 1:135 A:4031434744;C:3549307228;G:3562636129;T:3996868396;N:2702153 135 135     4031434744 3549307228 3562636129 3996868396 2702153 SRX22100896 SRS19166022 SRA1731898 University of Michigan|Computational Medicine and Bioinformatics University of Michigan 2 0.93753 0.93663 0.02519 0.024 0.77301 0.77674 0.47421 0.46951 135 135 B B biological fallback assumption illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   United States 2023-10-16 Cleavage Embryo Embryo Imprecise All anatomical structures
28564 28564 SRR26395038 SRX22100895 SRS19166021 SRP466518 PRJNA1028258 Zygotic activation of transposable elements during zebrafish early embryogenesis PRJNA1028258 Other Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.   pubmed:40246845     64 cell RNA seq rep4   strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 4|BioSampleModel:Model organism or animal                 Illumina RNA seq of zebrafish: 64 cell replicate4 DR 031 DR 031 mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA HiSeq X Ten   SRP466518     C64-4_1.fq.gz C64-4_2.fq.gz fastq fastq 14488466220.0 53660986.0 C64 4 1.fq.gz 0:135 1:135 A:3863267905;C:3389148218;G:3402037749;T:3831469669;N:2542679 135 135     3863267905 3389148218 3402037749 3831469669 2542679 SRX22100895 SRS19166021 SRA1731898 University of Michigan|Computational Medicine and Bioinformatics University of Michigan 2 0.93879 0.93825 0.02613 0.02437 0.77212 0.77577 0.47796 0.47196 135 135 B B biological fallback assumption illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   United States 2023-10-16 Cleavage Embryo Embryo Imprecise All anatomical structures
28566 28566 SRR26395040 SRX22100893 SRS19166019 SRP466518 PRJNA1028258 Zygotic activation of transposable elements during zebrafish early embryogenesis PRJNA1028258 Other Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.   pubmed:40246845     64 cell RNA seq rep3   strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 3|BioSampleModel:Model organism or animal                 Illumina RNA seq of zebrafish: 64 cell replicate3 DR 030 DR 030 mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA HiSeq X Ten   SRP466518     C64-3_1.fq.gz C64-3_2.fq.gz fastq fastq 16017940620.0 59325706.0 C64 3 1.fq.gz 0:135 1:135 A:4273558549;C:3744205640;G:3760255830;T:4237074764;N:2845837 135 135     4273558549 3744205640 3760255830 4237074764 2845837 SRX22100893 SRS19166019 SRA1731898 University of Michigan|Computational Medicine and Bioinformatics University of Michigan 2 0.93688 0.9383 0.02702 0.02595 0.77433 0.7767 0.47319 0.47413 135 135 B B biological fallback assumption illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   United States 2023-10-16 Cleavage Embryo Embryo Imprecise All anatomical structures
28567 28567 SRR26395041 SRX22100892 SRS19166018 SRP466518 PRJNA1028258 Zygotic activation of transposable elements during zebrafish early embryogenesis PRJNA1028258 Other Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.   pubmed:40246845     64 cell RNA seq rep2   strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 2|BioSampleModel:Model organism or animal                 Illumina RNA seq of zebrafish: 64 cell replicate2 DR 029 DR 029 mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA HiSeq X Ten   SRP466518     C64-2_1.fq.gz C64-2_2.fq.gz fastq fastq 16732836630.0 61973469.0 C64 2 1.fq.gz 0:135 1:135 A:4451249064;C:3924735460;G:3940154978;T:4413679398;N:3017730 135 135     4451249064 3924735460 3940154978 4413679398 3017730 SRX22100892 SRS19166018 SRA1731898 University of Michigan|Computational Medicine and Bioinformatics University of Michigan 2 0.94302 0.94257 0.02459 0.02333 0.77248 0.77479 0.47902 0.47678 135 135 B B biological fallback assumption illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   United States 2023-10-16 Cleavage Embryo Embryo Imprecise All anatomical structures
28568 28568 SRR26395042 SRX22100891 SRS19166017 SRP466518 PRJNA1028258 Zygotic activation of transposable elements during zebrafish early embryogenesis PRJNA1028258 Other Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.   pubmed:40246845     64 cell RNA seq rep1   strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 1|BioSampleModel:Model organism or animal                 Illumina RNA seq of zebrafish: 64 cell replicate1 DR 028 DR 028 mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage.     RNA-Seq TRANSCRIPTOMIC Oligo-dT PAIRED ILLUMINA HiSeq X Ten   SRP466518     C64-1_1.fq.gz C64-1_2.fq.gz fastq fastq 16459047450.0 60959435.0 C64 1 1.fq.gz 0:135 1:135 A:4391773658;C:3847087464;G:3866793612;T:4350489494;N:2903222 135 135     4391773658 3847087464 3866793612 4350489494 2903222 SRX22100891 SRS19166017 SRA1731898 University of Michigan|Computational Medicine and Bioinformatics University of Michigan 2 0.94676 0.94707 0.02568 0.0244 0.77236 0.77593 0.48374 0.47691 135 135 B B biological fallback assumption illumina hiseq_era unknown poly_a nebnext bulk unknown unknown   United States 2023-10-16 Cleavage Embryo Embryo Imprecise All anatomical structures
28576 28576 SRR26395050 SRX22100883 SRS19166009 SRP466518 PRJNA1028258 Zygotic activation of transposable elements during zebrafish early embryogenesis PRJNA1028258 Other Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age.   pubmed:40246845     64 cell Iso seq   strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 3|BioSampleModel:Model organism or animal                 PacBio Iso seq of zebrafish: 64 cell DR 003 DR 003 Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform.     RNA-Seq TRANSCRIPTOMIC Oligo-dT SINGLE PACBIO_SMRT Sequel   SRP466518     cell64_1.ccs.fq.gz cell64_2.ccs.fq.gz fastq fastq 2829660788.0 1238867.0 cell64 1.ccs.fq.gz 0:2284.07 A:765802910;C:646754322;G:668768985;T:748334571;N:0 2284       765802910 646754322 668768985 748334571 0 SRX22100883 SRS19166009 SRA1731898 University of Michigan|Computational Medicine and Bioinformatics University of Michigan 1 0.37504   0.00108   0.91149   0.48939   1913   T   long read pacbio pacbio_modern full_length poly_a unknown bulk unknown unknown   United States 2023-10-16 Cleavage Embryo Embryo Imprecise All anatomical structures
28935 28935 SRR26845669 SRX22541151 SRS19550737 SRP472252 PRJNA1040929 Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] GSE247933 Other Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. parent bioproject:PRJNA1040928     zebrafish 2hour wt 75mM s4u r2 GSM7903257   tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing zebrafish 2hour wt 75mM s4u r2 Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; Embryos at 2 hpf Embryos were injected with 1000pL of 75mM s4 UTP. Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF] GSM7903257 GSM7903257: zebrafish 2hour wt 75mM s4u r2; Danio rerio; RNA Seq GSM7903257 r1 GSM7903257 1 Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP472252   loader:fastq load.py s2h_2.fastq.gz fastq 4440596805.0 43966305.0 GSM7903257 r1 0:101 A:1543708731;C:806593065;G:905733733;T:1182095254;N:2466022 101       1543708731 806593065 905733733 1182095254 2466022 SRX22541151 SRS19550737 SRA1751928 Bazzini Lab, Stowers Institute for Medical Research Bazzini Lab, Stowers Institute for Medical Research 1 0.63778   0.15677   0.82676   0.61166   101   B   usable mapping rate illumina nextseq_v2 3prime small_rna lexogen bulk unknown unknown   United States 2023-11-15 Cleavage Embryo Embryo Imprecise All anatomical structures
28936 28936 SRR26845670 SRX22541150 SRS19550735 SRP472252 PRJNA1040929 Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] GSE247933 Other Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. parent bioproject:PRJNA1040928     zebrafish 2hour wt 75mM s4u r1 GSM7903256   tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing zebrafish 2hour wt 75mM s4u r1 Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; Embryos at 2 hpf Embryos were injected with 1000pL of 75mM s4 UTP. Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF] GSM7903256 GSM7903256: zebrafish 2hour wt 75mM s4u r1; Danio rerio; RNA Seq GSM7903256 r1 GSM7903256 1 Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP472252   loader:fastq load.py s2h_1.fastq.gz fastq 4689849655.0 46434155.0 GSM7903256 r1 0:101 A:1611038201;C:846984275;G:953714532;T:1275424861;N:2687786 101       1611038201 846984275 953714532 1275424861 2687786 SRX22541150 SRS19550735 SRA1751928 Bazzini Lab, Stowers Institute for Medical Research Bazzini Lab, Stowers Institute for Medical Research 1 0.67301   0.15612   0.82171   0.63462   101   B   usable mapping rate illumina nextseq_v2 3prime small_rna lexogen bulk unknown unknown   United States 2023-11-15 Cleavage Embryo Embryo Imprecise All anatomical structures
28937 28937 SRR26845671 SRX22541149 SRS19550733 SRP472252 PRJNA1040929 Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] GSE247933 Other Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. parent bioproject:PRJNA1040928     zebrafish 1hour wt 75mM s4u r3 GSM7903255   tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing zebrafish 1hour wt 75mM s4u r3 Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; Embryos at 1 hpf Embryos were injected with 1000pL of 75mM s4 UTP. Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF] GSM7903255 GSM7903255: zebrafish 1hour wt 75mM s4u r3; Danio rerio; RNA Seq GSM7903255 r1 GSM7903255 1 Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP472252   loader:fastq load.py s1h_3.fastq.gz fastq 5540992108.0 54861308.0 GSM7903255 r1 0:101 A:1856189531;C:1011042624;G:1124613529;T:1546055477;N:3090947 101       1856189531 1011042624 1124613529 1546055477 3090947 SRX22541149 SRS19550733 SRA1751928 Bazzini Lab, Stowers Institute for Medical Research Bazzini Lab, Stowers Institute for Medical Research 1 0.72187   0.16436   0.82416   0.64431   101   B   usable mapping rate illumina nextseq_v2 3prime small_rna lexogen bulk unknown unknown   United States 2023-11-15 Cleavage Embryo Embryo Imprecise All anatomical structures
28938 28938 SRR26845672 SRX22541148 SRS19550734 SRP472252 PRJNA1040929 Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] GSE247933 Other Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. parent bioproject:PRJNA1040928     zebrafish 1hour wt 75mM s4u r2 GSM7903254   tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing zebrafish 1hour wt 75mM s4u r2 Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; Embryos at 1 hpf Embryos were injected with 1000pL of 75mM s4 UTP. Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF] GSM7903254 GSM7903254: zebrafish 1hour wt 75mM s4u r2; Danio rerio; RNA Seq GSM7903254 r1 GSM7903254 1 Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP472252   loader:fastq load.py s1h_2.fastq.gz fastq 4572239397.0 45269697.0 GSM7903254 r1 0:101 A:1530268631;C:831534079;G:915378596;T:1292534173;N:2523918 101       1530268631 831534079 915378596 1292534173 2523918 SRX22541148 SRS19550734 SRA1751928 Bazzini Lab, Stowers Institute for Medical Research Bazzini Lab, Stowers Institute for Medical Research 1 0.72394   0.15187   0.81753   0.63236   101   B   usable mapping rate illumina nextseq_v2 3prime small_rna lexogen bulk unknown unknown   United States 2023-11-15 Cleavage Embryo Embryo Imprecise All anatomical structures
28939 28939 SRR26845673 SRX22541147 SRS19550732 SRP472252 PRJNA1040929 Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] GSE247933 Other Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. parent bioproject:PRJNA1040928     zebrafish 1hour wt 75mM s4u r1 GSM7903253   tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing zebrafish 1hour wt 75mM s4u r1 Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; Embryos at 1 hpf Embryos were injected with 1000pL of 75mM s4 UTP. Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF] GSM7903253 GSM7903253: zebrafish 1hour wt 75mM s4u r1; Danio rerio; RNA Seq GSM7903253 r1 GSM7903253 1 Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP472252   loader:fastq load.py s1h_1.fastq.gz fastq 4271986597.0 42296897.0 GSM7903253 r1 0:101 A:1447221671;C:787487923;G:887526673;T:1147409594;N:2340736 101       1447221671 787487923 887526673 1147409594 2340736 SRX22541147 SRS19550732 SRA1751928 Bazzini Lab, Stowers Institute for Medical Research Bazzini Lab, Stowers Institute for Medical Research 1 0.68805   0.18469   0.83175   0.62945   101   B   usable mapping rate illumina nextseq_v2 3prime small_rna lexogen bulk unknown unknown   United States 2023-11-15 Cleavage Embryo Embryo Imprecise All anatomical structures
29718 29718 SRR27485663 SRX23156886 SRS20107307 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           4 cell R3   strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:3|BioSampleModel:Model organism or animal                 mRNA seq of zebrafish: embryo 1 hpf rep4 EV06010 EV06010 RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode     RNA-Seq TRANSCRIPTOMIC Oligo-dT SINGLE ILLUMINA NextSeq 500   SRP482074     EV06010.R1.fastq.gz fastq 620142356.0 8227837.0 EV06010.R1.fastq.gz 0:75.37 A:186029536;C:118842640;G:134072972;T:181171903;N:25305 75       186029536 118842640 134072972 181171903 25305 SRX23156886 SRS20107307 SRA1783314 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.90656   0.06918   0.80192   0.72472   76   B   usable mapping rate illumina nextseq 3prime poly_a lexogen bulk unknown unknown   Austria 2024-01-11 Cleavage Embryo Whole Organism All anatomical structures
29725 29725 SRR27485670 SRX23156879 SRS20107300 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           4 cell R2   strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:2|BioSampleModel:Model organism or animal                 mRNA seq of zebrafish: embryo 1 hpf rep4 EV06003 EV06003 RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode     RNA-Seq TRANSCRIPTOMIC Oligo-dT SINGLE ILLUMINA NextSeq 500   SRP482074     EV06003.R1.fastq.gz fastq 706095550.0 9366364.0 EV06003.R1.fastq.gz 0:75.39 A:204324355;C:140058731;G:159377323;T:202282197;N:52944 75       204324355 140058731 159377323 202282197 52944 SRX23156879 SRS20107300 SRA1783314 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.90788   0.10297   0.80168   0.71073   76   B   usable mapping rate illumina nextseq 3prime poly_a lexogen bulk unknown unknown   Austria 2024-01-11 Cleavage Embryo Whole Organism All anatomical structures
29736 29736 SRR27477296 SRX23148651 SRS20099370 SRP482074 PRJNA1061456 tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development PRJNA1061456 Other           4 cell R4   strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:4|BioSampleModel:Model organism or animal                 mRNA seq of zebrafish: embryo 1 hpf rep4 EV09003 EV09003 RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode     RNA-Seq TRANSCRIPTOMIC Oligo-dT SINGLE ILLUMINA NextSeq 500   SRP482074     EV09003.R1.fastq.gz fastq 438955973.0 5837128.0 EV09003.R1.fastq.gz 0:75.20 A:134628611;C:87460856;G:98199538;T:118638244;N:28724 75       134628611 87460856 98199538 118638244 28724 SRX23148651 SRS20099370 SRA1782413 Medical University of Vienna|Cell and Developmental Biology Medical University of Vienna 1 0.89029   0.11994   0.80833   0.72581   76   B   usable mapping rate illumina nextseq 3prime poly_a lexogen bulk unknown unknown   Austria 2024-01-10 Cleavage Embryo Whole Organism All anatomical structures
30769 30769 SRR28348935 SRX23954961 SRS20755382 SRP495323 PRJNA1088158 Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis. GSE261646 Transcriptome Analysis The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and nee…   pubmed:39302832   Zebrafish Embryo 2hpf rep3 GSM8147858   source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing Zebrafish Embryo 2hpf rep3 Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates Whole embryo   Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.   tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF GSM8147858 GSM8147858: Zebrafish Embryo 2hpf rep3; Danio rerio; RNA Seq GSM8147858 r1 GSM8147858 1 Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP495323     s_2hpf_3.fastq fastq 1748504032.0 23006632.0 GSM8147858 r1 0:76 A:420580006;C:434589498;G:408972977;T:484281127;N:80424 76       420580006 434589498 408972977 484281127 80424 SRX23954961 SRS20755382 SRA1824599 Computational Biology, Stowers Institute for Medical Research Computational Biology, Stowers Institute for Medical Research                       B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk bulk bulk   United States 2024-03-14 Cleavage Embryo Whole Organism All anatomical structures
30770 30770 SRR28348936 SRX23954960 SRS20755381 SRP495323 PRJNA1088158 Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis. GSE261646 Transcriptome Analysis The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and nee…   pubmed:39302832   Zebrafish Embryo 2hpf rep2 GSM8147857   source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing Zebrafish Embryo 2hpf rep2 Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates Whole embryo   Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.   tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF GSM8147857 GSM8147857: Zebrafish Embryo 2hpf rep2; Danio rerio; RNA Seq GSM8147857 r1 GSM8147857 1 Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP495323     s_2hpf_2.fastq fastq 1578919456.0 20775256.0 GSM8147857 r1 0:76 A:380440230;C:393721925;G:368114931;T:436571104;N:71266 76       380440230 393721925 368114931 436571104 71266 SRX23954960 SRS20755381 SRA1824599 Computational Biology, Stowers Institute for Medical Research Computational Biology, Stowers Institute for Medical Research                       B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk bulk bulk   United States 2024-03-14 Cleavage Embryo Whole Organism All anatomical structures
30771 30771 SRR28348937 SRX23954959 SRS20755380 SRP495323 PRJNA1088158 Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis. GSE261646 Transcriptome Analysis The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and nee…   pubmed:39302832   Zebrafish Embryo 2hpf rep1 GSM8147856   source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing Zebrafish Embryo 2hpf rep1 Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates Whole embryo   Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.   tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF GSM8147856 GSM8147856: Zebrafish Embryo 2hpf rep1; Danio rerio; RNA Seq GSM8147856 r1 GSM8147856 1 Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP495323     s_2hpf_1.fastq fastq 1730435412.0 22768887.0 GSM8147856 r1 0:76 A:420026952;C:428388301;G:403718608;T:478219805;N:81746 76       420026952 428388301 403718608 478219805 81746 SRX23954959 SRS20755380 SRA1824599 Computational Biology, Stowers Institute for Medical Research Computational Biology, Stowers Institute for Medical Research                       B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk bulk bulk   United States 2024-03-14 Cleavage Embryo Whole Organism All anatomical structures
31528 31528 SRR28423881 SRX24027916 SRS20821688 SRP497294 PRJNA1090898 The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169 GSE262247 Transcriptome Analysis The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq. parent bioproject:PRJNA1090894 pubmed:39271818   ventricular cells myd88 / 24 hpci GSM8161054   source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing ventricular cells myd88 / 24 hpci Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs cardiac ventricles cardiac cryoinjury 24 hours prior to heart extraction Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.   tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury GSM8161054 GSM8161054: ventricular cells myd88 / 24 hpci; Danio rerio; RNA Seq GSM8161054 r1 GSM8161054 1 Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 2000   SRP497294     Pinelopi_10x_Zebrafish_Mut_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_Mut_Lib_R2.fastq.gz fastq fastq 31356990530.0 394538049.0 GSM8161054 r1 0:28 1:51.48 A:8573180857;C:6884590114;G:7520784498;T:8220228225;N:158206836 28 51     8573180857 6884590114 7520784498 8220228225 158206836 SRX24027916 SRS20821688 SRA1832827 MPI for heart and lung research MPI for heart and lung research                       T B sc-like readlen illumina nextseq_v2 unknown cdna_unspecified unknown sc single_cell_droplet 10x   Germany 2024-03-22 Cleavage Embryo Heart Cardiovascular System
31529 31529 SRR28423882 SRX24027915 SRS20821687 SRP497294 PRJNA1090898 The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169 GSE262247 Transcriptome Analysis The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq. parent bioproject:PRJNA1090894 pubmed:39271818   ventricular cells myd88+/+ 24 hpci GSM8161053   source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing ventricular cells myd88+/+ 24 hpci Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs cardiac ventricles cardiac cryoinjury 24 hours prior to heart extraction Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.   tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury GSM8161053 GSM8161053: ventricular cells myd88+/+ 24 hpci; Danio rerio; RNA Seq GSM8161053 r1 GSM8161053 1 Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 2000   SRP497294     Pinelopi_10x_Zebrafish_WT_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_WT_Lib_R2.fastq.gz fastq fastq 40672259373.0 511650018.0 GSM8161053 r1 0:28 1:51.49 A:11079272327;C:8809520398;G:9307205642;T:11269370263;N:206890743 28 51     11079272327 8809520398 9307205642 11269370263 206890743 SRX24027915 SRS20821687 SRA1832827 MPI for heart and lung research MPI for heart and lung research                       T B sc-like readlen illumina nextseq_v2 unknown cdna_unspecified unknown sc single_cell_droplet 10x   Germany 2024-03-22 Cleavage Embryo Heart Cardiovascular System
34036 34036 SRR31033345 SRX26418807 SRS22938440 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish Riboseq M 4cell 5 GSM8579730   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing Zebrafish Riboseq M 4cell 5 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a GSM8579730 GSM8579730: Zebrafish Riboseq M 4cell 5; Danio rerio; RNA Seq GSM8579730 r1 GSM8579730 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     M-4cell-5_L1_1.fq.gz M-4cell-5_L1_2.fq.gz fastq fastq 5643278100.0 18810927.0 GSM8579730 r1 0:150 1:150 A:1555401034;C:1268722567;G:1323837426;T:1495279385;N:37688 150 150     1555401034 1268722567 1323837426 1495279385 37688 SRX26418807 SRS22938440 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
34037 34037 SRR31033351 SRX26418806 SRS22938443 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish Riboseq M 4cell 4 GSM8579729   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing Zebrafish Riboseq M 4cell 4 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a GSM8579729 GSM8579729: Zebrafish Riboseq M 4cell 4; Danio rerio; RNA Seq GSM8579729 r1 GSM8579729 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     M-4cell-4_L1_1.fq.gz M-4cell-4_L1_2.fq.gz fastq fastq 6607232100.0 22024107.0 GSM8579729 r1 0:150 1:150 A:1825603885;C:1480833466;G:1538474482;T:1762276005;N:44262 150 150     1825603885 1480833466 1538474482 1762276005 44262 SRX26418806 SRS22938443 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
34038 34038 SRR31033346 SRX26418805 SRS22938438 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish Riboseq M 4cell 3 GSM8579728   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing Zebrafish Riboseq M 4cell 3 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a GSM8579728 GSM8579728: Zebrafish Riboseq M 4cell 3; Danio rerio; RNA Seq GSM8579728 r1 GSM8579728 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     M-4cell-3_L1_1.fq.gz M-4cell-3_L1_2.fq.gz fastq fastq 7948794900.0 26495983.0 GSM8579728 r1 0:150 1:150 A:2183592013;C:1794605656;G:1863773539;T:2106770087;N:53605 150 150     2183592013 1794605656 1863773539 2106770087 53605 SRX26418805 SRS22938438 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
34039 34039 SRR31033350 SRX26418804 SRS22938441 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish Riboseq M 4cell 2 GSM8579727   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing Zebrafish Riboseq M 4cell 2 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a GSM8579727 GSM8579727: Zebrafish Riboseq M 4cell 2; Danio rerio; RNA Seq GSM8579727 r1 GSM8579727 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     M-4cell-2_L1_1.fq.gz M-4cell-2_L1_2.fq.gz fastq fastq 7036510200.0 23455034.0 GSM8579727 r1 0:150 1:150 A:1830698676;C:1686461802;G:1754202163;T:1765099649;N:47910 150 150     1830698676 1686461802 1754202163 1765099649 47910 SRX26418804 SRS22938441 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
34047 34047 SRR31033355 SRX26418796 SRS22938428 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish RNAseq Sibling 4cell 4 GSM8579719   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing Zebrafish RNAseq Sibling 4cell 4 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type GSM8579719 GSM8579719: Zebrafish RNAseq Sibling 4cell 4; Danio rerio; RNA Seq GSM8579719 r1 GSM8579719 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     Sibling-4cell-4_L1_1.fq.gz Sibling-4cell-4_L1_2.fq.gz fastq fastq 7424662500.0 24748875.0 GSM8579719 r1 0:150 1:150 A:2045351766;C:1671617139;G:1731338149;T:1976305596;N:49850 150 150     2045351766 1671617139 1731338149 1976305596 49850 SRX26418796 SRS22938428 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
34048 34048 SRR31033358 SRX26418795 SRS22938431 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish RNAseq Sibling 4cell 2 GSM8579718   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing Zebrafish RNAseq Sibling 4cell 2 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type GSM8579718 GSM8579718: Zebrafish RNAseq Sibling 4cell 2; Danio rerio; RNA Seq GSM8579718 r1 GSM8579718 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     Sibling-4cell-2_L1_1.fq.gz Sibling-4cell-2_L1_2.fq.gz fastq fastq 6484454400.0 21614848.0 GSM8579718 r1 0:150 1:150 A:1701212104;C:1544478776;G:1597991536;T:1640728663;N:43321 150 150     1701212104 1544478776 1597991536 1640728663 43321 SRX26418795 SRS22938431 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
34049 34049 SRR31033356 SRX26418794 SRS22938430 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish RNAseq Sibling 4cell 1 GSM8579717   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing Zebrafish RNAseq Sibling 4cell 1 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type GSM8579717 GSM8579717: Zebrafish RNAseq Sibling 4cell 1; Danio rerio; RNA Seq GSM8579717 r1 GSM8579717 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     Sibling-4cell-1_L1_1.fq.gz Sibling-4cell-1_L1_2.fq.gz fastq fastq 8126999700.0 27089999.0 GSM8579717 r1 0:150 1:150 A:2195769442;C:1872416059;G:1934390760;T:2124367874;N:55565 150 150     2195769442 1872416059 1934390760 2124367874 55565 SRX26418794 SRS22938430 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
36258 36258 SRR062659 SRX025027 SRS085806 SRP003165 PRJNA127881 High throughput sequencing of mRNA from oocyte 1 cell 16/32 cells 128/256 cells 3.5hpf and 5.3hpf zebrafish embryos Wild type; AB line GSE22830 Transcriptome Analysis mRNA seq based approach to determine the transcriptome dynamics during early development To study the mechanisms regulating this developmental event in zebrafish we applied RNA deep sequencing technology and generated comprehensive transcriptome profiles of 6 developmental stages from oocyte to early gastrulation. We determined the expression levels of maternal and zygotic transcripts and clustered them based on expression pattern. We identified a large number of novel transcribed regions in un annotated regions of the genome as well as splice variants with an estimated frequency of 40 75% during early zebrafish embryogenesis. Our data constitute a useful resource for developmental studies gene discovery and genome annotation. Overall design: RNA was extracted from pooled embryos of desired stages and one RNA seq library was generated for each sample. Totally 6 stages were selected: Maternal 1cell 16/32 cells 128/256 cells 3.5hpf and 5.3hpf   pubmed:21555364;pubmed:24586560;pubmed:23676078   16/32 cells GSM564429   tissue:developing embryos|background:AB; wild type|developmental stage:mixure of 16/32 cell embryos 16/32 cells ABI pipeline BioScope v1.0.1 Data analysis: The SOLiD generated RNA Seq reads was in 50bp length and an initial filtering process was taken to remove any non desirable contamination sequences such as rRNA tRNA and repeats etc. A seed and extension mapping approach was developed to map the 50bp reads into reference genome zv7 and also into the respective zv7 refGene annotation separately. During mapping of the reads to the refGene annotation a splice junction database fasta file is generated to which the reads are mapped to. This database contains known and putative junction sequences created by taking 46bp from the joining ends of adjacent and non adjacent exons for each gene and putting them together simulating the genomic sequences of known and putative junctions respectively. The first 25bp of the 50bp read was used as the seed for alignment for each read. When an alignment cannot be found using these 25bp seed the seed window is shifted and the next 25bp seed is taken from the 21st to the 45th base of the read. An extension step follows when the seed is able to map and a score generated for each extended base to determine best alignment. A merging step is performed on the genome mapping and splice junction mapping to determine a set of alignments for each read from which a unique alignment is found based on the score generated for these alignments. Mapping parameters:  Mapping was done using Applied Biosystems’ SOLiD BioScope alignment for whole transcriptome analysis pipeline.  Two mismatches were allowed in the 25bp color space seed sequence with extension alignment performed to find the full mapping location.  A score is computed for each mapping location and any location that scored <22 were filtered. Generation of gff and bedgraph files: GFF files were produced by parsing the output BAM format and extracted for unique alignments with score >22. The bedgraph files are then produced with the resulting gff file. developing embryos Embryos were frozen at the desired developmental stages and RNAs was extracted for sequencing. mRNA seq was performed by Mission Biotech Taiwan. SOLiD sequencing libraries were prepared using the Whole Transcriptome Library Preparation for SOLiD™ Sequencing kit ABI according to manufacturer’s instructions. About 200 280 µg of total RNAs were used as starting materials which were subjected to polyA selection using Applied Biosystems PolyA Purist Kit AM1916 fragmentation and library construction using distinct adapters for each library SOLiD Barcoding. From each library equal volumes were pooled together and sequenced in SOLiD3 ABI platform generating 50bp tags. Zebrafish embryos AB background collected just post fertilization were reared and harvested at desired time points. Unfertilized oocytes were collected by squeezing the abdomen of spawning females. Harvested embryos were snap frozen in liquid nitrogen and stored in −80°C. Total RNA was extracted from whole embryos using Trizol Invitrogen according to manufacturer’s instructions. RNA concentrations were determined using NanoDrop 2000 Thermo Scientific. Integrity of RNA samples were determined using Agilent RNA 6000 Nano chip and size separated using Agilent 2100 Bioanalyzer. Total RNA obtained per 100 embryos at each developmental stage was calculated for data normalization purposes. background:AB; wild type|developmental stage:mixure of 16/32 cell embryos GSM564429 GSM564429: 16/32 cells GSM564429: 16/32 cells GSM564429: 16/32 cells 1   GEO Accession:GSM564429 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD System 3.0 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP003165         1792238300.0 35844766.0 GSM564429 1 0:50   50                 SRX025027 SRS085806 SRA022850 GEO Computational and Systems Biology, Genome Institute of Singapore 1 0.6993   0.04019   0.83763   0.50284   50   B   usable mapping rate legacy early full_length poly_a unknown bulk unknown unknown   Singapore 2010-07-08 Cleavage Embryo Embryo Imprecise All anatomical structures
36297 36297 SRR393000 SRX113357 SRS284301 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments Wild type 2hpf 2 GSM854439   source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf Ribosome protected fragments Wild type 2hpf 2 Ribo Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo wild type   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf GSM854439 GSM854439: Ribosome protected fragments Wild type 2hpf 2; Danio rerio; RNA Seq GSM854439 1 GSM854439: Ribosome protected fragments Wild type 2hpf 2 1   GEO Accession:GSM854439 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040     Ribo_Wt_2_B1.fq fastq 217015848.0 3014109.0 GSM854439 r1 0:72 A:73500339;C:46583724;G:47804114;T:49117423;N:10248 72       73500339 46583724 47804114 49117423 10248 SRX113357 SRS284301 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 2e-05   0.0   0.99997   1.0   72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36298 36298 SRR393001 SRX113357 SRS284301 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments Wild type 2hpf 2 GSM854439   source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf Ribosome protected fragments Wild type 2hpf 2 Ribo Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo wild type   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf GSM854439 GSM854439: Ribosome protected fragments Wild type 2hpf 2; Danio rerio; RNA Seq GSM854439 1 GSM854439: Ribosome protected fragments Wild type 2hpf 2 1   GEO Accession:GSM854439 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040   instrument model:Illumina HiSeq 2000 Ribo_Wt_2_B2.fq fastq 976804848.0 13566734.0 GSM854439 r2 0:72 A:312362919;C:205660950;G:237663406;T:221097191;N:20382 72       312362919 205660950 237663406 221097191 20382 SRX113357 SRS284301 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.0   0.0   1.0       72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36299 36299 SRR392998 SRX113356 SRS284300 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments Wild type 2hpf GSM854438   source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf Ribosome protected fragments Wild type 2hpf Ribo Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo wild type   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf GSM854438 GSM854438: Ribosome protected fragments Wild type 2hpf; Danio rerio; RNA Seq GSM854438 1 GSM854438: Ribosome protected fragments Wild type 2hpf 1   GEO Accession:GSM854438 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040     Ribo_Wt_2_A1.fq fastq 284876712.0 3956621.0 GSM854438 r1 0:72 A:88022040;C:68867093;G:63794882;T:64180749;N:11948 72       88022040 68867093 63794882 64180749 11948 SRX113356 SRS284300 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.00011   7e-05   0.99995   0.0   72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36300 36300 SRR392999 SRX113356 SRS284300 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments Wild type 2hpf GSM854438   source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf Ribosome protected fragments Wild type 2hpf Ribo Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo wild type   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf GSM854438 GSM854438: Ribosome protected fragments Wild type 2hpf; Danio rerio; RNA Seq GSM854438 1 GSM854438: Ribosome protected fragments Wild type 2hpf 1   GEO Accession:GSM854438 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040   instrument model:Illumina HiSeq 2000 Ribo_Wt_2_A2.fq fastq 1197987552.0 16638716.0 GSM854438 r2 0:72 A:346631182;C:288138913;G:296030268;T:267150788;N:36401 72       346631182 288138913 296030268 267150788 36401 SRX113356 SRS284300 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 3e-05   0.0   0.99997   0.0   72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36309 36309 SRR392988 SRX113351 SRS284295 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments MZdicer 2hpf 2 GSM854433   source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf Ribosome protected fragments MZdicer 2hpf 2 Ribo Dicer 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo MZdicer   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf GSM854433 GSM854433: Ribosome protected fragments MZdicer 2hpf 2; Danio rerio; RNA Seq GSM854433 1 GSM854433: Ribosome protected fragments MZdicer 2hpf 2 1   GEO Accession:GSM854433 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040     Ribo_Dicer_2_B1.fq fastq 72956952.0 1013291.0 GSM854433 r1 0:72 A:22006501;C:17986138;G:16833834;T:16127785;N:2694 72       22006501 17986138 16833834 16127785 2694 SRX113351 SRS284295 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.00131   0.00114   0.99991   0.88888   72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36310 36310 SRR392989 SRX113351 SRS284295 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments MZdicer 2hpf 2 GSM854433   source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf Ribosome protected fragments MZdicer 2hpf 2 Ribo Dicer 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo MZdicer   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf GSM854433 GSM854433: Ribosome protected fragments MZdicer 2hpf 2; Danio rerio; RNA Seq GSM854433 1 GSM854433: Ribosome protected fragments MZdicer 2hpf 2 1   GEO Accession:GSM854433 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040   instrument model:Illumina HiSeq 2000 Ribo_Dicer_2_B2.fq fastq 454127328.0 6307324.0 GSM854433 r2 0:72 A:124676855;C:112665084;G:119208313;T:97572172;N:4904 72       124676855 112665084 119208313 97572172 4904 SRX113351 SRS284295 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.0   0.0   1.0       72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36311 36311 SRR392986 SRX113350 SRS284294 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments MZdicer 2hpf GSM854432   source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf Ribosome protected fragments MZdicer 2hpf Ribo Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo MZdicer   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf GSM854432 GSM854432: Ribosome protected fragments MZdicer 2hpf; Danio rerio; RNA Seq GSM854432 1 GSM854432: Ribosome protected fragments MZdicer 2hpf 1   GEO Accession:GSM854432 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040     Ribo_Dicer_2_A1.fq fastq 216257400.0 3003575.0 GSM854432 r1 0:72 A:66784432;C:51526758;G:47615177;T:50321714;N:9319 72       66784432 51526758 47615177 50321714 9319 SRX113350 SRS284294 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 6e-05   1e-05   0.99995   1.0   72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;