RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata

385 rows where devstage_curation = "Cleavage" and experiment.library_selection = "cDNA"

✎ View and edit SQL

This data as json, CSV (advanced)

technology 5

tissue_curation 4

experiment.platform 4

experiment.library_strategy 3

experiment.library_source 2

experiment.library_layout 2

experiment.library_selection 1

  • cDNA · 385 ✖

devstage_curation_coarse 1

devstage_curation 1

  • Cleavage · 385 ✖
Link rowid ▼ run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
3155 3155 ERR1410225 ERX1481464 ERS1021813 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool12 SAMEA3714664 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714664|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:11Z|INSDC status:public|Submitter Id:e9237f50 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCAGCTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e9237f50 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#24 15565967 Illumina sequencing of library 15565967 constructed from sample accession ERS1021813 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCAGCTC. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#24.cram cram 682856330.0 5252741.0 SC RUN 18730 4#24 0:55 1:75 A:168217714;C:139075008;G:141169282;T:234338870;N:55456 55 75     168217714 139075008 141169282 234338870 55456 ERX1481464 ERS1021813 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.22601 0.6266 0.06302 0.07433 0.95848 0.87767 0.77147 0.72121 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3156 3156 ERR1410224 ERX1481463 ERS1021812 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool11 SAMEA3714663 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714663|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:10Z|INSDC status:public|Submitter Id:e91834b0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACTAGTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e91834b0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#23 15565966 Illumina sequencing of library 15565966 constructed from sample accession ERS1021812 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACTAGTC. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#23.cram cram 784669730.0 6035921.0 SC RUN 18730 4#23 0:55 1:75 A:193369040;C:154930839;G:157589012;T:278718023;N:62816 55 75     193369040 154930839 157589012 278718023 62816 ERX1481463 ERS1021812 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.22113 0.66423 0.05856 0.07177 0.95899 0.86705 0.76036 0.71777 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3157 3157 ERR1410223 ERX1481462 ERS1021811 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool10 SAMEA3714662 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714662|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:10Z|INSDC status:public|Submitter Id:e90c9bf0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCAGATTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e90c9bf0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#22 15565965 Illumina sequencing of library 15565965 constructed from sample accession ERS1021811 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCAGATTC. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#22.cram cram 1247901590.0 9599243.0 SC RUN 18730 4#22 0:55 1:75 A:314703461;C:244320464;G:241561095;T:447214667;N:101903 55 75     314703461 244320464 241561095 447214667 101903 ERX1481462 ERS1021811 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.20694 0.62963 0.04856 0.05487 0.95763 0.87026 0.7137 0.71273 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3158 3158 ERR1410222 ERX1481461 ERS1021810 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool9 SAMEA3714661 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714661|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:09Z|INSDC status:public|Submitter Id:e8fe4410 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TATGCCAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8fe4410 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#21 15565964 Illumina sequencing of library 15565964 constructed from sample accession ERS1021810 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TATGCCAG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#21.cram cram 1160974880.0 8930576.0 SC RUN 18730 4#21 0:55 1:75 A:287583127;C:233701395;G:225242195;T:414354028;N:94135 55 75     287583127 233701395 225242195 414354028 94135 ERX1481461 ERS1021810 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.20242 0.60852 0.05828 0.06484 0.95568 0.87456 0.67452 0.38749 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3159 3159 ERR1410221 ERX1481460 ERS1021809 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool8 SAMEA3714660 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714660|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:08Z|INSDC status:public|Submitter Id:e8f2d260 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGGCTCAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8f2d260 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#20 15565963 Illumina sequencing of library 15565963 constructed from sample accession ERS1021809 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGGCTCAG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#20.cram cram 1041644630.0 8012651.0 SC RUN 18730 4#20 0:55 1:75 A:250361997;C:216927117;G:209137594;T:365137042;N:80880 55 75     250361997 216927117 209137594 365137042 80880 ERX1481460 ERS1021809 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.23722 0.6381 0.05317 0.07562 0.95503 0.87671 0.75995 0.72353 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3160 3160 ERR1410220 ERX1481459 ERS1021808 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool7 SAMEA3714659 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714659|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:08Z|INSDC status:public|Submitter Id:e8e787c0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCATTGAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8e787c0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#19 15565962 Illumina sequencing of library 15565962 constructed from sample accession ERS1021808 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCATTGAG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#19.cram cram 1002402180.0 7710786.0 SC RUN 18730 4#19 0:55 1:75 A:249654737;C:203437995;G:194586976;T:354640685;N:81787 55 75     249654737 203437995 194586976 354640685 81787 ERX1481459 ERS1021808 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.21081 0.61197 0.04352 0.05852 0.9529 0.86815 0.65385 0.64824 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3161 3161 ERR1410219 ERX1481458 ERS1021807 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool6 SAMEA3714658 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714658|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:07Z|INSDC status:public|Submitter Id:e8dc3d20 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGTATGCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8dc3d20 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#18 15565961 Illumina sequencing of library 15565961 constructed from sample accession ERS1021807 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGTATGCG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#18.cram cram 1001271050.0 7702085.0 SC RUN 18730 4#18 0:55 1:75 A:249131077;C:206043698;G:193568917;T:352446609;N:80749 55 75     249131077 206043698 193568917 352446609 80749 ERX1481458 ERS1021807 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.22004 0.6117 0.05313 0.0656 0.95095 0.8758 0.70135 0.69364 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3162 3162 ERR1410218 ERX1481457 ERS1021806 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool5 SAMEA3714657 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714657|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:06Z|INSDC status:public|Submitter Id:e8b183a0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCCAGTCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8b183a0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#17 15565960 Illumina sequencing of library 15565960 constructed from sample accession ERS1021806 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCCAGTCG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#17.cram cram 1240938140.0 9545678.0 SC RUN 18730 4#17 0:55 1:75 A:302318036;C:249218633;G:246601321;T:442702025;N:98125 55 75     302318036 249218633 246601321 442702025 98125 ERX1481457 ERS1021806 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.23057 0.63523 0.05319 0.067 0.95213 0.86695 0.69753 0.68537 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3163 3163 ERR1410217 ERX1481456 ERS1021805 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool4 SAMEA3714656 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714656|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:06Z|INSDC status:public|Submitter Id:e8ab9030 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAAGTTCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8ab9030 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#16 15565959 Illumina sequencing of library 15565959 constructed from sample accession ERS1021805 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAAGTTCG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#16.cram cram 942829030.0 7252531.0 SC RUN 18730 4#16 0:55 1:75 A:225274547;C:196341691;G:188483755;T:332654028;N:75009 55 75     225274547 196341691 188483755 332654028 75009 ERX1481456 ERS1021805 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.21889 0.64365 0.04363 0.07265 0.95181 0.87478 0.70501 0.69162 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3164 3164 ERR1410216 ERX1481455 ERS1021804 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool3 SAMEA3714655 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714655|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:05Z|INSDC status:public|Submitter Id:e8a5eae0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCAGGAGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8a5eae0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#15 15565958 Illumina sequencing of library 15565958 constructed from sample accession ERS1021804 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCAGGAGG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#15.cram cram 992671030.0 7635931.0 SC RUN 18730 4#15 0:55 1:75 A:241776762;C:210080049;G:195284057;T:345448849;N:81313 55 75     241776762 210080049 195284057 345448849 81313 ERX1481455 ERS1021804 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.21439 0.6195 0.04725 0.05379 0.95191 0.87606 0.67336 0.65016 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3165 3165 ERR1410215 ERX1481454 ERS1021803 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool2 SAMEA3714654 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714654|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:05Z|INSDC status:public|Submitter Id:e89cc320 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCTCACGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e89cc320 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#14 15565957 Illumina sequencing of library 15565957 constructed from sample accession ERS1021803 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCTCACGG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#14.cram cram 1234311910.0 9494707.0 SC RUN 18730 4#14 0:55 1:75 A:301439259;C:257228602;G:244500849;T:431043241;N:99959 55 75     301439259 257228602 244500849 431043241 99959 ERX1481454 ERS1021803 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.19348 0.62337 0.04021 0.05986 0.95574 0.87941 0.67064 0.69696 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3166 3166 ERR1410214 ERX1481453 ERS1021802 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 pool1 SAMEA3714653 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714653|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:04Z|INSDC status:public|Submitter Id:e897ba10 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACTTCGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e897ba10 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#13 15565956 Illumina sequencing of library 15565956 constructed from sample accession ERS1021802 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACTTCGG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#13.cram cram 1039867140.0 7998978.0 SC RUN 18730 4#13 0:55 1:75 A:252384576;C:218519074;G:206578085;T:362298880;N:86525 55 75     252384576 218519074 206578085 362298880 86525 ERX1481453 ERS1021802 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.18713 0.60956 0.05049 0.0817 0.95556 0.87618 0.66594 0.68034 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3167 3167 ERR1410213 ERX1481452 ERS1021801 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 12 SAMEA3714652 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714652|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:04Z|INSDC status:public|Submitter Id:e89262e0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGAACTGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e89262e0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#12 15565955 Illumina sequencing of library 15565955 constructed from sample accession ERS1021801 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGAACTGG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#12.cram cram 1071792020.0 8244554.0 SC RUN 18730 4#12 0:55 1:75 A:266291261;C:216074486;G:207838804;T:381495628;N:91841 55 75     266291261 216074486 207838804 381495628 91841 ERX1481452 ERS1021801 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.19027 0.64477 0.0489 0.06997 0.95268 0.86371 0.66594 0.67162 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3168 3168 ERR1410212 ERX1481451 ERS1021800 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 11 SAMEA3714651 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714651|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:03Z|INSDC status:public|Submitter Id:e88d59d0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTGGTATG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88d59d0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#11 15565954 Illumina sequencing of library 15565954 constructed from sample accession ERS1021800 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTGGTATG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#11.cram cram 686164570.0 5278189.0 SC RUN 18730 4#11 0:55 1:75 A:165352345;C:146328635;G:134343947;T:240083817;N:55826 55 75     165352345 146328635 134343947 240083817 55826 ERX1481451 ERS1021800 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.22823 0.61844 0.08567 0.10696 0.95106 0.86797 0.62805 0.63179 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3169 3169 ERR1410211 ERX1481450 ERS1021799 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 10 SAMEA3714650 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714650|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:03Z|INSDC status:public|Submitter Id:e88829b0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAACGCTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88829b0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#10 15565953 Illumina sequencing of library 15565953 constructed from sample accession ERS1021799 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAACGCTG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#10.cram cram 889043870.0 6838799.0 SC RUN 18730 4#10 0:55 1:75 A:223435089;C:179282347;G:171273337;T:314981588;N:71509 55 75     223435089 179282347 171273337 314981588 71509 ERX1481450 ERS1021799 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.19054 0.6472 0.0467 0.06495 0.953 0.86519 0.68221 0.68725 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3170 3170 ERR1410210 ERX1481449 ERS1021798 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 9 SAMEA3714649 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714649|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:02Z|INSDC status:public|Submitter Id:e88320a0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCGAAGTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88320a0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#9 15565952 Illumina sequencing of library 15565952 constructed from sample accession ERS1021798 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCGAAGTG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#9.cram cram 987809940.0 7598538.0 SC RUN 18730 4#9 0:55 1:75 A:248484130;C:197140774;G:188385871;T:353715305;N:83860 55 75     248484130 197140774 188385871 353715305 83860 ERX1481449 ERS1021798 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.2215 0.62639 0.05009 0.06362 0.94959 0.86689 0.63702 0.63984 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3171 3171 ERR1410209 ERX1481448 ERS1021797 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 8 SAMEA3714648 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714648|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:02Z|INSDC status:public|Submitter Id:e87d5440 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCCATTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e87d5440 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#8 15565951 Illumina sequencing of library 15565951 constructed from sample accession ERS1021797 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCCATTG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#8.cram cram 991993340.0 7630718.0 SC RUN 18730 4#8 0:55 1:75 A:248601530;C:201637312;G:190701521;T:350971271;N:81706 55 75     248601530 201637312 190701521 350971271 81706 ERX1481448 ERS1021797 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.18071 0.60546 0.04372 0.05614 0.95556 0.87182 0.64904 0.68316 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3172 3172 ERR1410208 ERX1481447 ERS1021796 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 7 SAMEA3714647 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714647|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e871e290 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAGTCTTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e871e290 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#7 15565950 Illumina sequencing of library 15565950 constructed from sample accession ERS1021796 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAGTCTTG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#7.cram cram 1355591770.0 10427629.0 SC RUN 18730 4#7 0:55 1:75 A:333761549;C:285155703;G:270975293;T:465589806;N:109419 55 75     333761549 285155703 270975293 465589806 109419 ERX1481447 ERS1021796 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.19403 0.63995 0.03449 0.07104 0.957 0.88641 0.73288 0.71598 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3173 3173 ERR1410207 ERX1481446 ERS1021795 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 6 SAMEA3714646 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714646|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e86670e0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGTGGTTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e86670e0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#6 15565949 Illumina sequencing of library 15565949 constructed from sample accession ERS1021795 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGTGGTTG. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#6.cram cram 1121411330.0 8626241.0 SC RUN 18730 4#6 0:55 1:75 A:275436070;C:245845272;G:219970219;T:380067436;N:92333 55 75     275436070 245845272 219970219 380067436 92333 ERX1481446 ERS1021795 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.185 0.59026 0.03934 0.06143 0.95268 0.88968 0.59393 0.69736 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3174 3174 ERR1410206 ERX1481445 ERS1021794 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 5 SAMEA3714645 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714645|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e85b2640 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCCTCAAT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e85b2640 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#5 15565948 Illumina sequencing of library 15565948 constructed from sample accession ERS1021794 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCCTCAAT. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#5.cram cram 852544290.0 6558033.0 SC RUN 18730 4#5 0:55 1:75 A:202033234;C:177211087;G:169900063;T:303332405;N:67501 55 75     202033234 177211087 169900063 303332405 67501 ERX1481445 ERS1021794 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.21445 0.62891 0.0753 0.09655 0.95278 0.86929 0.61569 0.48656 55 75 T B mate1 technical by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3175 3175 ERR1410205 ERX1481444 ERS1021793 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 4 SAMEA3714644 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714644|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:00Z|INSDC status:public|Submitter Id:e84f8d80 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACAGGAT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e84f8d80 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#4 15565947 Illumina sequencing of library 15565947 constructed from sample accession ERS1021793 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACAGGAT. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#4.cram cram 989803880.0 7613876.0 SC RUN 18730 4#4 0:55 1:75 A:241562947;C:196888151;G:193862254;T:357404172;N:86356 55 75     241562947 196888151 193862254 357404172 86356 ERX1481444 ERS1021793 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.27131 0.63988 0.04128 0.04919 0.95923 0.88292 0.81011 0.7508 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3176 3176 ERR1410204 ERX1481443 ERS1021792 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 3 SAMEA3714643 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714643|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:00Z|INSDC status:public|Submitter Id:e8441bd0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAGTGACT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8441bd0 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#3 15565946 Illumina sequencing of library 15565946 constructed from sample accession ERS1021792 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAGTGACT. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#3.cram cram 1144202930.0 8801561.0 SC RUN 18730 4#3 0:55 1:75 A:278906912;C:230946498;G:229591661;T:404660425;N:97434 55 75     278906912 230946498 229591661 404660425 97434 ERX1481443 ERS1021792 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.24055 0.6437 0.04616 0.05861 0.9554 0.88221 0.30306 0.73916 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3177 3177 ERR1410203 ERX1481442 ERS1021791 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 2 SAMEA3714642 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714642|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:41:59Z|INSDC status:public|Submitter Id:e8385c00 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCCTGCT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8385c00 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#2 15565945 Illumina sequencing of library 15565945 constructed from sample accession ERS1021791 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCCTGCT. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#2.cram cram 1459339960.0 11225692.0 SC RUN 18730 4#2 0:55 1:75 A:361580033;C:294777861;G:295641568;T:507221717;N:118781 55 75     361580033 294777861 295641568 507221717 118781 ERX1481442 ERS1021791 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.25446 0.64481 0.04258 0.05864 0.95473 0.88562 0.32211 0.75437 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3178 3178 ERR1410202 ERX1481441 ERS1021790 ERP013756 PRJEB12296 Baseline expression from transcriptional profiling of zebrafish developmental stages 2 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 Transcriptome Analysis Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 453     ZMP phenotype 128 1 1 SAMEA3714641 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714641|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:41:58Z|INSDC status:public|Submitter Id:e73ff240 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGCGATCT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e73ff240 a000 11e5 800b 68b59976a382|strain:mixed                 Illumina HiSeq 2000 paired end sequencing SC EXP 18730 4#1 15565944 Illumina sequencing of library 15565944 constructed from sample accession ERS1021790 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGCGATCT. Transcriptome counting qPCR only   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP013756 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 18730_4#1.cram cram 869624210.0 6689417.0 SC RUN 18730 4#1 0:55 1:75 A:211816407;C:178380016;G:176641186;T:302714073;N:72528 55 75     211816407 178380016 176641186 302714073 72528 ERX1481441 ERS1021790 ERA620320 European Nucleotide Archive Wellcome Sanger Institute 2 0.26789 0.63129 0.0568 0.09239 0.95978 0.88978 0.82999 0.78005 55 75 B B mate1-mate2 similar by mapping diff illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United Kingdom 2015-12-16 Cleavage Embryo Whole Organism All anatomical structures
3788 3788 ERR1442900 ERX1513277 ERS1079219 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 F SAMEA3892085 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 2#70 16564972 Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence GATCTCTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_2#70.cram cram 364410400.0 1822052.0 SC RUN 19912 2#70 0:100 1:100 A:96471898;C:85460940;G:85739185;T:96152266;N:586111 100 100     96471898 85460940 85739185 96152266 586111 ERX1513277 ERS1079219 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96377 0.96719 0.0976 0.09955 0.79667 0.79693 0.58832 0.58226 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3789 3789 ERR1442899 ERX1513276 ERS1079218 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 E SAMEA3892084 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 2#69 16564960 Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence GGTGAGTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_2#69.cram cram 312144800.0 1560724.0 SC RUN 19912 2#69 0:100 1:100 A:82044388;C:74027006;G:73985684;T:81583681;N:504041 100 100     82044388 74027006 73985684 81583681 504041 ERX1513276 ERS1079218 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96275 0.9677 0.10631 0.10791 0.79496 0.79535 0.57643 0.57303 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3790 3790 ERR1442898 ERX1513275 ERS1079217 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 D SAMEA3892083 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 2#68 16564948 Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TGCGTGAA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_2#68.cram cram 330453000.0 1652265.0 SC RUN 19912 2#68 0:100 1:100 A:87696659;C:77248972;G:77394239;T:87578108;N:535022 100 100     87696659 77248972 77394239 87578108 535022 ERX1513275 ERS1079217 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96171 0.96419 0.10779 0.11047 0.79902 0.80018 0.57383 0.56925 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3791 3791 ERR1442897 ERX1513274 ERS1079216 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 C SAMEA3892082 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 2#67 16564936 Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TACCACCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_2#67.cram cram 327261000.0 1636305.0 SC RUN 19912 2#67 0:100 1:100 A:87523901;C:75771535;G:75871608;T:87573282;N:520674 100 100     87523901 75771535 75871608 87573282 520674 ERX1513274 ERS1079216 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.95986 0.96354 0.1123 0.11468 0.80156 0.80229 0.58372 0.58338 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3792 3792 ERR1442896 ERX1513273 ERS1079215 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 B SAMEA3892081 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 2#66 16564924 Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TGAAGCCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_2#66.cram cram 328496600.0 1642483.0 SC RUN 19912 2#66 0:100 1:100 A:86841947;C:77278436;G:77262516;T:86589805;N:523896 100 100     86841947 77278436 77262516 86589805 523896 ERX1513273 ERS1079215 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96091 0.96535 0.1279 0.13047 0.79805 0.79857 0.58551 0.58209 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3878 3878 ERR1442810 ERX1513187 ERS1079219 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 F SAMEA3892085 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 1#70 16564972 Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence GATCTCTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_1#70.cram cram 364912600.0 1824563.0 SC RUN 19912 1#70 0:100 1:100 A:96642496;C:85588675;G:85883202;T:96301393;N:496834 100 100     96642496 85588675 85883202 96301393 496834 ERX1513187 ERS1079219 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96362 0.96689 0.09725 0.09882 0.79592 0.79703 0.59097 0.5784 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3879 3879 ERR1442809 ERX1513186 ERS1079218 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 E SAMEA3892084 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 1#69 16564960 Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence GGTGAGTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_1#69.cram cram 312470400.0 1562352.0 SC RUN 19912 1#69 0:100 1:100 A:82160555;C:74100532;G:74069193;T:81696066;N:444054 100 100     82160555 74100532 74069193 81696066 444054 ERX1513186 ERS1079218 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96376 0.96859 0.10642 0.1079 0.79417 0.79474 0.5752 0.57 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3880 3880 ERR1442808 ERX1513185 ERS1079217 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 D SAMEA3892083 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 1#68 16564948 Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TGCGTGAA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_1#68.cram cram 330554000.0 1652770.0 SC RUN 19912 1#68 0:100 1:100 A:87747224;C:77298685;G:77439701;T:87616982;N:451408 100 100     87747224 77298685 77439701 87616982 451408 ERX1513185 ERS1079217 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96163 0.96436 0.10875 0.1111 0.79928 0.79965 0.57561 0.5708 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3881 3881 ERR1442807 ERX1513184 ERS1079216 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 C SAMEA3892082 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 1#67 16564936 Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TACCACCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_1#67.cram cram 327019400.0 1635097.0 SC RUN 19912 1#67 0:100 1:100 A:87453957;C:75726607;G:75847551;T:87546870;N:444415 100 100     87453957 75726607 75847551 87546870 444415 ERX1513184 ERS1079216 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96147 0.9625 0.11258 0.11475 0.79825 0.79924 0.58372 0.56917 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3882 3882 ERR1442806 ERX1513183 ERS1079215 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 B SAMEA3892081 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19912 1#66 16564924 Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TGAAGCCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19912_1#66.cram cram 327613800.0 1638069.0 SC RUN 19912 1#66 0:100 1:100 A:86594522;C:77121933;G:77114321;T:86338082;N:444942 100 100     86594522 77121933 77114321 86338082 444942 ERX1513183 ERS1079215 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.9614 0.96527 0.12823 0.13043 0.79762 0.79922 0.58597 0.5851 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3968 3968 ERR1442720 ERX1513097 ERS1079219 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 F SAMEA3892085 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 2#70 16564972 Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence GATCTCTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_2#70.cram cram 371283800.0 1856419.0 SC RUN 19850 2#70 0:100 1:100 A:98443439;C:87187703;G:87417381;T:98100142;N:135135 100 100     98443439 87187703 87417381 98100142 135135 ERX1513097 ERS1079219 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96411 0.96451 0.09692 0.09902 0.79657 0.7964 0.58932 0.57779 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3969 3969 ERR1442719 ERX1513096 ERS1079218 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 E SAMEA3892084 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 2#69 16564960 Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence GGTGAGTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_2#69.cram cram 318491400.0 1592457.0 SC RUN 19850 2#69 0:100 1:100 A:83845999;C:75642375;G:75561647;T:83330437;N:110942 100 100     83845999 75642375 75561647 83330437 110942 ERX1513096 ERS1079218 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96388 0.96834 0.10544 0.10741 0.79336 0.79417 0.57217 0.56939 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3970 3970 ERR1442718 ERX1513095 ERS1079217 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 D SAMEA3892083 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 2#68 16564948 Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TGCGTGAA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_2#68.cram cram 335548800.0 1677744.0 SC RUN 19850 2#68 0:100 1:100 A:89188408;C:78543202;G:78653253;T:89044211;N:119726 100 100     89188408 78543202 78653253 89044211 119726 ERX1513095 ERS1079217 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96211 0.96612 0.10777 0.11055 0.79724 0.79876 0.57249 0.43044 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3971 3971 ERR1442717 ERX1513094 ERS1079216 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 C SAMEA3892082 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 2#67 16564936 Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TACCACCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_2#67.cram cram 331952200.0 1659761.0 SC RUN 19850 2#67 0:100 1:100 A:88872903;C:76957606;G:77065688;T:88935012;N:120991 100 100     88872903 76957606 77065688 88935012 120991 ERX1513094 ERS1079216 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96191 0.96393 0.11342 0.11468 0.799 0.79908 0.58219 0.58045 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
3972 3972 ERR1442716 ERX1513093 ERS1079215 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 B SAMEA3892081 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 2#66 16564924 Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TGAAGCCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_2#66.cram cram 333024200.0 1665121.0 SC RUN 19850 2#66 0:100 1:100 A:88172616;C:78454066;G:78393792;T:87885914;N:117812 100 100     88172616 78454066 78393792 87885914 117812 ERX1513093 ERS1079215 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96249 0.96556 0.1289 0.13166 0.79945 0.79961 0.58336 0.58063 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
4058 4058 ERR1442630 ERX1513007 ERS1079219 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 F SAMEA3892085 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 1#70 16564972 Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence GATCTCTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_1#70.cram cram 371578800.0 1857894.0 SC RUN 19850 1#70 0:100 1:100 A:98533022;C:87264222;G:87555118;T:98151909;N:74529 100 100     98533022 87264222 87555118 98151909 74529 ERX1513007 ERS1079219 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.9636 0.96761 0.09699 0.09916 0.79525 0.79553 0.58618 0.57988 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
4059 4059 ERR1442629 ERX1513006 ERS1079218 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 E SAMEA3892084 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 1#69 16564960 Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence GGTGAGTT. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_1#69.cram cram 318342200.0 1591711.0 SC RUN 19850 1#69 0:100 1:100 A:83801083;C:75621628;G:75578752;T:83271737;N:69000 100 100     83801083 75621628 75578752 83271737 69000 ERX1513006 ERS1079218 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96351 0.96877 0.10486 0.10713 0.79423 0.79444 0.57288 0.57375 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
4060 4060 ERR1442628 ERX1513005 ERS1079217 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 D SAMEA3892083 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 1#68 16564948 Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TGCGTGAA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_1#68.cram cram 334846000.0 1674230.0 SC RUN 19850 1#68 0:100 1:100 A:88989528;C:78413149;G:78541907;T:88833028;N:68388 100 100     88989528 78413149 78541907 88833028 68388 ERX1513005 ERS1079217 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96197 0.96681 0.10873 0.11111 0.79805 0.7992 0.57474 0.57198 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
4061 4061 ERR1442627 ERX1513004 ERS1079216 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 C SAMEA3892082 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 1#67 16564936 Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TACCACCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_1#67.cram cram 332077800.0 1660389.0 SC RUN 19850 1#67 0:100 1:100 A:88958890;C:76946124;G:77079866;T:89022508;N:70412 100 100     88958890 76946124 77079866 89022508 70412 ERX1513004 ERS1079216 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96162 0.96369 0.11367 0.11586 0.7992 0.79855 0.58505 0.58088 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
4062 4062 ERR1442626 ERX1513003 ERS1079215 ERP014517 PRJEB12982 Baseline expression from transcriptional profiling of zebrafish developmental stages 3 Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 Transcriptome Analysis RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling ArrayExpress:E ERAD 475     ZMP phenotype 128 B SAMEA3892081 Wellcome Sanger Institute ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed                 Illumina HiSeq 2500 paired end sequencing SC EXP 19850 1#66 16564924 Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TGAAGCCA. RNA seq dUTP eukaryotic   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2500   ERP014517 Illumina HiSeq 2500 paired end sequencing ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 19850_1#66.cram cram 332776400.0 1663882.0 SC RUN 19850 1#66 0:100 1:100 A:88108657;C:78400833;G:78371292;T:87823689;N:71929 100 100     88108657 78400833 78371292 87823689 71929 ERX1513003 ERS1079215 ERA648700 European Nucleotide Archive Wellcome Sanger Institute 2 0.96154 0.96535 0.12909 0.13161 0.79815 0.79959 0.58756 0.58417 100 100 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2016-03-10 Cleavage Embryo Whole Organism All anatomical structures
9296 9296 ERR202508 ERX177193 ERS092407 ERP001280 PRJEB2925 maternal to Zygotic Transition maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 Transcriptome Analysis During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.         SAMEA1570569 SC ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:T/LF|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:29Z|External Id:SAMEA1570569|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:29Z|INSDC status:public|Submitter Id:2C TotRNA sc 2012 02 06T13:12:17Z 1121923|common name:zebrafish|sample description:RNA seq|sample name:2C TotRNA sc 2012 02 06T13:12:17Z 1121923|scientific name:Danio rerio|strain:T/LF                 1 SC EXP 6683 2 2532385 Illumina sequencing of library 2532385 constructed from sample accession ERS092407 for study accession ERP001280. Illumina cDNA protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP001280 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 6683_2.bam bam 11463941550.0 76426277.0 SC RUN 6683 2 0:75 1:75 A:2384324967;C:3291391074;G:3291238330;T:2457078635;N:39908544 75 75     2384324967 3291391074 3291238330 2457078635 39908544 ERX177193 ERS092407 ERA176708 SC Wellcome Sanger Institute 2 0.96484 0.95918 0.35968 0.35526 0.88404 0.88485 0.84949 0.8524 75 75 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2012-11-28 Cleavage Embryo Whole Organism All anatomical structures
9298 9298 ERR202506 ERX177191 ERS092405 ERP001280 PRJEB2925 maternal to Zygotic Transition maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 Transcriptome Analysis During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.         SAMEA1570534 SC ArrayExpress DevelopmentalStage:16 cell|ArrayExpress Genotype:T/LF|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:25Z|External Id:SAMEA1570534|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:25Z|INSDC status:public|Submitter Id:16C stan pro sc 2012 02 06T13:12:14Z 1121921|common name:zebrafish|sample description:RNA seq|sample name:16C stan pro sc 2012 02 06T13:12:14Z 1121921|scientific name:Danio rerio|strain:T/LF                 1 SC EXP 6317 5 2532383 Illumina sequencing of library 2532383 constructed from sample accession ERS092405 for study accession ERP001280. Illumina cDNA protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   ERP001280 Illumina HiSeq 2000 paired end sequencing ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 6317_5.bam bam 7092438300.0 47282922.0 SC RUN 6317 5 0:75 1:75 A:1947926886;C:1582039071;G:1595096528;T:1959471222;N:7904593 75 75     1947926886 1582039071 1595096528 1959471222 7904593 ERX177191 ERS092405 ERA176708 SC Wellcome Sanger Institute 2 0.90801 0.90631 0.0426 0.04216 0.78486 0.78539 0.4795 0.47872 75 75 B B biological fallback assumption illumina hiseq_era unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2012-11-28 Cleavage Embryo Whole Organism All anatomical structures
9301 9301 ERR202503 ERX177188 ERS092094 ERP001280 PRJEB2925 maternal to Zygotic Transition maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 Transcriptome Analysis During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.         SAMEA1570566 SC ArrayExpress DevelopmentalStage:64 cell|ArrayExpress Genotype:SAT/WIK|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:31Z|External Id:SAMEA1570566|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:31Z|INSDC status:public|Submitter Id:SAT b sc 2012 02 06T13:05:45Z 998060|common name:zebrafish|sample description:RNA seq|sample name:SAT b sc 2012 02 06T13:05:45Z 998060|scientific name:Danio rerio|strain:SAT                 1 SC EXP 5552 6 1476240 Illumina sequencing of library 1476240 constructed from sample accession ERS092094 for study accession ERP001280. Illumina cDNA protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina Genome Analyzer II   ERP001280 Illumina Genome Analyzer II paired end sequencing ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 5552_6.bam bam 3031861428.0 28072791.0 SC RUN 5552 6 0:54 1:54 A:827548202;C:685397282;G:689217947;T:827560833;N:2137164 54 54     827548202 685397282 689217947 827560833 2137164 ERX177188 ERS092094 ERA176708 SC Wellcome Sanger Institute 2 0.88709 0.8867 0.04219 0.04381 0.76836 0.76978 0.48688 0.48607 54 54 B B biological fallback assumption illumina early_illumina unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2012-11-28 Cleavage Embryo Whole Organism All anatomical structures
9304 9304 ERR202500 ERX177185 ERS092093 ERP001280 PRJEB2925 maternal to Zygotic Transition maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 Transcriptome Analysis During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.         SAMEA1570541 SC ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:SAT/WIK|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:13Z|External Id:SAMEA1570541|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:13Z|INSDC status:public|Submitter Id:SAT a sc 2012 02 06T13:05:43Z 998059|common name:zebrafish|sample description:RNA seq|sample name:SAT a sc 2012 02 06T13:05:43Z 998059|scientific name:Danio rerio|strain:SAT                 1 SC EXP 5540 7 1392795 Illumina sequencing of library 1392795 constructed from sample accession ERS092093 for study accession ERP001280. Illumina cDNA protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina Genome Analyzer II   ERP001280 Illumina Genome Analyzer II paired end sequencing ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 5540_7.bam bam 4139896608.0 38332376.0 SC RUN 5540 7 0:54 1:54 A:1123995667;C:935834208;G:933659183;T:1138309303;N:8098247 54 54     1123995667 935834208 933659183 1138309303 8098247 ERX177185 ERS092093 ERA176708 SC Wellcome Sanger Institute 2 0.89473 0.89261 0.0475 0.0496 0.80413 0.80551 0.49672 0.49064 54 54 B B biological fallback assumption illumina early_illumina unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2012-11-28 Cleavage Embryo Whole Organism All anatomical structures
9308 9308 ERR202496 ERX177181 ERS092089 ERP001280 PRJEB2925 maternal to Zygotic Transition maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 Transcriptome Analysis During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.         SAMEA1570537 SC ArrayExpress DevelopmentalStage:64 cell|ArrayExpress Genotype:WIK/SAT|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:15Z|External Id:SAMEA1570537|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:15Z|INSDC status:public|Submitter Id:WIK b sc 2012 02 06T13:05:39Z 998055|common name:zebrafish|sample description:RNA seq|sample name:WIK b sc 2012 02 06T13:05:39Z 998055|scientific name:Danio rerio|strain:WIK                 1 SC EXP 5540 2 1392791 Illumina sequencing of library 1392791 constructed from sample accession ERS092089 for study accession ERP001280. Illumina cDNA protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina Genome Analyzer II   ERP001280 Illumina Genome Analyzer II paired end sequencing ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 5540_2.bam bam 3934066536.0 36426542.0 SC RUN 5540 2 0:54 1:54 A:1089272408;C:875257818;G:871131618;T:1090449345;N:7955347 54 54     1089272408 875257818 871131618 1090449345 7955347 ERX177181 ERS092089 ERA176708 SC Wellcome Sanger Institute 2 0.92002 0.92014 0.04875 0.05104 0.76061 0.76161 0.4821 0.48296 54 54 B B biological fallback assumption illumina early_illumina unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2012-11-28 Cleavage Embryo Whole Organism All anatomical structures
9309 9309 ERR202495 ERX177180 ERS092088 ERP001280 PRJEB2925 maternal to Zygotic Transition maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 Transcriptome Analysis During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing.         SAMEA1570572 SC ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:WIK/SAT|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:31Z|External Id:SAMEA1570572|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:31Z|INSDC status:public|Submitter Id:WIK a sc 2012 02 06T13:05:37Z 998054|common name:zebrafish|sample description:RNA seq|sample name:WIK a sc 2012 02 06T13:05:37Z 998054|scientific name:Danio rerio|strain:WIK                 1 SC EXP 5540 1 1392790 Illumina sequencing of library 1392790 constructed from sample accession ERS092088 for study accession ERP001280. Illumina cDNA protocol   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina Genome Analyzer II   ERP001280 Illumina Genome Analyzer II paired end sequencing ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 5540_1.bam bam 4120158204.0 38149613.0 SC RUN 5540 1 0:54 1:54 A:1165514767;C:896704109;G:892695229;T:1156428740;N:8815359 54 54     1165514767 896704109 892695229 1156428740 8815359 ERX177180 ERS092088 ERA176708 SC Wellcome Sanger Institute 2 0.9228 0.92241 0.05498 0.05795 0.79091 0.79235 0.50034 0.50151 54 54 B B biological fallback assumption illumina early_illumina unknown cdna_unspecified unknown bulk unknown unknown   United Kingdom 2012-11-28 Cleavage Embryo Whole Organism All anatomical structures
24550 24550 ERR964668 ERX1041631 ERS792102 ERP011038 PRJEB9889 The Zebrafish transcriptome during early development ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22 Other Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation.       KI BN JKE DRERIO RNASEQ SAMEA3484817 KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484817|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 16cell|common name:zebrafish|dev stage:16 cell|sample name:KI BN JKE DRERIO RNASEQ 2009 16cell|strain:Tuebingen                 AB SOLiD System 3.0 sequencing ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:870 2 unspecified 1     RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD System 3.0   ERP011038 AB SOLiD System 3.0 sequencing ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16 KI-BN-JKE-DRERIO-RNASEQ-20090709-16cell_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20090709-16cell_F3_QV.qual.gz SOLiD_native SOLiD_native 5278508300.0 105570166.0 ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:871 2 0:50 0:1410981717;1:1203936808;2:1415708111;3:1223403795;.:24477869 50                 ERX1041631 ERS792102 ERA458495 KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 1 0.71371   0.09346   0.91539   0.73015   50   B   usable mapping rate legacy early full_length random_priming unknown bulk unknown unknown   Sweden 2015-07-15 Cleavage Embryo Undetermined Embryo Imprecise
24553 24553 ERR964672 ERX1041635 ERS792102 ERP011038 PRJEB9889 The Zebrafish transcriptome during early development ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22 Other Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation.       KI BN JKE DRERIO RNASEQ SAMEA3484817 KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484817|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 16cell|common name:zebrafish|dev stage:16 cell|sample name:KI BN JKE DRERIO RNASEQ 2009 16cell|strain:Tuebingen                 AB SOLiD System 3.0 sequencing ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:872 6 unspecified 1     RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD System 3.0   ERP011038 AB SOLiD System 3.0 sequencing ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16 KI-BN-JKE-DRERIO-RNASEQ-20091014-16cell_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20091014-16cell_F3_QV.qual.gz SOLiD_native SOLiD_native 2719433200.0 54388664.0 ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:872 6 0:50 0:699731678;1:628745158;2:754903505;3:633574679;.:2478180 50                 ERX1041635 ERS792102 ERA458495 KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 1 0.73214   0.09566   0.90836   0.74043   50   B   usable mapping rate legacy early full_length random_priming unknown bulk unknown unknown   Sweden 2015-07-15 Cleavage Embryo Undetermined Embryo Imprecise
28935 28935 SRR26845669 SRX22541151 SRS19550737 SRP472252 PRJNA1040929 Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] GSE247933 Other Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. parent bioproject:PRJNA1040928     zebrafish 2hour wt 75mM s4u r2 GSM7903257   tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing zebrafish 2hour wt 75mM s4u r2 Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; Embryos at 2 hpf Embryos were injected with 1000pL of 75mM s4 UTP. Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF] GSM7903257 GSM7903257: zebrafish 2hour wt 75mM s4u r2; Danio rerio; RNA Seq GSM7903257 r1 GSM7903257 1 Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP472252   loader:fastq load.py s2h_2.fastq.gz fastq 4440596805.0 43966305.0 GSM7903257 r1 0:101 A:1543708731;C:806593065;G:905733733;T:1182095254;N:2466022 101       1543708731 806593065 905733733 1182095254 2466022 SRX22541151 SRS19550737 SRA1751928 Bazzini Lab, Stowers Institute for Medical Research Bazzini Lab, Stowers Institute for Medical Research 1 0.63778   0.15677   0.82676   0.61166   101   B   usable mapping rate illumina nextseq_v2 3prime small_rna lexogen bulk unknown unknown   United States 2023-11-15 Cleavage Embryo Embryo Imprecise All anatomical structures
28936 28936 SRR26845670 SRX22541150 SRS19550735 SRP472252 PRJNA1040929 Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] GSE247933 Other Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. parent bioproject:PRJNA1040928     zebrafish 2hour wt 75mM s4u r1 GSM7903256   tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing zebrafish 2hour wt 75mM s4u r1 Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; Embryos at 2 hpf Embryos were injected with 1000pL of 75mM s4 UTP. Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF] GSM7903256 GSM7903256: zebrafish 2hour wt 75mM s4u r1; Danio rerio; RNA Seq GSM7903256 r1 GSM7903256 1 Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP472252   loader:fastq load.py s2h_1.fastq.gz fastq 4689849655.0 46434155.0 GSM7903256 r1 0:101 A:1611038201;C:846984275;G:953714532;T:1275424861;N:2687786 101       1611038201 846984275 953714532 1275424861 2687786 SRX22541150 SRS19550735 SRA1751928 Bazzini Lab, Stowers Institute for Medical Research Bazzini Lab, Stowers Institute for Medical Research 1 0.67301   0.15612   0.82171   0.63462   101   B   usable mapping rate illumina nextseq_v2 3prime small_rna lexogen bulk unknown unknown   United States 2023-11-15 Cleavage Embryo Embryo Imprecise All anatomical structures
28937 28937 SRR26845671 SRX22541149 SRS19550733 SRP472252 PRJNA1040929 Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] GSE247933 Other Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. parent bioproject:PRJNA1040928     zebrafish 1hour wt 75mM s4u r3 GSM7903255   tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing zebrafish 1hour wt 75mM s4u r3 Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; Embryos at 1 hpf Embryos were injected with 1000pL of 75mM s4 UTP. Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF] GSM7903255 GSM7903255: zebrafish 1hour wt 75mM s4u r3; Danio rerio; RNA Seq GSM7903255 r1 GSM7903255 1 Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP472252   loader:fastq load.py s1h_3.fastq.gz fastq 5540992108.0 54861308.0 GSM7903255 r1 0:101 A:1856189531;C:1011042624;G:1124613529;T:1546055477;N:3090947 101       1856189531 1011042624 1124613529 1546055477 3090947 SRX22541149 SRS19550733 SRA1751928 Bazzini Lab, Stowers Institute for Medical Research Bazzini Lab, Stowers Institute for Medical Research 1 0.72187   0.16436   0.82416   0.64431   101   B   usable mapping rate illumina nextseq_v2 3prime small_rna lexogen bulk unknown unknown   United States 2023-11-15 Cleavage Embryo Embryo Imprecise All anatomical structures
28938 28938 SRR26845672 SRX22541148 SRS19550734 SRP472252 PRJNA1040929 Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] GSE247933 Other Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. parent bioproject:PRJNA1040928     zebrafish 1hour wt 75mM s4u r2 GSM7903254   tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing zebrafish 1hour wt 75mM s4u r2 Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; Embryos at 1 hpf Embryos were injected with 1000pL of 75mM s4 UTP. Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF] GSM7903254 GSM7903254: zebrafish 1hour wt 75mM s4u r2; Danio rerio; RNA Seq GSM7903254 r1 GSM7903254 1 Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP472252   loader:fastq load.py s1h_2.fastq.gz fastq 4572239397.0 45269697.0 GSM7903254 r1 0:101 A:1530268631;C:831534079;G:915378596;T:1292534173;N:2523918 101       1530268631 831534079 915378596 1292534173 2523918 SRX22541148 SRS19550734 SRA1751928 Bazzini Lab, Stowers Institute for Medical Research Bazzini Lab, Stowers Institute for Medical Research 1 0.72394   0.15187   0.81753   0.63236   101   B   usable mapping rate illumina nextseq_v2 3prime small_rna lexogen bulk unknown unknown   United States 2023-11-15 Cleavage Embryo Embryo Imprecise All anatomical structures
28939 28939 SRR26845673 SRX22541147 SRS19550732 SRP472252 PRJNA1040929 Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] GSE247933 Other Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. parent bioproject:PRJNA1040928     zebrafish 1hour wt 75mM s4u r1 GSM7903253   tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing zebrafish 1hour wt 75mM s4u r1 Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; Embryos at 1 hpf Embryos were injected with 1000pL of 75mM s4 UTP. Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF] GSM7903253 GSM7903253: zebrafish 1hour wt 75mM s4u r1; Danio rerio; RNA Seq GSM7903253 r1 GSM7903253 1 Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 2000   SRP472252   loader:fastq load.py s1h_1.fastq.gz fastq 4271986597.0 42296897.0 GSM7903253 r1 0:101 A:1447221671;C:787487923;G:887526673;T:1147409594;N:2340736 101       1447221671 787487923 887526673 1147409594 2340736 SRX22541147 SRS19550732 SRA1751928 Bazzini Lab, Stowers Institute for Medical Research Bazzini Lab, Stowers Institute for Medical Research 1 0.68805   0.18469   0.83175   0.62945   101   B   usable mapping rate illumina nextseq_v2 3prime small_rna lexogen bulk unknown unknown   United States 2023-11-15 Cleavage Embryo Embryo Imprecise All anatomical structures
30769 30769 SRR28348935 SRX23954961 SRS20755382 SRP495323 PRJNA1088158 Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis. GSE261646 Transcriptome Analysis The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and nee…   pubmed:39302832   Zebrafish Embryo 2hpf rep3 GSM8147858   source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing Zebrafish Embryo 2hpf rep3 Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates Whole embryo   Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.   tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF GSM8147858 GSM8147858: Zebrafish Embryo 2hpf rep3; Danio rerio; RNA Seq GSM8147858 r1 GSM8147858 1 Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP495323     s_2hpf_3.fastq fastq 1748504032.0 23006632.0 GSM8147858 r1 0:76 A:420580006;C:434589498;G:408972977;T:484281127;N:80424 76       420580006 434589498 408972977 484281127 80424 SRX23954961 SRS20755382 SRA1824599 Computational Biology, Stowers Institute for Medical Research Computational Biology, Stowers Institute for Medical Research                       B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk bulk bulk   United States 2024-03-14 Cleavage Embryo Whole Organism All anatomical structures
30770 30770 SRR28348936 SRX23954960 SRS20755381 SRP495323 PRJNA1088158 Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis. GSE261646 Transcriptome Analysis The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and nee…   pubmed:39302832   Zebrafish Embryo 2hpf rep2 GSM8147857   source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing Zebrafish Embryo 2hpf rep2 Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates Whole embryo   Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.   tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF GSM8147857 GSM8147857: Zebrafish Embryo 2hpf rep2; Danio rerio; RNA Seq GSM8147857 r1 GSM8147857 1 Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP495323     s_2hpf_2.fastq fastq 1578919456.0 20775256.0 GSM8147857 r1 0:76 A:380440230;C:393721925;G:368114931;T:436571104;N:71266 76       380440230 393721925 368114931 436571104 71266 SRX23954960 SRS20755381 SRA1824599 Computational Biology, Stowers Institute for Medical Research Computational Biology, Stowers Institute for Medical Research                       B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk bulk bulk   United States 2024-03-14 Cleavage Embryo Whole Organism All anatomical structures
30771 30771 SRR28348937 SRX23954959 SRS20755380 SRP495323 PRJNA1088158 Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis. GSE261646 Transcriptome Analysis The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and nee…   pubmed:39302832   Zebrafish Embryo 2hpf rep1 GSM8147856   source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing Zebrafish Embryo 2hpf rep1 Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates Whole embryo   Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.   tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF GSM8147856 GSM8147856: Zebrafish Embryo 2hpf rep1; Danio rerio; RNA Seq GSM8147856 r1 GSM8147856 1 Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files.   RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA NextSeq 500   SRP495323     s_2hpf_1.fastq fastq 1730435412.0 22768887.0 GSM8147856 r1 0:76 A:420026952;C:428388301;G:403718608;T:478219805;N:81746 76       420026952 428388301 403718608 478219805 81746 SRX23954959 SRS20755380 SRA1824599 Computational Biology, Stowers Institute for Medical Research Computational Biology, Stowers Institute for Medical Research                       B   usable mapping rate illumina nextseq unknown cdna_unspecified trueseq bulk bulk bulk   United States 2024-03-14 Cleavage Embryo Whole Organism All anatomical structures
31528 31528 SRR28423881 SRX24027916 SRS20821688 SRP497294 PRJNA1090898 The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169 GSE262247 Transcriptome Analysis The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq. parent bioproject:PRJNA1090894 pubmed:39271818   ventricular cells myd88 / 24 hpci GSM8161054   source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing ventricular cells myd88 / 24 hpci Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs cardiac ventricles cardiac cryoinjury 24 hours prior to heart extraction Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.   tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury GSM8161054 GSM8161054: ventricular cells myd88 / 24 hpci; Danio rerio; RNA Seq GSM8161054 r1 GSM8161054 1 Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 2000   SRP497294     Pinelopi_10x_Zebrafish_Mut_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_Mut_Lib_R2.fastq.gz fastq fastq 31356990530.0 394538049.0 GSM8161054 r1 0:28 1:51.48 A:8573180857;C:6884590114;G:7520784498;T:8220228225;N:158206836 28 51     8573180857 6884590114 7520784498 8220228225 158206836 SRX24027916 SRS20821688 SRA1832827 MPI for heart and lung research MPI for heart and lung research                       T B sc-like readlen illumina nextseq_v2 unknown cdna_unspecified unknown sc single_cell_droplet 10x   Germany 2024-03-22 Cleavage Embryo Heart Cardiovascular System
31529 31529 SRR28423882 SRX24027915 SRS20821687 SRP497294 PRJNA1090898 The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169 GSE262247 Transcriptome Analysis The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq. parent bioproject:PRJNA1090894 pubmed:39271818   ventricular cells myd88+/+ 24 hpci GSM8161053   source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing ventricular cells myd88+/+ 24 hpci Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs cardiac ventricles cardiac cryoinjury 24 hours prior to heart extraction Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.   tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury GSM8161053 GSM8161053: ventricular cells myd88+/+ 24 hpci; Danio rerio; RNA Seq GSM8161053 r1 GSM8161053 1 Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.   RNA-Seq TRANSCRIPTOMIC SINGLE CELL cDNA PAIRED ILLUMINA NextSeq 2000   SRP497294     Pinelopi_10x_Zebrafish_WT_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_WT_Lib_R2.fastq.gz fastq fastq 40672259373.0 511650018.0 GSM8161053 r1 0:28 1:51.49 A:11079272327;C:8809520398;G:9307205642;T:11269370263;N:206890743 28 51     11079272327 8809520398 9307205642 11269370263 206890743 SRX24027915 SRS20821687 SRA1832827 MPI for heart and lung research MPI for heart and lung research                       T B sc-like readlen illumina nextseq_v2 unknown cdna_unspecified unknown sc single_cell_droplet 10x   Germany 2024-03-22 Cleavage Embryo Heart Cardiovascular System
34036 34036 SRR31033345 SRX26418807 SRS22938440 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish Riboseq M 4cell 5 GSM8579730   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing Zebrafish Riboseq M 4cell 5 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a GSM8579730 GSM8579730: Zebrafish Riboseq M 4cell 5; Danio rerio; RNA Seq GSM8579730 r1 GSM8579730 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     M-4cell-5_L1_1.fq.gz M-4cell-5_L1_2.fq.gz fastq fastq 5643278100.0 18810927.0 GSM8579730 r1 0:150 1:150 A:1555401034;C:1268722567;G:1323837426;T:1495279385;N:37688 150 150     1555401034 1268722567 1323837426 1495279385 37688 SRX26418807 SRS22938440 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
34037 34037 SRR31033351 SRX26418806 SRS22938443 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish Riboseq M 4cell 4 GSM8579729   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing Zebrafish Riboseq M 4cell 4 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a GSM8579729 GSM8579729: Zebrafish Riboseq M 4cell 4; Danio rerio; RNA Seq GSM8579729 r1 GSM8579729 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     M-4cell-4_L1_1.fq.gz M-4cell-4_L1_2.fq.gz fastq fastq 6607232100.0 22024107.0 GSM8579729 r1 0:150 1:150 A:1825603885;C:1480833466;G:1538474482;T:1762276005;N:44262 150 150     1825603885 1480833466 1538474482 1762276005 44262 SRX26418806 SRS22938443 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
34038 34038 SRR31033346 SRX26418805 SRS22938438 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish Riboseq M 4cell 3 GSM8579728   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing Zebrafish Riboseq M 4cell 3 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a GSM8579728 GSM8579728: Zebrafish Riboseq M 4cell 3; Danio rerio; RNA Seq GSM8579728 r1 GSM8579728 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     M-4cell-3_L1_1.fq.gz M-4cell-3_L1_2.fq.gz fastq fastq 7948794900.0 26495983.0 GSM8579728 r1 0:150 1:150 A:2183592013;C:1794605656;G:1863773539;T:2106770087;N:53605 150 150     2183592013 1794605656 1863773539 2106770087 53605 SRX26418805 SRS22938438 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
34039 34039 SRR31033350 SRX26418804 SRS22938441 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish Riboseq M 4cell 2 GSM8579727   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing Zebrafish Riboseq M 4cell 2 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a GSM8579727 GSM8579727: Zebrafish Riboseq M 4cell 2; Danio rerio; RNA Seq GSM8579727 r1 GSM8579727 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     M-4cell-2_L1_1.fq.gz M-4cell-2_L1_2.fq.gz fastq fastq 7036510200.0 23455034.0 GSM8579727 r1 0:150 1:150 A:1830698676;C:1686461802;G:1754202163;T:1765099649;N:47910 150 150     1830698676 1686461802 1754202163 1765099649 47910 SRX26418804 SRS22938441 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
34047 34047 SRR31033355 SRX26418796 SRS22938428 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish RNAseq Sibling 4cell 4 GSM8579719   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing Zebrafish RNAseq Sibling 4cell 4 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type GSM8579719 GSM8579719: Zebrafish RNAseq Sibling 4cell 4; Danio rerio; RNA Seq GSM8579719 r1 GSM8579719 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     Sibling-4cell-4_L1_1.fq.gz Sibling-4cell-4_L1_2.fq.gz fastq fastq 7424662500.0 24748875.0 GSM8579719 r1 0:150 1:150 A:2045351766;C:1671617139;G:1731338149;T:1976305596;N:49850 150 150     2045351766 1671617139 1731338149 1976305596 49850 SRX26418796 SRS22938428 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
34048 34048 SRR31033358 SRX26418795 SRS22938431 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish RNAseq Sibling 4cell 2 GSM8579718   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing Zebrafish RNAseq Sibling 4cell 2 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type GSM8579718 GSM8579718: Zebrafish RNAseq Sibling 4cell 2; Danio rerio; RNA Seq GSM8579718 r1 GSM8579718 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     Sibling-4cell-2_L1_1.fq.gz Sibling-4cell-2_L1_2.fq.gz fastq fastq 6484454400.0 21614848.0 GSM8579718 r1 0:150 1:150 A:1701212104;C:1544478776;G:1597991536;T:1640728663;N:43321 150 150     1701212104 1544478776 1597991536 1640728663 43321 SRX26418795 SRS22938431 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
34049 34049 SRR31033356 SRX26418794 SRS22938430 SRP539223 PRJNA1174207 Rbm24 dictates mRNA recruitment for germ plasm assembly GSE279756 Transcriptome Analysis Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf.       Zebrafish RNAseq Sibling 4cell 1 GSM8579717   source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing Zebrafish RNAseq Sibling 4cell 1 Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample whole embryo   Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type GSM8579717 GSM8579717: Zebrafish RNAseq Sibling 4cell 1; Danio rerio; RNA Seq GSM8579717 r1 GSM8579717 1 Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions.   RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000   SRP539223     Sibling-4cell-1_L1_1.fq.gz Sibling-4cell-1_L1_2.fq.gz fastq fastq 8126999700.0 27089999.0 GSM8579717 r1 0:150 1:150 A:2195769442;C:1872416059;G:1934390760;T:2124367874;N:55565 150 150     2195769442 1872416059 1934390760 2124367874 55565 SRX26418794 SRS22938430 SRA1993092 Shandong university Shandong university                       B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk bulk bulk   China 2024-10-17 Cleavage Embryo Whole Organism All anatomical structures
36258 36258 SRR062659 SRX025027 SRS085806 SRP003165 PRJNA127881 High throughput sequencing of mRNA from oocyte 1 cell 16/32 cells 128/256 cells 3.5hpf and 5.3hpf zebrafish embryos Wild type; AB line GSE22830 Transcriptome Analysis mRNA seq based approach to determine the transcriptome dynamics during early development To study the mechanisms regulating this developmental event in zebrafish we applied RNA deep sequencing technology and generated comprehensive transcriptome profiles of 6 developmental stages from oocyte to early gastrulation. We determined the expression levels of maternal and zygotic transcripts and clustered them based on expression pattern. We identified a large number of novel transcribed regions in un annotated regions of the genome as well as splice variants with an estimated frequency of 40 75% during early zebrafish embryogenesis. Our data constitute a useful resource for developmental studies gene discovery and genome annotation. Overall design: RNA was extracted from pooled embryos of desired stages and one RNA seq library was generated for each sample. Totally 6 stages were selected: Maternal 1cell 16/32 cells 128/256 cells 3.5hpf and 5.3hpf   pubmed:21555364;pubmed:24586560;pubmed:23676078   16/32 cells GSM564429   tissue:developing embryos|background:AB; wild type|developmental stage:mixure of 16/32 cell embryos 16/32 cells ABI pipeline BioScope v1.0.1 Data analysis: The SOLiD generated RNA Seq reads was in 50bp length and an initial filtering process was taken to remove any non desirable contamination sequences such as rRNA tRNA and repeats etc. A seed and extension mapping approach was developed to map the 50bp reads into reference genome zv7 and also into the respective zv7 refGene annotation separately. During mapping of the reads to the refGene annotation a splice junction database fasta file is generated to which the reads are mapped to. This database contains known and putative junction sequences created by taking 46bp from the joining ends of adjacent and non adjacent exons for each gene and putting them together simulating the genomic sequences of known and putative junctions respectively. The first 25bp of the 50bp read was used as the seed for alignment for each read. When an alignment cannot be found using these 25bp seed the seed window is shifted and the next 25bp seed is taken from the 21st to the 45th base of the read. An extension step follows when the seed is able to map and a score generated for each extended base to determine best alignment. A merging step is performed on the genome mapping and splice junction mapping to determine a set of alignments for each read from which a unique alignment is found based on the score generated for these alignments. Mapping parameters:  Mapping was done using Applied Biosystems’ SOLiD BioScope alignment for whole transcriptome analysis pipeline.  Two mismatches were allowed in the 25bp color space seed sequence with extension alignment performed to find the full mapping location.  A score is computed for each mapping location and any location that scored <22 were filtered. Generation of gff and bedgraph files: GFF files were produced by parsing the output BAM format and extracted for unique alignments with score >22. The bedgraph files are then produced with the resulting gff file. developing embryos Embryos were frozen at the desired developmental stages and RNAs was extracted for sequencing. mRNA seq was performed by Mission Biotech Taiwan. SOLiD sequencing libraries were prepared using the Whole Transcriptome Library Preparation for SOLiD™ Sequencing kit ABI according to manufacturer’s instructions. About 200 280 µg of total RNAs were used as starting materials which were subjected to polyA selection using Applied Biosystems PolyA Purist Kit AM1916 fragmentation and library construction using distinct adapters for each library SOLiD Barcoding. From each library equal volumes were pooled together and sequenced in SOLiD3 ABI platform generating 50bp tags. Zebrafish embryos AB background collected just post fertilization were reared and harvested at desired time points. Unfertilized oocytes were collected by squeezing the abdomen of spawning females. Harvested embryos were snap frozen in liquid nitrogen and stored in −80°C. Total RNA was extracted from whole embryos using Trizol Invitrogen according to manufacturer’s instructions. RNA concentrations were determined using NanoDrop 2000 Thermo Scientific. Integrity of RNA samples were determined using Agilent RNA 6000 Nano chip and size separated using Agilent 2100 Bioanalyzer. Total RNA obtained per 100 embryos at each developmental stage was calculated for data normalization purposes. background:AB; wild type|developmental stage:mixure of 16/32 cell embryos GSM564429 GSM564429: 16/32 cells GSM564429: 16/32 cells GSM564429: 16/32 cells 1   GEO Accession:GSM564429 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD System 3.0 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP003165         1792238300.0 35844766.0 GSM564429 1 0:50   50                 SRX025027 SRS085806 SRA022850 GEO Computational and Systems Biology, Genome Institute of Singapore 1 0.6993   0.04019   0.83763   0.50284   50   B   usable mapping rate legacy early full_length poly_a unknown bulk unknown unknown   Singapore 2010-07-08 Cleavage Embryo Embryo Imprecise All anatomical structures
36297 36297 SRR393000 SRX113357 SRS284301 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments Wild type 2hpf 2 GSM854439   source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf Ribosome protected fragments Wild type 2hpf 2 Ribo Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo wild type   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf GSM854439 GSM854439: Ribosome protected fragments Wild type 2hpf 2; Danio rerio; RNA Seq GSM854439 1 GSM854439: Ribosome protected fragments Wild type 2hpf 2 1   GEO Accession:GSM854439 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040     Ribo_Wt_2_B1.fq fastq 217015848.0 3014109.0 GSM854439 r1 0:72 A:73500339;C:46583724;G:47804114;T:49117423;N:10248 72       73500339 46583724 47804114 49117423 10248 SRX113357 SRS284301 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 2e-05   0.0   0.99997   1.0   72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36298 36298 SRR393001 SRX113357 SRS284301 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments Wild type 2hpf 2 GSM854439   source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf Ribosome protected fragments Wild type 2hpf 2 Ribo Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo wild type   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf GSM854439 GSM854439: Ribosome protected fragments Wild type 2hpf 2; Danio rerio; RNA Seq GSM854439 1 GSM854439: Ribosome protected fragments Wild type 2hpf 2 1   GEO Accession:GSM854439 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040   instrument model:Illumina HiSeq 2000 Ribo_Wt_2_B2.fq fastq 976804848.0 13566734.0 GSM854439 r2 0:72 A:312362919;C:205660950;G:237663406;T:221097191;N:20382 72       312362919 205660950 237663406 221097191 20382 SRX113357 SRS284301 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.0   0.0   1.0       72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36299 36299 SRR392998 SRX113356 SRS284300 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments Wild type 2hpf GSM854438   source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf Ribosome protected fragments Wild type 2hpf Ribo Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo wild type   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf GSM854438 GSM854438: Ribosome protected fragments Wild type 2hpf; Danio rerio; RNA Seq GSM854438 1 GSM854438: Ribosome protected fragments Wild type 2hpf 1   GEO Accession:GSM854438 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040     Ribo_Wt_2_A1.fq fastq 284876712.0 3956621.0 GSM854438 r1 0:72 A:88022040;C:68867093;G:63794882;T:64180749;N:11948 72       88022040 68867093 63794882 64180749 11948 SRX113356 SRS284300 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.00011   7e-05   0.99995   0.0   72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36300 36300 SRR392999 SRX113356 SRS284300 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments Wild type 2hpf GSM854438   source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf Ribosome protected fragments Wild type 2hpf Ribo Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo wild type   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf GSM854438 GSM854438: Ribosome protected fragments Wild type 2hpf; Danio rerio; RNA Seq GSM854438 1 GSM854438: Ribosome protected fragments Wild type 2hpf 1   GEO Accession:GSM854438 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040   instrument model:Illumina HiSeq 2000 Ribo_Wt_2_A2.fq fastq 1197987552.0 16638716.0 GSM854438 r2 0:72 A:346631182;C:288138913;G:296030268;T:267150788;N:36401 72       346631182 288138913 296030268 267150788 36401 SRX113356 SRS284300 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 3e-05   0.0   0.99997   0.0   72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36309 36309 SRR392988 SRX113351 SRS284295 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments MZdicer 2hpf 2 GSM854433   source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf Ribosome protected fragments MZdicer 2hpf 2 Ribo Dicer 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo MZdicer   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf GSM854433 GSM854433: Ribosome protected fragments MZdicer 2hpf 2; Danio rerio; RNA Seq GSM854433 1 GSM854433: Ribosome protected fragments MZdicer 2hpf 2 1   GEO Accession:GSM854433 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040     Ribo_Dicer_2_B1.fq fastq 72956952.0 1013291.0 GSM854433 r1 0:72 A:22006501;C:17986138;G:16833834;T:16127785;N:2694 72       22006501 17986138 16833834 16127785 2694 SRX113351 SRS284295 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.00131   0.00114   0.99991   0.88888   72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36310 36310 SRR392989 SRX113351 SRS284295 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments MZdicer 2hpf 2 GSM854433   source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf Ribosome protected fragments MZdicer 2hpf 2 Ribo Dicer 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo MZdicer   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf GSM854433 GSM854433: Ribosome protected fragments MZdicer 2hpf 2; Danio rerio; RNA Seq GSM854433 1 GSM854433: Ribosome protected fragments MZdicer 2hpf 2 1   GEO Accession:GSM854433 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040   instrument model:Illumina HiSeq 2000 Ribo_Dicer_2_B2.fq fastq 454127328.0 6307324.0 GSM854433 r2 0:72 A:124676855;C:112665084;G:119208313;T:97572172;N:4904 72       124676855 112665084 119208313 97572172 4904 SRX113351 SRS284295 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.0   0.0   1.0       72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36311 36311 SRR392986 SRX113350 SRS284294 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments MZdicer 2hpf GSM854432   source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf Ribosome protected fragments MZdicer 2hpf Ribo Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo MZdicer   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf GSM854432 GSM854432: Ribosome protected fragments MZdicer 2hpf; Danio rerio; RNA Seq GSM854432 1 GSM854432: Ribosome protected fragments MZdicer 2hpf 1   GEO Accession:GSM854432 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040     Ribo_Dicer_2_A1.fq fastq 216257400.0 3003575.0 GSM854432 r1 0:72 A:66784432;C:51526758;G:47615177;T:50321714;N:9319 72       66784432 51526758 47615177 50321714 9319 SRX113350 SRS284294 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 6e-05   1e-05   0.99995   1.0   72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36312 36312 SRR392987 SRX113350 SRS284294 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Ribosome protected fragments MZdicer 2hpf GSM854432   source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf Ribosome protected fragments MZdicer 2hpf Ribo Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo MZdicer   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf GSM854432 GSM854432: Ribosome protected fragments MZdicer 2hpf; Danio rerio; RNA Seq GSM854432 1 GSM854432: Ribosome protected fragments MZdicer 2hpf 1   GEO Accession:GSM854432 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040   instrument model:Illumina HiSeq 2000 Ribo_Dicer_2_A2.fq fastq 953861544.0 13248077.0 GSM854432 r2 0:72 A:256595558;C:242054835;G:238026249;T:217176275;N:8627 72       256595558 242054835 238026249 217176275 8627 SRX113350 SRS284294 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 9e-05   3e-05   0.99993   1.0   72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36321 36321 SRR392976 SRX113345 SRS284289 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Input mRNA Seq Wild type 2hpf 2 GSM854427   source name:Whole embryo wild type|sample type:input mRNA|tissue:whole embryo|genotype:wild type|development stage:2hpf|genetic background:TUAB Input mRNA Seq Wild type 2hpf 2 Input Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo wild type   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:input mRNA|tissue:whole embryo|genotype:wild type|developmental stage:2hpf|genetic background:TUAB GSM854427 GSM854427: Input mRNA Seq Wild type 2hpf 2; Danio rerio; RNA Seq GSM854427 1 GSM854427: Input mRNA Seq Wild type 2hpf 2 1   GEO Accession:GSM854427 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040     Input_Wt_2_B1.fq fastq 395024832.0 5486456.0 GSM854427 r1 0:72 A:142810926;C:92574191;G:71835480;T:87787309;N:16926 72       142810926 92574191 71835480 87787309 16926 SRX113345 SRS284289 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.0   0.0   1.0       72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36322 36322 SRR392977 SRX113345 SRS284289 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Input mRNA Seq Wild type 2hpf 2 GSM854427   source name:Whole embryo wild type|sample type:input mRNA|tissue:whole embryo|genotype:wild type|development stage:2hpf|genetic background:TUAB Input mRNA Seq Wild type 2hpf 2 Input Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo wild type   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:input mRNA|tissue:whole embryo|genotype:wild type|developmental stage:2hpf|genetic background:TUAB GSM854427 GSM854427: Input mRNA Seq Wild type 2hpf 2; Danio rerio; RNA Seq GSM854427 1 GSM854427: Input mRNA Seq Wild type 2hpf 2 1   GEO Accession:GSM854427 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040   instrument model:Illumina HiSeq 2000 Input_Wt_2_B2.fq fastq 1778028768.0 24694844.0 GSM854427 r2 0:72 A:599303071;C:388710416;G:399829888;T:390165838;N:19555 72       599303071 388710416 399829888 390165838 19555 SRX113345 SRS284289 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.0   0.0   1.0       72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36323 36323 SRR392974 SRX113344 SRS284288 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Input mRNA Seq Wild type 2hpf GSM854426   source name:Whole embryo wild type|sample type:input mRNA|tissue:whole embryo|genotype:wild type|development stage:2hpf|genetic background:TUAB Input mRNA Seq Wild type 2hpf Input Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo wild type   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:input mRNA|tissue:whole embryo|genotype:wild type|developmental stage:2hpf|genetic background:TUAB GSM854426 GSM854426: Input mRNA Seq Wild type 2hpf; Danio rerio; RNA Seq GSM854426 1 GSM854426: Input mRNA Seq Wild type 2hpf 1   GEO Accession:GSM854426 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040     Input_Wt_2_A1.fq fastq 315124632.0 4376731.0 GSM854426 r1 0:72 A:116463238;C:74027349;G:54200798;T:70419115;N:14132 72       116463238 74027349 54200798 70419115 14132 SRX113344 SRS284288 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.0   0.0   1.0       72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36324 36324 SRR392975 SRX113344 SRS284288 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Input mRNA Seq Wild type 2hpf GSM854426   source name:Whole embryo wild type|sample type:input mRNA|tissue:whole embryo|genotype:wild type|development stage:2hpf|genetic background:TUAB Input mRNA Seq Wild type 2hpf Input Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo wild type   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:input mRNA|tissue:whole embryo|genotype:wild type|developmental stage:2hpf|genetic background:TUAB GSM854426 GSM854426: Input mRNA Seq Wild type 2hpf; Danio rerio; RNA Seq GSM854426 1 GSM854426: Input mRNA Seq Wild type 2hpf 1   GEO Accession:GSM854426 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040   instrument model:Illumina HiSeq 2000 Input_Wt_2_A2.fq fastq 1366683048.0 18981709.0 GSM854426 r2 0:72 A:475749702;C:303155361;G:282027500;T:305707196;N:43289 72       475749702 303155361 282027500 305707196 43289 SRX113344 SRS284288 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.0   0.0   1.0       72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36331 36331 SRR392966 SRX113340 SRS284284 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Input mRNA Seq MZdicer 2hpf GSM854422   source name:Whole embryo MZdicer|sample type:input mRNA|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf|genetic background:TUAB Input mRNA Seq MZdicer 2hpf Input Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo MZdicer   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:input mRNA|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf|genetic background:TUAB GSM854422 GSM854422: Input mRNA Seq MZdicer 2hpf; Danio rerio; RNA Seq GSM854422 1 GSM854422: Input mRNA Seq MZdicer 2hpf 1   GEO Accession:GSM854422 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040     Input_Dicer_2_A1.fq fastq 197997408.0 2749964.0 GSM854422 r1 0:72 A:73258529;C:47205089;G:34750581;T:42774230;N:8979 72       73258529 47205089 34750581 42774230 8979 SRX113340 SRS284284 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.0   0.0   1.0       72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36332 36332 SRR392967 SRX113340 SRS284284 SRP010040 PRJNA150397 Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay GSE34743 Transcriptome Analysis MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos   pubmed:22422859   Input mRNA Seq MZdicer 2hpf GSM854422   source name:Whole embryo MZdicer|sample type:input mRNA|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf|genetic background:TUAB Input mRNA Seq MZdicer 2hpf Input Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence Whole embryo MZdicer   Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC…   sample type:input mRNA|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf|genetic background:TUAB GSM854422 GSM854422: Input mRNA Seq MZdicer 2hpf; Danio rerio; RNA Seq GSM854422 1 GSM854422: Input mRNA Seq MZdicer 2hpf 1   GEO Accession:GSM854422 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP010040   instrument model:Illumina HiSeq 2000 Input_Dicer_2_A2.fq fastq 821282832.0 11406706.0 GSM854422 r2 0:72 A:289320106;C:176199303;G:179059045;T:176687758;N:16620 72       289320106 176199303 179059045 176687758 16620 SRX113340 SRS284284 SRA048903 GEO Giraldez Lab, Genetics, Yale University 1 0.0   0.0   1.0       72   T   under 1.2% mapping rate illumina early_illumina unknown poly_a unknown bulk unknown unknown   United States 2011-12-27 Cleavage Embryo Whole Organism All anatomical structures
36355 36355 SRR372788 SRX107384 SRS280824 SRP009426 PRJNA154389 Comprehensive identification of long non coding RNAs expressed during zebrafish embryogenesis [RNA seq] GSE32898 Transcriptome Analysis Long non coding RNAs lncRNAs comprise a diverse class of transcripts that structurally resemble mRNAs but do not encode proteins. Recent genome wide studies in human and mouse have annotated lncRNAs expressed in cell lines and adult tissues but a systematic analysis of lncRNAs expressed during vertebrate embryogenesis has been elusive. To identify lncRNAs with potential functions in vertebrate embryogenesis we performed a time series of RNA Seq experiments at eight stages during early zebrafish development. We reconstructed 56 535 high confidence transcripts in 28 912 loci recovering the vast majority of expressed RefSeq transcripts while identifying thousands of novel isoforms and expressed loci. We defined a stringent set of 1 133 non coding multi exonic transcripts expressed during embryogenesis. These include long intergenic ncRNAs lincRNAs intronic overlapping lncRNAs exonic antisense overlapping lncRNAs and precursors for small RNAs sRNAs. Zebrafish lncRNAs share many of the characteristics of their mammalian counterparts: relatively short length low exon number low expression and conservation levels comparable to introns. Subsets of lncRNAs carry chromatin signatures characteristic of genes with developmental functions. The temporal expression profile of lncRNAs revealed two novel properties: lncRNAs are expressed in narrower time windows than protein coding genes and are specifically enriched in early stage embryos. In addition several lncRNAs show tissue specific expression and distinct subcellular localization patterns. Integrative computational analyses associated individual lncRNAs with specific pathways and functions ranging from cell cycle regulation to morphogenesis. Our study provides the first comprehensive identification of lncRNAs in a vertebrate embryo and forms the foundation for future genetic genomic and evolutionary studies. Overall design: RNA Seq for 8 zebrafish developmental stages 2 lanes for each stage 3 for shield. parent bioproject:PRJNA146503 pubmed:22110045;pubmed:23698349   2 4cell 2 GSM831504   source name:2 4cell RNA Seq|tissue:embryo|development stage:embryogenesis: 2 4 cell stage|stdev for insert size:1301.769583 2 4cell 2 Th summary result files of he developmental transcriptome of all samples are available as supplementary information with the paper. 2 4cell RNA Seq   Total RNA was isolated using the standard Trizol Invitrogen protocol. Two rounds of PolyA+ RNA purification were performed for each sample using the PolyAPuristTM MAG kit Ambion. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bioanalyzer. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed in Levin et al. 2010. Zebrafish embryos were dechorionated at the 1 cell stage followed by incubation at 28C. tissue:embryo|developmental stage:embryogenesis: 2 4 cell stage|average insert size fragment length:673.36217|stdev for insert size:1301.769583 GSM831504 GSM831504: 2 4cell 2 GSM831504: 2 4cell 2 GSM831504: 2 4cell 2 1   GEO Accession:GSM831504 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>152</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>77</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP009426         9256767320.0 60899785.0 GSM831504 1 0:76 1:76 A:2412461359;C:2170215834;G:2234888308;T:2438303823;N:897996 76 76     2412461359 2170215834 2234888308 2438303823 897996 SRX107384 SRS280824 SRA048184 GEO Sandelin, Dep. of Biology, University of Copenhagen 2 0.93703 0.94416 0.03525 0.03149 0.80129 0.79188 0.49723 0.49656 76 76 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   Denmark 2011-11-11 Cleavage Embryo Embryo Imprecise All anatomical structures
36356 36356 SRR372787 SRX107383 SRS280823 SRP009426 PRJNA154389 Comprehensive identification of long non coding RNAs expressed during zebrafish embryogenesis [RNA seq] GSE32898 Transcriptome Analysis Long non coding RNAs lncRNAs comprise a diverse class of transcripts that structurally resemble mRNAs but do not encode proteins. Recent genome wide studies in human and mouse have annotated lncRNAs expressed in cell lines and adult tissues but a systematic analysis of lncRNAs expressed during vertebrate embryogenesis has been elusive. To identify lncRNAs with potential functions in vertebrate embryogenesis we performed a time series of RNA Seq experiments at eight stages during early zebrafish development. We reconstructed 56 535 high confidence transcripts in 28 912 loci recovering the vast majority of expressed RefSeq transcripts while identifying thousands of novel isoforms and expressed loci. We defined a stringent set of 1 133 non coding multi exonic transcripts expressed during embryogenesis. These include long intergenic ncRNAs lincRNAs intronic overlapping lncRNAs exonic antisense overlapping lncRNAs and precursors for small RNAs sRNAs. Zebrafish lncRNAs share many of the characteristics of their mammalian counterparts: relatively short length low exon number low expression and conservation levels comparable to introns. Subsets of lncRNAs carry chromatin signatures characteristic of genes with developmental functions. The temporal expression profile of lncRNAs revealed two novel properties: lncRNAs are expressed in narrower time windows than protein coding genes and are specifically enriched in early stage embryos. In addition several lncRNAs show tissue specific expression and distinct subcellular localization patterns. Integrative computational analyses associated individual lncRNAs with specific pathways and functions ranging from cell cycle regulation to morphogenesis. Our study provides the first comprehensive identification of lncRNAs in a vertebrate embryo and forms the foundation for future genetic genomic and evolutionary studies. Overall design: RNA Seq for 8 zebrafish developmental stages 2 lanes for each stage 3 for shield. parent bioproject:PRJNA146503 pubmed:22110045;pubmed:23698349   2 4cell 1 GSM831503   source name:2 4cell RNA Seq|tissue:embryo|developmental stage:embryogenesis: 2 4 cell stage|stdev for insert size:1336.039246 2 4cell 1 Th summary result files of he developmental transcriptome of all samples are available as supplementary information with the paper. 2 4cell RNA Seq   Total RNA was isolated using the standard Trizol Invitrogen protocol. Two rounds of PolyA+ RNA purification were performed for each sample using the PolyAPuristTM MAG kit Ambion. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bioanalyzer. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed in Levin et al. 2010. Zebrafish embryos were dechorionated at the 1 cell stage followed by incubation at 28C. tissue:embryo|developmental stage:embryogenesis: 2 4 cell stage|average insert size fragment length:710.502832|stdev for insert size:1336.039246 GSM831503 GSM831503: 2 4cell 1 GSM831503: 2 4cell 1 GSM831503: 2 4cell 1 1   GEO Accession:GSM831503 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>152</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>77</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP009426         6454083552.0 42461076.0 GSM831503 1 0:76 1:76 A:1659789336;C:1511027834;G:1564153032;T:1683582419;N:35530931 76 76     1659789336 1511027834 1564153032 1683582419 35530931 SRX107383 SRS280823 SRA048184 GEO Sandelin, Dep. of Biology, University of Copenhagen 2 0.82115 0.94097 0.02927 0.02775 0.84362 0.79864 0.49872 0.49708 76 76 B B biological fallback assumption illumina hiseq_era unknown poly_a unknown bulk unknown unknown   Denmark 2011-11-11 Cleavage Embryo Embryo Imprecise All anatomical structures
36358 36358 SRR489491 SRX143568 SRS310289 SRP012376 PRJNA160143 Extensive alternative polyadenylation during zebrafish development GSE37453 Transcriptome Analysis The post transcriptional fate of messenger RNAs mRNAs is largely dictated by their three prime' untranslated regions three prime'UTRs which are defined by cleavage and polyadenylation CPA of pre mRNAs. We used polyA position profiling by sequencing 3P Seq to map polyA sites at eight developmental stages and tissues in the zebrafish. Analysis of over 60 million 3P Seq reads substantially increased and improved existing three prime'UTR annotations resulting in confidently identified three prime'UTRs for more than 78.79% of the annotated protein coding genes in zebrafish. Most zebrafish genes undergo alternative CPA with more than a thousand genes using different dominant three prime'UTRs at different stages. three prime'UTRs tend to be shortest in the ovaries and longest in the brain. Isoforms with some of the shortest three prime'UTRs are highly expressed in the ovary yet absent in the maternally contributed RNAs of the embryo perhaps because their three prime'UTRs are too short to accommodate a uridine rich motif required for stability of the maternal mRNA. At two hpf thousands of unique polyA sites appear at locations lacking a typical polyadenylation signal which suggests a wave of widespread cytoplasmic polyadenylation of mRNA degradation intermediates. Our insights into the identities formation and evolution of zebrafish three prime'UTRs provide a resource for studying gene regulation during vertebrate development. Overall design: 3P Seq was used to map the three prime' ends of protein coding genes in the zebrafish genome   pubmed:22722342   3P PE Seq PreMZT GSM919974   source name:whole embryo at 1.5 hpf 2 hpf type|tissue:whole embryo|development stage:1.5 hpf 2 hpf 3P PE Seq PreMZT For 3P Seq: Reads were reverse complemented and aligned to the D. rerio genome Zv9/danRer7 using Bowtie. Reads that aligned to up to four genomic locus and had one or more mismatches at their three prime end within a terminal adenylate run were carried forward as 3P tags. Reads mapping to the same locus with the same number of terminal adenylates were consolidated in the processed data file. The BED file is as in Jan et al. GSE24924 For 3P PE Seq: In each read pair read #1 captured the three prime end of the polyA tail in the antisense orientation and read #2 captured a portion of the three prime region of the transcript and occasionally the beginning of the polyA tail in the sense orientation. Read #2 began with an adapter of 26 bases. Reads with more than 10 mismatches to the adapter were discarded and the first 26 bases were removed before further processing. A read pair was considered informative only if read #1 began with Ts and read #2 contained 2–39 terminal As. post leading Ts and terminal As were removed from reads #1 and #2 respectively they were mapped to the genome using Bowtie allowing for up to two mismatches and requiring a unique mapping position in the zebrafish genome. The length of the tail encoded in read #2 was defined as the maximum number of trailing As allowing for up to one mismatch. Only cases in which this number was larger than the number of As encoded in the genome at the predicted cleavage position by at least 2 bases were carried forward. Cleavage and polyadenylation position was defined as the last non A base in read #2. The length of the polyA tail at that position was estimated using the corresponding read #1 and defined as the maximal i for which >90% of the bases in the first i bases of read #1 were Ts. This criterion was used to allow for some sequencing errors expected when sequencing long homopolymers. Genome build: danRer7 Supplementary files format and content: The .bed files contain the positions where 3P Seq reads were mapped and the name of each track is the … whole embryo at 1.5 hpf 2 hpf Anesthetized decorioneted embryos were washed three times in PBS 137 mM NaCl 2.7 mM KCl 1.5 mM KH2PO4 8 mM Na2HP04 pH 7.4 and suspended in PBS containing 1% freshly added formaldehyde. Embryos were transferred to a dounce homogenizer dounced several times and incubated at room temperature for 15 min. Formaldehyde was quenched by adding 1/20 volume 2.5 M glycine. Cells were pelleted at 400 x g for 5 min. The supernatant was removed and pellets were rinsed twice with PBS flash frozen in liquid nitrogen and stored at 80C. 3P PE Seq: To selectively capture polyadenylated ends for paired end sequencing 2.5 µg of total RNA from 2–2.2 or 6 hpf zebrafish embryos was splint ligated to a three prime biotinylated adapter p AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGACACATAC biotin IDT in the presence of bridge oligo TTCCGATCTTTTTTTTT IDT using T4 Rnl2 NEB in an overnight reaction at 18°C. Following partial digestion with RNase T1 Ambion 115–750 nt RNAs were isolated from a denaturing polyacrylamide gel and ligation products were captured on streptavidin M 280 Dynabeads Invitrogen. RNAs were phosphorylated at the five prime end on beads using PNK NEB and subsequently ligated to an adapter C3.spacer GTTCAGAGTTCTAcaguccgacgauc uppercase DNA; lowercase RNA; IDT using T4 Rnl1 NEB in an overnight reaction at room temperature. Complementary DNA was synthesized on beads using SuperScript II Invitrogen primed with AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACG IDT liberated from the beads by base hydrolysis size selected 155–790 nt on a denaturing polyacrylamide gel and amplified by PCR for 15 cycles. 180–750 nt products were isolated from a formamide gel and amplified for four additional cycles using primers that contain the Illumina paired end sequencing primer binding sites. post a final formamide gel purification and size selection 220–800 nt 80x80 paired end sequencing was performed on the Illumina Hi Seq platform. Zebrafish embryos or adults grown under standard condition genotype/variation:wild type|tissue:whole embryo|developmental stage:1.5 hpf 2 hpf GSM919974 GSM919974: 3P PE Seq PreMZT; Danio rerio; RNA Seq GSM919974 2 GSM919974: 3P PE Seq PreMZT 1   GEO Accession:GSM919974 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>160</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>81</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP012376     PolyALengths_PreMZT_read2.fastq PolyALengths_PreMZT_read1.fastq fastq fastq 35175463040.0 219846644.0 GSM919974 r1 0:80 1:80 A:6774783678;C:5489443100;G:6337298045;T:13536245767;N:3037692450 80 80     6774783678 5489443100 6337298045 13536245767 3037692450 SRX143568 SRS310289 SRA051955 GEO Whitehead Institute for Biomedical Research 2 0.87245 0.00013 0.4503 5e-05 0.98912 0.99993 0.92784 1.0 80 80 B T mate2 technical by mapping diff illumina hiseq_era 5prime cdna_unspecified unknown bulk unknown unknown   United States 2012-04-20 Cleavage Embryo Whole Organism All anatomical structures
36365 36365 SRR489484 SRX143561 SRS310282 SRP012376 PRJNA160143 Extensive alternative polyadenylation during zebrafish development GSE37453 Transcriptome Analysis The post transcriptional fate of messenger RNAs mRNAs is largely dictated by their three prime' untranslated regions three prime'UTRs which are defined by cleavage and polyadenylation CPA of pre mRNAs. We used polyA position profiling by sequencing 3P Seq to map polyA sites at eight developmental stages and tissues in the zebrafish. Analysis of over 60 million 3P Seq reads substantially increased and improved existing three prime'UTR annotations resulting in confidently identified three prime'UTRs for more than 78.79% of the annotated protein coding genes in zebrafish. Most zebrafish genes undergo alternative CPA with more than a thousand genes using different dominant three prime'UTRs at different stages. three prime'UTRs tend to be shortest in the ovaries and longest in the brain. Isoforms with some of the shortest three prime'UTRs are highly expressed in the ovary yet absent in the maternally contributed RNAs of the embryo perhaps because their three prime'UTRs are too short to accommodate a uridine rich motif required for stability of the maternal mRNA. At two hpf thousands of unique polyA sites appear at locations lacking a typical polyadenylation signal which suggests a wave of widespread cytoplasmic polyadenylation of mRNA degradation intermediates. Our insights into the identities formation and evolution of zebrafish three prime'UTRs provide a resource for studying gene regulation during vertebrate development. Overall design: 3P Seq was used to map the three prime' ends of protein coding genes in the zebrafish genome   pubmed:22722342   3P Seq PreMZT 3 GSM919967   source name:whole embryo at 1.5 hpf 2 hpf type|tissue:whole embryo|development stage:1.5 hpf 2 hpf 3P Seq PreMZT 3 For 3P Seq: Reads were reverse complemented and aligned to the D. rerio genome Zv9/danRer7 using Bowtie. Reads that aligned to up to four genomic locus and had one or more mismatches at their three prime end within a terminal adenylate run were carried forward as 3P tags. Reads mapping to the same locus with the same number of terminal adenylates were consolidated in the processed data file. The BED file is as in Jan et al. GSE24924 For 3P PE Seq: In each read pair read #1 captured the three prime end of the polyA tail in the antisense orientation and read #2 captured a portion of the three prime region of the transcript and occasionally the beginning of the polyA tail in the sense orientation. Read #2 began with an adapter of 26 bases. Reads with more than 10 mismatches to the adapter were discarded and the first 26 bases were removed before further processing. A read pair was considered informative only if read #1 began with Ts and read #2 contained 2–39 terminal As. post leading Ts and terminal As were removed from reads #1 and #2 respectively they were mapped to the genome using Bowtie allowing for up to two mismatches and requiring a unique mapping position in the zebrafish genome. The length of the tail encoded in read #2 was defined as the maximum number of trailing As allowing for up to one mismatch. Only cases in which this number was larger than the number of As encoded in the genome at the predicted cleavage position by at least 2 bases were carried forward. Cleavage and polyadenylation position was defined as the last non A base in read #2. The length of the polyA tail at that position was estimated using the corresponding read #1 and defined as the maximal i for which >90% of the bases in the first i bases of read #1 were Ts. This criterion was used to allow for some sequencing errors expected when sequencing long homopolymers. Genome build: danRer7 Supplementary files format and content: The .bed files contain the positions where 3P Seq reads were mapped and the name of each track is the … whole embryo at 1.5 hpf 2 hpf Anesthetized decorioneted embryos were washed three times in PBS 137 mM NaCl 2.7 mM KCl 1.5 mM KH2PO4 8 mM Na2HP04 pH 7.4 and suspended in PBS containing 1% freshly added formaldehyde. Embryos were transferred to a dounce homogenizer dounced several times and incubated at room temperature for 15 min. Formaldehyde was quenched by adding 1/20 volume 2.5 M glycine. Cells were pelleted at 400 x g for 5 min. The supernatant was removed and pellets were rinsed twice with PBS flash frozen in liquid nitrogen and stored at 80C. 3P Seq; see http://web.wi.mit.edu/bartel/pub/protocols.html Zebrafish embryos or adults grown under standard condition genotype/variation:wild type|tissue:whole embryo|developmental stage:1.5 hpf 2 hpf GSM919967 GSM919967: 3P Seq PreMZT 3; Danio rerio; RNA Seq GSM919967 1 GSM919967: 3P Seq PreMZT 3 1   GEO Accession:GSM919967 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000 <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>40</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP012376     3P_Seq_PreMZT_3.fastq fastq 2568831200.0 64220780.0 GSM919967 r1 0:40 A:928593325;C:457629269;G:462667409;T:719889166;N:52031 40       928593325 457629269 462667409 719889166 52031 SRX143561 SRS310282 SRA051955 GEO Whitehead Institute for Biomedical Research 1 0.71138   0.10487   0.79904   0.51337   40   B   usable mapping rate illumina hiseq_era 3prime cdna_unspecified unknown bulk unknown unknown   United States 2012-04-20 Cleavage Embryo Whole Organism All anatomical structures
36366 36366 SRR489483 SRX143560 SRS310281 SRP012376 PRJNA160143 Extensive alternative polyadenylation during zebrafish development GSE37453 Transcriptome Analysis The post transcriptional fate of messenger RNAs mRNAs is largely dictated by their three prime' untranslated regions three prime'UTRs which are defined by cleavage and polyadenylation CPA of pre mRNAs. We used polyA position profiling by sequencing 3P Seq to map polyA sites at eight developmental stages and tissues in the zebrafish. Analysis of over 60 million 3P Seq reads substantially increased and improved existing three prime'UTR annotations resulting in confidently identified three prime'UTRs for more than 78.79% of the annotated protein coding genes in zebrafish. Most zebrafish genes undergo alternative CPA with more than a thousand genes using different dominant three prime'UTRs at different stages. three prime'UTRs tend to be shortest in the ovaries and longest in the brain. Isoforms with some of the shortest three prime'UTRs are highly expressed in the ovary yet absent in the maternally contributed RNAs of the embryo perhaps because their three prime'UTRs are too short to accommodate a uridine rich motif required for stability of the maternal mRNA. At two hpf thousands of unique polyA sites appear at locations lacking a typical polyadenylation signal which suggests a wave of widespread cytoplasmic polyadenylation of mRNA degradation intermediates. Our insights into the identities formation and evolution of zebrafish three prime'UTRs provide a resource for studying gene regulation during vertebrate development. Overall design: 3P Seq was used to map the three prime' ends of protein coding genes in the zebrafish genome   pubmed:22722342   3P Seq PreMZT 2 GSM919966   source name:whole embryo at 1.5 hpf 2 hpf type|tissue:whole embryo|development stage:1.5 hpf 2 hpf 3P Seq PreMZT 2 For 3P Seq: Reads were reverse complemented and aligned to the D. rerio genome Zv9/danRer7 using Bowtie. Reads that aligned to up to four genomic locus and had one or more mismatches at their three prime end within a terminal adenylate run were carried forward as 3P tags. Reads mapping to the same locus with the same number of terminal adenylates were consolidated in the processed data file. The BED file is as in Jan et al. GSE24924 For 3P PE Seq: In each read pair read #1 captured the three prime end of the polyA tail in the antisense orientation and read #2 captured a portion of the three prime region of the transcript and occasionally the beginning of the polyA tail in the sense orientation. Read #2 began with an adapter of 26 bases. Reads with more than 10 mismatches to the adapter were discarded and the first 26 bases were removed before further processing. A read pair was considered informative only if read #1 began with Ts and read #2 contained 2–39 terminal As. post leading Ts and terminal As were removed from reads #1 and #2 respectively they were mapped to the genome using Bowtie allowing for up to two mismatches and requiring a unique mapping position in the zebrafish genome. The length of the tail encoded in read #2 was defined as the maximum number of trailing As allowing for up to one mismatch. Only cases in which this number was larger than the number of As encoded in the genome at the predicted cleavage position by at least 2 bases were carried forward. Cleavage and polyadenylation position was defined as the last non A base in read #2. The length of the polyA tail at that position was estimated using the corresponding read #1 and defined as the maximal i for which >90% of the bases in the first i bases of read #1 were Ts. This criterion was used to allow for some sequencing errors expected when sequencing long homopolymers. Genome build: danRer7 Supplementary files format and content: The .bed files contain the positions where 3P Seq reads were mapped and the name of each track is the … whole embryo at 1.5 hpf 2 hpf Anesthetized decorioneted embryos were washed three times in PBS 137 mM NaCl 2.7 mM KCl 1.5 mM KH2PO4 8 mM Na2HP04 pH 7.4 and suspended in PBS containing 1% freshly added formaldehyde. Embryos were transferred to a dounce homogenizer dounced several times and incubated at room temperature for 15 min. Formaldehyde was quenched by adding 1/20 volume 2.5 M glycine. Cells were pelleted at 400 x g for 5 min. The supernatant was removed and pellets were rinsed twice with PBS flash frozen in liquid nitrogen and stored at 80C. 3P Seq; see http://web.wi.mit.edu/bartel/pub/protocols.html Zebrafish embryos or adults grown under standard condition genotype/variation:wild type|tissue:whole embryo|developmental stage:1.5 hpf 2 hpf GSM919966 GSM919966: 3P Seq PreMZT 2; Danio rerio; RNA Seq GSM919966 1 GSM919966: 3P Seq PreMZT 2 1   GEO Accession:GSM919966 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP012376     3P_Seq_PreMZT_2.fastq fastq 706103748.0 19613993.0 GSM919966 r1 0:36 A:259247584;C:125282714;G:127103688;T:194451978;N:17784 36       259247584 125282714 127103688 194451978 17784 SRX143560 SRS310281 SRA051955 GEO Whitehead Institute for Biomedical Research 1 0.54759   0.0884   0.81371   0.51819   36   B   usable mapping rate illumina early_illumina 3prime cdna_unspecified unknown bulk unknown unknown   United States 2012-04-20 Cleavage Embryo Whole Organism All anatomical structures
36367 36367 SRR489482 SRX143559 SRS310280 SRP012376 PRJNA160143 Extensive alternative polyadenylation during zebrafish development GSE37453 Transcriptome Analysis The post transcriptional fate of messenger RNAs mRNAs is largely dictated by their three prime' untranslated regions three prime'UTRs which are defined by cleavage and polyadenylation CPA of pre mRNAs. We used polyA position profiling by sequencing 3P Seq to map polyA sites at eight developmental stages and tissues in the zebrafish. Analysis of over 60 million 3P Seq reads substantially increased and improved existing three prime'UTR annotations resulting in confidently identified three prime'UTRs for more than 78.79% of the annotated protein coding genes in zebrafish. Most zebrafish genes undergo alternative CPA with more than a thousand genes using different dominant three prime'UTRs at different stages. three prime'UTRs tend to be shortest in the ovaries and longest in the brain. Isoforms with some of the shortest three prime'UTRs are highly expressed in the ovary yet absent in the maternally contributed RNAs of the embryo perhaps because their three prime'UTRs are too short to accommodate a uridine rich motif required for stability of the maternal mRNA. At two hpf thousands of unique polyA sites appear at locations lacking a typical polyadenylation signal which suggests a wave of widespread cytoplasmic polyadenylation of mRNA degradation intermediates. Our insights into the identities formation and evolution of zebrafish three prime'UTRs provide a resource for studying gene regulation during vertebrate development. Overall design: 3P Seq was used to map the three prime' ends of protein coding genes in the zebrafish genome   pubmed:22722342   3P Seq PreMZT GSM919965   source name:whole embryo at 1.5 hpf 2 hpf type|tissue:whole embryo|development stage:1.5 hpf 2 hpf 3P Seq PreMZT For 3P Seq: Reads were reverse complemented and aligned to the D. rerio genome Zv9/danRer7 using Bowtie. Reads that aligned to up to four genomic locus and had one or more mismatches at their three prime end within a terminal adenylate run were carried forward as 3P tags. Reads mapping to the same locus with the same number of terminal adenylates were consolidated in the processed data file. The BED file is as in Jan et al. GSE24924 For 3P PE Seq: In each read pair read #1 captured the three prime end of the polyA tail in the antisense orientation and read #2 captured a portion of the three prime region of the transcript and occasionally the beginning of the polyA tail in the sense orientation. Read #2 began with an adapter of 26 bases. Reads with more than 10 mismatches to the adapter were discarded and the first 26 bases were removed before further processing. A read pair was considered informative only if read #1 began with Ts and read #2 contained 2–39 terminal As. post leading Ts and terminal As were removed from reads #1 and #2 respectively they were mapped to the genome using Bowtie allowing for up to two mismatches and requiring a unique mapping position in the zebrafish genome. The length of the tail encoded in read #2 was defined as the maximum number of trailing As allowing for up to one mismatch. Only cases in which this number was larger than the number of As encoded in the genome at the predicted cleavage position by at least 2 bases were carried forward. Cleavage and polyadenylation position was defined as the last non A base in read #2. The length of the polyA tail at that position was estimated using the corresponding read #1 and defined as the maximal i for which >90% of the bases in the first i bases of read #1 were Ts. This criterion was used to allow for some sequencing errors expected when sequencing long homopolymers. Genome build: danRer7 Supplementary files format and content: The .bed files contain the positions where 3P Seq reads were mapped and the name of each track is the … whole embryo at 1.5 hpf 2 hpf Anesthetized decorioneted embryos were washed three times in PBS 137 mM NaCl 2.7 mM KCl 1.5 mM KH2PO4 8 mM Na2HP04 pH 7.4 and suspended in PBS containing 1% freshly added formaldehyde. Embryos were transferred to a dounce homogenizer dounced several times and incubated at room temperature for 15 min. Formaldehyde was quenched by adding 1/20 volume 2.5 M glycine. Cells were pelleted at 400 x g for 5 min. The supernatant was removed and pellets were rinsed twice with PBS flash frozen in liquid nitrogen and stored at 80C. 3P Seq; see http://web.wi.mit.edu/bartel/pub/protocols.html Zebrafish embryos or adults grown under standard condition genotype/variation:wild type|tissue:whole embryo|developmental stage:1.5 hpf 2 hpf GSM919965 GSM919965: 3P Seq PreMZT; Danio rerio; RNA Seq GSM919965 1 GSM919965: 3P Seq PreMZT 1   GEO Accession:GSM919965 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> SRP012376     3P_Seq_PreMZT.fastq fastq 612082764.0 17002299.0 GSM919965 r1 0:36 A:226644687;C:107265813;G:109073433;T:168922136;N:176695 36       226644687 107265813 109073433 168922136 176695 SRX143559 SRS310280 SRA051955 GEO Whitehead Institute for Biomedical Research 1 0.56415   0.09075   0.8114   0.50672   36   B   usable mapping rate illumina early_illumina 3prime cdna_unspecified unknown bulk unknown unknown   United States 2012-04-20 Cleavage Embryo Whole Organism All anatomical structures
36694 36694 SRR801679 SRX258160 SRS406291 SRP020469 PRJNA195909 RNA sequencing project for zebrafish embryo and larva development GSE45706 Transcriptome Analysis Zebrafish is an important model system for the study of vertebrate embryonic development and adaptive immunese response. recent yrs have seen great advancement in the understanding of the regulatory mechanisms during zebrafish embryogenesis and immune processes yet large gaps still remain in the functional pathways critical for each developmental stage especially for the late embryonic development. We sequenced the polyA extracted mRNA from 9 stages covering 7 major developmental periods of zebrafish. Whole genome gene expression pattern were analyzed to reveal unknown pathways or factors with implicated roles during each stage of vertebrate development. Overall design: Analysis of total mRNA by highthroughput sequencing in 9 stages covering 7 periods during the embryonic and larval development of zebrafish   pubmed:23700457;pubmed:26891128 source: Zebrafish embryos at the 64 cell stage GSM1112155: 64 cell 2 hpf GSM1112155   strain:AB|developmental stage:64 cell 2 hpf|tissue:embryo 64 cell 2 hpf Primary processing by SOLiD 3.0 online software The short SOLiD reads were aligned against the zebrafish genome build Zv9 using the software package Bioscope v1.2 obtained from Life Techlogies. Reads per kilobase of transcript per million mapped reads RPKM were calculated using an in house developed perl script which is available upon request. Genome build: Zv9 Supplementary files format and content: tab delimited text files including RPKM values for gene models from the genome annotation release Ensembl 62 of the Zv9 assembly Zebrafish embryos at the 64 cell stage Liquid nitrogen rapid cooling methods were used for zebrafish embryos and larvae euthanasia. Total RNA was extracted from each stage of about 2000 embryos or larvae using Trizol Invitrogen Carlsbad CA USA methods according to the manufacturer’s instruction. RNA quality was evaluated by gel electrophoresis and the concentration was measured with NanoDrop 2000 Thermo Scientific，Waltham MA USA.The aliquots were stored at 80 oC. A protocol/kit available from Life Technologies with minor modifications was used to construct mRNA seq libraries. First the total RNA was estimated on an Agilent 2100 Bioanalyzer Agilent Technologies Waldbronn Germany. Second The ribosomal RNA removal steps were replaced by two rounds of polyA purification with the first round using the PolyATtract® mRNA Isolation Systems Promega Madison WI USA and the second round using the PolyAPurist™ Kit Ambion Austin TX USA. About 0.8 μg of mRNA was fragmented with 10min at 37 oC RNase III treatment. The fragmented mRNA were ligated with adaptor Mix A subsequently used for reverse transcription. The first strand cDNA were separated using 6% TBE Urea Gel Invitrogen Carlsbad CA USA and 100–200 nt fraction was recovered. The fractionated cDNA were subjected to 11 15 cycles of PCR amplification with the PCR products purified to yield the SOLiD Fragment Library ready for emulsion PCR. Emulsion PCR was performed using 600 pg of the library. All experiments were performed on full sequencing slides. Zebrafish embryos and larvae were collected and maintained at approximately 28.5°C and were staged according to their morphological features and hours h or days dpf as described previously Kimmel et al. 1995 strain:AB|developmental stage:64 cell 2 hpf|tissue:embryo GSM1112155 GSM1112155: 64 cell 2 hpf; Danio rerio; RNA Seq GSM1112155 1   1   GEO Accession:GSM1112155 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ABI_SOLID AB SOLiD System 3.0   SRP020469     D_rerio_64cell_F3.csfasta.bz2 D_rerio_64cell_F3_QV.qual.bz2 SOLiD_native SOLiD_native 11793112050.0 235862241.0 GSM1112155 r1 0:50 0:2729453191;1:3189868180;2:3325229431;3:2482063391;.:66497857 50                 SRX258160 SRS406291 SRA072427 GEO Shanghai Chenshan Botanical Garden 1 0.56575   0.01697   0.8538   0.48681   50   B   usable mapping rate legacy early unknown poly_a unknown bulk unknown unknown   China 2013-04-02 Cleavage Embryo Embryo Imprecise All anatomical structures
36989 36989 SRR870747 SRX288478 SRS431105 SRP023492 PRJNA206070 Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition GSE47558 Other Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT   pubmed:24056933   WT 2hpf Total mRNA GSM1152440   source name:WT 2hpf Total mRNA|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA WT 2hpf Total mRNA Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. WT 2hpf Total mRNA Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012.   tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA GSM1152440 GSM1152440: WT 2hpf Total mRNA; Danio rerio; RNA Seq GSM1152440   1 For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. GEO Accession:GSM1152440 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP023492     W2.run1_f0.fastq.gz fastq 203106276.0 2672451.0 GSM1152440 r1 0:76 A:39556313;C:62215497;G:57574227;T:43753218;N:7021 76       39556313 62215497 57574227 43753218 7021 SRX288478 SRS431105 SRA082637 GEO Giraldez Lab, Genetics, Yale University 1 0.89932   0.14283   0.79537   0.6949   76   B   usable mapping rate illumina hiseq_era unknown rrna_depletion ribozero bulk unknown unknown   United States 2013-05-31 Cleavage Embryo Whole Organism All anatomical structures
36990 36990 SRR870748 SRX288478 SRS431105 SRP023492 PRJNA206070 Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition GSE47558 Other Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT   pubmed:24056933   WT 2hpf Total mRNA GSM1152440   source name:WT 2hpf Total mRNA|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA WT 2hpf Total mRNA Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. WT 2hpf Total mRNA Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012.   tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA GSM1152440 GSM1152440: WT 2hpf Total mRNA; Danio rerio; RNA Seq GSM1152440   1 For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. GEO Accession:GSM1152440 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP023492     W2.run1_f1.fastq.gz fastq 304000000.0 4000000.0 GSM1152440 r2 0:76 A:59049134;C:93274080;G:86287062;T:65360620;N:29104 76       59049134 93274080 86287062 65360620 29104 SRX288478 SRS431105 SRA082637 GEO Giraldez Lab, Genetics, Yale University 1 0.89775   0.14047   0.79492   0.72145   76   B   usable mapping rate illumina hiseq_era unknown rrna_depletion ribozero bulk unknown unknown   United States 2013-05-31 Cleavage Embryo Whole Organism All anatomical structures
36991 36991 SRR870749 SRX288478 SRS431105 SRP023492 PRJNA206070 Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition GSE47558 Other Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT   pubmed:24056933   WT 2hpf Total mRNA GSM1152440   source name:WT 2hpf Total mRNA|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA WT 2hpf Total mRNA Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. WT 2hpf Total mRNA Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012.   tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA GSM1152440 GSM1152440: WT 2hpf Total mRNA; Danio rerio; RNA Seq GSM1152440   1 For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. GEO Accession:GSM1152440 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP023492     W2.run2_f0.fastq.gz fastq 198979248.0 2618148.0 GSM1152440 r3 0:76 A:38850253;C:60847024;G:56292278;T:42982425;N:7268 76       38850253 60847024 56292278 42982425 7268 SRX288478 SRS431105 SRA082637 GEO Giraldez Lab, Genetics, Yale University 1 0.90135   0.14238   0.79525   0.72238   76   B   usable mapping rate illumina hiseq_era unknown rrna_depletion ribozero bulk unknown unknown   United States 2013-05-31 Cleavage Embryo Whole Organism All anatomical structures
36992 36992 SRR870750 SRX288478 SRS431105 SRP023492 PRJNA206070 Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition GSE47558 Other Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT   pubmed:24056933   WT 2hpf Total mRNA GSM1152440   source name:WT 2hpf Total mRNA|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA WT 2hpf Total mRNA Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. WT 2hpf Total mRNA Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012.   tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA GSM1152440 GSM1152440: WT 2hpf Total mRNA; Danio rerio; RNA Seq GSM1152440   1 For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. GEO Accession:GSM1152440 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP023492     W2.run2_f1.fastq.gz fastq 304000000.0 4000000.0 GSM1152440 r4 0:76 A:59259860;C:93069912;G:86074433;T:65573954;N:21841 76       59259860 93069912 86074433 65573954 21841 SRX288478 SRS431105 SRA082637 GEO Giraldez Lab, Genetics, Yale University 1 0.90021   0.14063   0.79531   0.69776   76   B   usable mapping rate illumina hiseq_era unknown rrna_depletion ribozero bulk unknown unknown   United States 2013-05-31 Cleavage Embryo Whole Organism All anatomical structures
37234 37234 SRR1146564 SRX451693 SRS544829 SRP033369 PRJNA230112 PolyA tail profiling reveals an embryonic switch in translational control GSE52809 Other PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species   pubmed:24476825   Dre 155 2hpf PAL GSM1316816   tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf Dre 155 2hpf PAL Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. zebrafish embryo RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 Each sample was grown or maintained in accordance with standard protocols. strain:AB|developmental stage:2 hpf GSM1316816 GSM1316816: Dre 155 2hpf PAL; Danio rerio; RNA Seq GSM1316816   1 Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 GEO Accession:GSM1316816 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II   SRP033369     Dre_155_2hpf_PAL_sequences.txt.gz fastq 359788448.0 8775328.0 GSM1316816 r1 0:41 A:85325483;C:54760617;G:79441969;T:135974691;N:4285688 41       85325483 54760617 79441969 135974691 4285688 SRX451693 SRS544829 SRA114402 GEO Bartel, Biology, Whitehead Institute for Biomedical Research 1 0.55281   0.12799   0.85399   0.57589   41   B   usable mapping rate illumina early_illumina 3prime small_rna unknown bulk unknown unknown   United States 2014-01-29 Cleavage Embryo Embryo Imprecise All anatomical structures
37235 37235 SRR1146563 SRX451692 SRS544828 SRP033369 PRJNA230112 PolyA tail profiling reveals an embryonic switch in translational control GSE52809 Other PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species   pubmed:24476825   Dre 132 2hpf PAL GSM1316815   tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf Dre 132 2hpf PAL Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. zebrafish embryo RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 Each sample was grown or maintained in accordance with standard protocols. strain:AB|developmental stage:2 hpf GSM1316815 GSM1316815: Dre 132 2hpf PAL; Danio rerio; RNA Seq GSM1316815   1 Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 GEO Accession:GSM1316815 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II   SRP033369     Dre_132_2hpf_PAL_sequences.txt.gz fastq 381247110.0 9298710.0 GSM1316815 r1 0:41 A:89344310;C:58798497;G:80235521;T:148523775;N:4345007 41       89344310 58798497 80235521 148523775 4345007 SRX451692 SRS544828 SRA114402 GEO Bartel, Biology, Whitehead Institute for Biomedical Research 1 0.56455   0.12077   0.86628   0.56964   41   B   usable mapping rate illumina early_illumina 3prime small_rna unknown bulk unknown unknown   United States 2014-01-29 Cleavage Embryo Embryo Imprecise All anatomical structures
37236 37236 SRR1146562 SRX451691 SRS544827 SRP033369 PRJNA230112 PolyA tail profiling reveals an embryonic switch in translational control GSE52809 Other PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species   pubmed:24476825   Dre mock 2hpf PAL GSM1316814   tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf Dre mock 2hpf PAL Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. zebrafish embryo RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 Each sample was grown or maintained in accordance with standard protocols. strain:AB|developmental stage:2 hpf GSM1316814 GSM1316814: Dre mock 2hpf PAL; Danio rerio; RNA Seq GSM1316814   1 Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 GEO Accession:GSM1316814 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina Genome Analyzer II   SRP033369     Dre_mock_2hpf_PAL_sequences.txt.gz fastq 377647351.0 9210911.0 GSM1316814 r1 0:41 A:87549066;C:56716380;G:81391312;T:147721892;N:4268701 41       87549066 56716380 81391312 147721892 4268701 SRX451691 SRS544827 SRA114402 GEO Bartel, Biology, Whitehead Institute for Biomedical Research 1 0.55884   0.12609   0.85731   0.55373   41   B   usable mapping rate illumina early_illumina 3prime small_rna unknown bulk unknown unknown   United States 2014-01-29 Cleavage Embryo Embryo Imprecise All anatomical structures
37243 37243 SRR1039875 SRX384685 SRS508883 SRP033369 PRJNA230112 PolyA tail profiling reveals an embryonic switch in translational control GSE52809 Other PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species   pubmed:24476825   Dre 155 2hpf RPF GSM1276556   tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf Dre 155 2hpf RPF Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. zebrafish embryo RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 Each sample was grown or maintained in accordance with standard protocols. strain:AB|developmental stage:2 hpf GSM1276556 GSM1276556: Dre 155 2hpf RPF; Danio rerio; RNA Seq GSM1276556   1 Libraries were constructed exactly as described in Guo et al. 2010 GSE22004 RNA seq GEO Accession:GSM1276556 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP033369     Dre_155_2hpf_RPF_GCCAAT-s_2_1_sequence.txt fastq 1183731400.0 29593285.0 GSM1276556 r1 0:40 A:294292314;C:281794141;G:332579260;T:274773786;N:291899 40       294292314 281794141 332579260 274773786 291899 SRX384685 SRS508883 SRA114402 GEO Bartel, Biology, Whitehead Institute for Biomedical Research 1 0.04234   0.00777   0.94795   0.7945   40   B   usable mapping rate illumina hiseq_era 3prime small_rna unknown bulk unknown unknown   United States 2013-11-27 Cleavage Embryo Embryo Imprecise All anatomical structures
37244 37244 SRR1039874 SRX384684 SRS508884 SRP033369 PRJNA230112 PolyA tail profiling reveals an embryonic switch in translational control GSE52809 Other PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species   pubmed:24476825   Dre 132 2hpf RPF GSM1276555   tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf Dre 132 2hpf RPF Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. zebrafish embryo RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 Each sample was grown or maintained in accordance with standard protocols. strain:AB|developmental stage:2 hpf GSM1276555 GSM1276555: Dre 132 2hpf RPF; Danio rerio; RNA Seq GSM1276555   1 Libraries were constructed exactly as described in Guo et al. 2010 GSE22004 RNA seq GEO Accession:GSM1276555 RNA-Seq TRANSCRIPTOMIC cDNA SINGLE ILLUMINA Illumina HiSeq 2000   SRP033369     Dre_132_2hpf_RPF_ACAGTG-s_2_1_sequence.txt fastq 1178603560.0 29465089.0 GSM1276555 r1 0:40 A:298397078;C:284717833;G:331869329;T:263329002;N:290318 40       298397078 284717833 331869329 263329002 290318 SRX384684 SRS508884 SRA114402 GEO Bartel, Biology, Whitehead Institute for Biomedical Research 1 0.05095   0.00846   0.94111   0.79521   40   B   usable mapping rate illumina hiseq_era 3prime small_rna unknown bulk unknown unknown   United States 2013-11-27 Cleavage Embryo Embryo Imprecise All anatomical structures

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;