run_metadata
445 rows where devstage_curation = "Cleavage" and experiment.library_layout = "SINGLE"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 71 | 71 | DRR032753 | DRX029559 | DRS049958 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 114 individuals | Dr 8cell 2 | SAMD00028150 | sample name:Dr 8cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028150 | DRX029559 | Dr 8cell 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028150 | 3708921900.0 | 37089219.0 | DRR032753 | 0:100 1:0 | A:985502141;C:874161613;G:869551685;T:979663686;N:42775 | 100 | 0 | 985502141 | 874161613 | 869551685 | 979663686 | 42775 | DRX029559 | DRS049958 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.93329 | 0.02366 | 0.78896 | 0.47447 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 72 | 72 | DRR032752 | DRX029558 | DRS049957 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 96 individuals | Dr 8cell 1 | SAMD00028149 | sample name:Dr 8cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028149 | DRX029558 | Dr 8cell 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028149 | 3666991200.0 | 36669912.0 | DRR032752 | 0:100 1:0 | A:976118513;C:862559696;G:858017821;T:970254302;N:40868 | 100 | 0 | 976118513 | 862559696 | 858017821 | 970254302 | 40868 | DRX029558 | DRS049957 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.934 | 0.02403 | 0.78877 | 0.46902 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 86 | 86 | DRR032738 | DRX029544 | DRS049943 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 100 individuals | Dr 32cell 2 | SAMD00028135 | sample name:Dr 32cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028135 | DRX029544 | Dr 32cell 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028135 | 3678713000.0 | 36787130.0 | DRR032738 | 0:100 1:0 | A:981005900;C:863203049;G:859660640;T:974807835;N:35576 | 100 | 0 | 981005900 | 863203049 | 859660640 | 974807835 | 35576 | DRX029544 | DRS049943 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.93302 | 0.02468 | 0.77441 | 0.47485 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 87 | 87 | DRR032737 | DRX029543 | DRS049942 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 95 individuals | Dr 32cell 1 | SAMD00028134 | sample name:Dr 32cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028134 | DRX029543 | Dr 32cell 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028134 | 3870906500.0 | 38709065.0 | DRR032737 | 0:100 1:0 | A:1030407751;C:909948718;G:905608620;T:1024897443;N:43968 | 100 | 0 | 1030407751 | 909948718 | 905608620 | 1024897443 | 43968 | DRX029543 | DRS049942 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.93364 | 0.02484 | 0.77307 | 0.47588 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 90 | 90 | DRR032734 | DRX029540 | DRS049939 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 107 individuals | Dr 2cell 2 | SAMD00028131 | sample name:Dr 2cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028131 | DRX029540 | Dr 2cell 2 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028131 | 3687517000.0 | 36875170.0 | DRR032734 | 0:100 1:0 | A:975272080;C:873518282;G:869743434;T:968941851;N:41353 | 100 | 0 | 975272080 | 873518282 | 869743434 | 968941851 | 41353 | DRX029540 | DRS049939 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.93204 | 0.02088 | 0.81639 | 0.47553 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 91 | 91 | DRR032733 | DRX029539 | DRS049938 | DRP003810 | PRJDB3785 | EXPANDE project | DRP003810 | Other | EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates. | mRNA extracted from pooled embryos of 108 individuals | Dr 2cell 1 | SAMD00028130 | sample name:Dr 2cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male female and mixed | Illumina HiSeq 2000 sequencing of SAMD00028130 | DRX029539 | Dr 2cell 1 | 1 | Total RNA QIAGEN RNeasy followed by TruSeq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>100</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | DRP003810 | Illumina HiSeq 2000 sequencing of SAMD00028130 | 4156651100.0 | 41566511.0 | DRR032733 | 0:100 1:0 | A:1099943617;C:985498415;G:978884426;T:1092278665;N:45977 | 100 | 0 | 1099943617 | 985498415 | 978884426 | 1092278665 | 45977 | DRX029539 | DRS049938 | DRA003460 | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo | 1 | 0.93452 | 0.02198 | 0.81197 | 0.47342 | 100 | B | usable mapping rate | illumina | hiseq_era | unknown | other | trueseq | bulk | unknown | unknown | Japan | 2017-09-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||
| 8090 | 8090 | ERR034125 | ERX012651 | ERS032266 | ERP000635 | PRJEB2512 | The Zebrafish transcriptome during early development | KI-BN-JKE-DRERIO-RNASEQ-2011 | Transcriptome Analysis | Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions. | RNA extracted from zebrafish embryo at 16 cell stage | zebrafish embryo 16 cell | SAMEA791631 | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791631|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 16cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 16cell|sex:mixed|strain:Tuebingen | Transcriptome profiling of early zebrafish development | KI BN JKE DRERIO RNASEQ 2011 16cell | JKE Drerio rna seq | Transcriptome profiling of 16 cell stage of zebrafish embryos. | Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems. | RNA-Seq | TRANSCRIPTOMIC | RANDOM | SINGLE | ABI_SOLID | AB SOLiD System 3.0 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>50</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | ERP000635 | AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development | ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16 | KI-BN-JKE-DRERIO-RNASEQ-2011-16cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-16cell_QV.qual.gz | SOLiD_native SOLiD_native | 4256756500.0 | 85135130.0 | KI BN JKE DRERIO RNASEQ 2011 16cell | 0:50 | 50 | ERX012651 | ERS032266 | ERA029959 | KI-BN|Department of Biosciences and Nutrition | Department of Biosciences and Nutrition, Karolinska Institutet, Sweden | 1 | 0.57946 | 0.08115 | 0.91896 | 0.72164 | 50 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | unknown | unknown | Sweden | 2011-06-09 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 9726 | 9726 | ERR3841993 | ERX3854555 | ERS3555998 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 2 | SAMEA5752539 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752539|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:2|common name:zebrafish|dev stage:64 cell|sample name:2|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 3 | 64 cell 3 | OTHER | RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14 | 1579307816.0 | 20780366.0 | ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 3 | 0:76 | A:589876602;C:380048242;G:392473318;T:216893826;N:15828 | 76 | 589876602 | 380048242 | 392473318 | 216893826 | 15828 | ERX3854555 | ERS3555998 | ERA2359305 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.15411 | 0.04564 | 0.97883 | 0.55376 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9727 | 9727 | ERR3841992 | ERX3854554 | ERS3556003 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 4Ei 10 | SAMEA5752544 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752544|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:7|common name:zebrafish|dev stage:64 cell|sample name:7|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:406 2 | 64 cell 4Ei | OTHER | RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14 | 1213585480.0 | 15968230.0 | ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 2 | 0:76 | A:548456563;C:244465528;G:271963808;T:148687764;N:11817 | 76 | 548456563 | 244465528 | 271963808 | 148687764 | 11817 | ERX3854554 | ERS3556003 | ERA2359305 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.21973 | 0.10926 | 0.97419 | 0.44348 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9728 | 9728 | ERR3841991 | ERX3854553 | ERS3555997 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 1 | SAMEA5752538 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752538|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:1|common name:zebrafish|dev stage:64 cell|sample name:1|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 27 01 2020 16:24:36:405 1 | 64 cell 1 | OTHER | RNA Seq | RNA-Seq | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2020 02 14 | 1494930944.0 | 19670144.0 | ena RUN Computational Biology Unit 27 01 2020 16:24:36:406 1 | 0:76 | A:543017836;C:366974203;G:367027373;T:217896401;N:15131 | 76 | 543017836 | 366974203 | 367027373 | 217896401 | 15131 | ERX3854553 | ERS3555997 | ERA2359305 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.2544 | 0.08957 | 0.96568 | 0.55681 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9742 | 9742 | ERR3489868 | ERX3511283 | ERS3556003 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 4Ei 10 | SAMEA5752544 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752544|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:7|common name:zebrafish|dev stage:64 cell|sample name:7|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 20 | 64 cell 4Ei 10 SSU | None | RCP seq | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22 | 5928054796.0 | 78000721.0 | ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 20 | 0:76 | A:2109854905;C:1377083508;G:1616166285;T:824889630;N:60468 | 76 | 2109854905 | 1377083508 | 1616166285 | 824889630 | 60468 | ERX3511283 | ERS3556003 | ERA2100634 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.61525 | 0.45233 | 0.99379 | 0.57373 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9743 | 9743 | ERR3489867 | ERX3511282 | ERS3556003 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 4Ei 10 | SAMEA5752544 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752544|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:7|common name:zebrafish|dev stage:64 cell|sample name:7|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 19 | 64 cell 4Ei 10 SSU | None | RCP seq | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22 | 9772604780.0 | 128586905.0 | ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 19 | 0:76 | A:3901301079;C:2223067879;G:2553338016;T:1094797648;N:100158 | 76 | 3901301079 | 2223067879 | 2553338016 | 1094797648 | 100158 | ERX3511282 | ERS3556003 | ERA2100634 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.52103 | 0.25046 | 0.9861 | 0.64575 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9744 | 9744 | ERR3489866 | ERX3511281 | ERS3556002 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 4Ei 0.1 | SAMEA5752543 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752543|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:6|common name:zebrafish|dev stage:64 cell|sample name:6|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 18 | 64 cell 4Ei 0.1 LSU | None | RCP seq | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 09 26 | 6730725680.0 | 88562180.0 | ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 18 | 0:76 | A:3805722011;C:1188715051;G:1382258076;T:353814168;N:216374 | 76 | 3805722011 | 1188715051 | 1382258076 | 353814168 | 216374 | ERX3511281 | ERS3556002 | ERA2100634 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.61922 | 0.37217 | 0.99527 | 0.29148 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9745 | 9745 | ERR3489865 | ERX3511280 | ERS3556002 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 4Ei 0.1 | SAMEA5752543 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752543|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:6|common name:zebrafish|dev stage:64 cell|sample name:6|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:424 17 | 64 cell 4Ei 0.1 SSU | None | RCP seq | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 09 26 | 10616304872.0 | 139688222.0 | ena RUN Computational Biology Unit 22 08 2019 11:57:43:424 17 | 0:76 | A:4717003484;C:2600725234;G:2586105174;T:712124440;N:346540 | 76 | 4717003484 | 2600725234 | 2586105174 | 712124440 | 346540 | ERX3511280 | ERS3556002 | ERA2100634 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.30908 | 0.08252 | 0.94683 | 0.69548 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9758 | 9758 | ERR3489852 | ERX3511267 | ERS3555998 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 2 | SAMEA5752539 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752539|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:2|common name:zebrafish|dev stage:64 cell|sample name:2|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:423 4 | 64 cell 2 LSU | None | RCP seq | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22 | 11722578884.0 | 154244459.0 | ena RUN Computational Biology Unit 22 08 2019 11:57:43:423 4 | 0:76 | A:8175036829;C:1396062240;G:1882846539;T:268587131;N:46145 | 76 | 8175036829 | 1396062240 | 1882846539 | 268587131 | 46145 | ERX3511267 | ERS3555998 | ERA2100634 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.81133 | 0.41331 | 0.99823 | 0.03453 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9759 | 9759 | ERR3489851 | ERX3511266 | ERS3555998 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 2 | SAMEA5752539 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752539|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:2|common name:zebrafish|dev stage:64 cell|sample name:2|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:423 3 | 64 cell 2 SSU | None | RCP seq | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22 | 9525478088.0 | 125335238.0 | ena RUN Computational Biology Unit 22 08 2019 11:57:43:423 3 | 0:76 | A:4813606784;C:2048902072;G:2140220088;T:522714000;N:35144 | 76 | 4813606784 | 2048902072 | 2140220088 | 522714000 | 35144 | ERX3511266 | ERS3555998 | ERA2100634 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.59747 | 0.26784 | 0.996 | 0.21193 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9760 | 9760 | ERR3489850 | ERX3511265 | ERS3555997 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 1 | SAMEA5752538 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752538|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:1|common name:zebrafish|dev stage:64 cell|sample name:1|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:423 2 | 64 cell 1 LSU | None | RCP seq | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22 | 8544157652.0 | 112423127.0 | ena RUN Computational Biology Unit 22 08 2019 11:57:43:423 2 | 0:76 | A:2633354802;C:2582123846;G:2505786164;T:822713754;N:179086 | 76 | 2633354802 | 2582123846 | 2505786164 | 822713754 | 179086 | ERX3511265 | ERS3555997 | ERA2100634 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.34707 | 0.02129 | 0.99797 | 0.62478 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9761 | 9761 | ERR3489849 | ERX3511264 | ERS3555997 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 1 | SAMEA5752538 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752538|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:1|common name:zebrafish|dev stage:64 cell|sample name:1|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 22 08 2019 11:57:43:423 1 | 64 cell 1 SSU | None | RCP seq | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 08 22 | run7_64_cell_SSU_12_13_14.fastq.gz | fastq | 10139466432.0 | 133414032.0 | ena RUN Computational Biology Unit 22 08 2019 11:57:43:423 1 | 0:76 1:0 | A:4628193785;C:2494821868;G:2485640988;T:530605907;N:203884 | 76 | 0 | 4628193785 | 2494821868 | 2485640988 | 530605907 | 203884 | ERX3511264 | ERS3555997 | ERA2100634 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.06893 | 0.02559 | 0.99766 | 0.90567 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | |||||||||||||||||||||
| 9762 | 9762 | ERR3413870 | ERX3437516 | ERS3555997 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 1 | SAMEA5752538 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752538|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:1|common name:zebrafish|dev stage:64 cell|sample name:1|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 03 07 2019 14:45:09:705 2 | 64 cell 1 LSU | None | RCP seq | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 8544157652.0 | 112423127.0 | ena RUN Computational Biology Unit 03 07 2019 14:45:09:705 2 | 0:76 | A:2633354802;C:2582123846;G:2505786164;T:822713754;N:179086 | 76 | 2633354802 | 2582123846 | 2505786164 | 822713754 | 179086 | ERX3437516 | ERS3555997 | ERA2028987 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.34696 | 0.02086 | 0.99795 | 0.66261 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9763 | 9763 | ERR3413869 | ERX3437515 | ERS3555997 | ERP116106 | PRJEB33323 | Deconstructing the individual steps of vertebrate translation initiation | ena-STUDY-Computational Biology Unit-03-07-2019-10:11:34:314-422 | Other | In eukaryotes the number of ribosomes synthesizing a given protein depends on how many are recruited to its mRNA their success in navigating its five prime untranslated region UTR and whether they recognize its start codon. Initiation of translation is a rate limiting step in protein synthesis and key to gene expression control 1 but despite this centrality it remains poorly understood 2 3. Here we introduce ribosome complex profiling RCP seq to capture the transcriptome wide occupancy of scanning initiating elongating and terminating ribosome complexes in a higher eukaryote. We track scanning and elongating ribosomes across all five prime UTRs in zebrafish which enable us to assess the individual regulatory contributions from the three stages of initiation: ribosome recruitment scanning of the five prime UTR and recognition of the start codon. Our data sheds light on small subunit recruitment to mRNAs presenting evidence for the threading model and demonstrates that sequence features regulate this recruitment. We estimate the processivity of scanning ribosomes as they traverse the five prime UTR and show that the repressive effects of upstream open reading frames depend on the efficiency of both translation initiation and termination. Finally we determine the optimal initiation contexts by directly estimating the conversion of scanning to elongating ribosomes and demonstrate specific regulation of translation initiation at the endoplasmic reticulum. Our results open for the possibility of deconvoluting translation initiation into separate stages and provides the first view of global occupancy of ribosomal small subunits in a vertebrate. | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 64 cell 1 | SAMEA5752538 | Computational Biology Unit | ENA FIRST PUBLIC:2020 03 27T17:04:59Z|ENA LAST UPDATE:2019 07 03T10:01:14Z|External Id:SAMEA5752538|INSDC center name:Computational Biology Unit|INSDC first public:2020 03 27T17:04:59Z|INSDC last update:2019 07 03T10:01:14Z|INSDC status:public|Submitter Id:1|common name:zebrafish|dev stage:64 cell|sample name:1|scientific name:Danio rerio | NextSeq 500 sequencing | ena EXPERIMENT Computational Biology Unit 03 07 2019 14:45:09:705 1 | 64 cell 1 SSU | None | RCP seq | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | NextSeq 500 | ERP116106 | NextSeq 500 sequencing | ENA FIRST PUBLIC:2020 03 27|ENA LAST UPDATE:2019 07 03 | 10139466432.0 | 133414032.0 | ena RUN Computational Biology Unit 03 07 2019 14:45:09:705 1 | 0:76 | A:4628193785;C:2494821868;G:2485640988;T:530605907;N:203884 | 76 | 4628193785 | 2494821868 | 2485640988 | 530605907 | 203884 | ERX3437515 | ERS3555997 | ERA2028987 | Computational Biology Unit|European Nucleotide Archive | Computational Biology Unit | 1 | 0.06884 | 0.02526 | 0.99762 | 0.89856 | 76 | B | usable mapping rate | illumina | nextseq | unknown | other | unknown | bulk | unknown | unknown | Unknown | 2019-07-03 | Cleavage | Embryo | Undetermined | Embryo Imprecise | ||||||||||||||||||||||||
| 9919 | 9919 | ERR5167510 | ERX4972431 | ERS5593364 | ERP122761 | PRJEB39265 | RNA dynamics during zebrafish development | ena-STUDY-CENTER FOR GENOMIC REGULATION (CRG)-06-07-2020-15:41:43:771-1183 | Other | RNA dynamics during early zebrafish development | ENA FIRST PUBLIC:2022 07 05|ENA LAST UPDATE:2022 07 05 | cDNA WT 2hpf rep1 | JD T20 PDPN191089 | ENA FIRST PUBLIC:2022 07 05T12:06:34Z|organism:Danio rerio|ENA LAST UPDATE:2022 07 05T12:06:34Z|scientific name:Danio rerio|common name:zebrafish|ENA FIRST PUBLIC:2022 07 05|ENA LAST UPDATE:2022 07 05 | PromethION sequencing | ena EXPERIMENT CENTER FOR GENOMIC REGULATION CRG 21 01 2021 22:16:50:154 1 | unspecified | 1 | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | OXFORD_NANOPORE | PromethION | ERP122761 | PromethION sequencing | ENA FIRST PUBLIC:2022 07 05|ENA LAST UPDATE:2022 07 05 | ena RUN CENTER FOR GENOMIC REGULATION CRG 21 01 2021 22:16:50:154 1 | ERX4972431 | ERA3319053 | CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive | CENTER FOR GENOMIC REGULATION (CRG) | ont | ont | unknown | poly_a | unknown | bulk | unknown | unknown | Spain | 2022-07-05 | Cleavage | Embryo | Undetermined | Embryo Imprecise | |||||||||||||||||||||||||||||||||||||||||||||
| 24550 | 24550 | ERR964668 | ERX1041631 | ERS792102 | ERP011038 | PRJEB9889 | The Zebrafish transcriptome during early development | ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22 | Other | Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation. | KI BN JKE DRERIO RNASEQ | SAMEA3484817 | KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION | ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484817|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 16cell|common name:zebrafish|dev stage:16 cell|sample name:KI BN JKE DRERIO RNASEQ 2009 16cell|strain:Tuebingen | AB SOLiD System 3.0 sequencing | ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:870 2 | unspecified | 1 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD System 3.0 | ERP011038 | AB SOLiD System 3.0 sequencing | ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16 | KI-BN-JKE-DRERIO-RNASEQ-20090709-16cell_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20090709-16cell_F3_QV.qual.gz | SOLiD_native SOLiD_native | 5278508300.0 | 105570166.0 | ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:871 2 | 0:50 | 0:1410981717;1:1203936808;2:1415708111;3:1223403795;.:24477869 | 50 | ERX1041631 | ERS792102 | ERA458495 | KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive | KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION | 1 | 0.71371 | 0.09346 | 0.91539 | 0.73015 | 50 | B | usable mapping rate | legacy | early | full_length | random_priming | unknown | bulk | unknown | unknown | Sweden | 2015-07-15 | Cleavage | Embryo | Undetermined | Embryo Imprecise | |||||||||||||||||||||||||||||
| 24553 | 24553 | ERR964672 | ERX1041635 | ERS792102 | ERP011038 | PRJEB9889 | The Zebrafish transcriptome during early development | ena-STUDY-KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION-15-07-2015-15:13:51:747-22 | Other | Zebrafish has emerged as a model organism to investigate vertebrate development and human genetic diseases. However currently zebrafish annotation is still ongoing and clearly not sufficed therefore providing opportunity for novel transcript finding. With the introduction of massive parallel sequencing whole transcriptome investigations became possible through assembling entire transcriptome from overlapped sequencing reads. In the study we were aiming to discover novel transcribed regions NTRs using data from RNA sequencing. We have developed an in house bioinformatics pipeline for NTR discovery. Using the pipeline we detected 165 putative NTRs which could involve in early zebrafish development and not annotated anywhere. Six randomly selected NTRs were successfully validated experimentally using RT PCR. These NTRs provided new candidates for zebrafish transcriptome studies and zebrafish genome annotation. | KI BN JKE DRERIO RNASEQ | SAMEA3484817 | KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION | ENA first public:2015 07 16|ENA last update:2015 07 15|External Id:SAMEA3484817|INSDC center alias:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC center name:KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|INSDC first public:2015 07 16T15:54:30Z|INSDC last update:2015 07 15T15:02:15Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2009 16cell|common name:zebrafish|dev stage:16 cell|sample name:KI BN JKE DRERIO RNASEQ 2009 16cell|strain:Tuebingen | AB SOLiD System 3.0 sequencing | ena EXPERIMENT KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:872 6 | unspecified | 1 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD System 3.0 | ERP011038 | AB SOLiD System 3.0 sequencing | ENA FIRST PUBLIC:2015 07 16|ENA LAST UPDATE:2018 11 16 | KI-BN-JKE-DRERIO-RNASEQ-20091014-16cell_F3.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-20091014-16cell_F3_QV.qual.gz | SOLiD_native SOLiD_native | 2719433200.0 | 54388664.0 | ena RUN KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION 15 07 2015 15:13:47:872 6 | 0:50 | 0:699731678;1:628745158;2:754903505;3:633574679;.:2478180 | 50 | ERX1041635 | ERS792102 | ERA458495 | KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION|European Nucleotide Archive | KAROLINSKA INSTITUTET DEPARTMENT OF BIOSCIENCES AND NUTRITION | 1 | 0.73214 | 0.09566 | 0.90836 | 0.74043 | 50 | B | usable mapping rate | legacy | early | full_length | random_priming | unknown | bulk | unknown | unknown | Sweden | 2015-07-15 | Cleavage | Embryo | Undetermined | Embryo Imprecise | |||||||||||||||||||||||||||||
| 28576 | 28576 | SRR26395050 | SRX22100883 | SRS19166009 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell Iso seq | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:LR 3|BioSampleModel:Model organism or animal | PacBio Iso seq of zebrafish: 64 cell | DR 003 | DR 003 | Total RNA was isolated from each developmental stages of zebrafish embryos using TRIzolTM Reagent Invitrogen. RNA purity and concentration were assessed with the NanoPhotometer spectrophotometer IMPLEN CA USA and the Qubit RNA Assay Kit in the Qubit 3.0 Fluorometer Life Technologies CA USA. The RNA integrity number RIN was determined using the RNA Nano 6000 Assay Kit and Agilent Bioanalyzer 2100 system Agilent Technologies CA USA. RNA samples with a RIN 8 were used to synthesize cDNA with SMARTerPCR cDNA Synthesis Kit Takara Bio USA Inc. Mountain View CA USA. PCR amplification was performed using a KAPA HiFi PCR Kit Kapa Biosystems Wilmington MA USA with the optimized number of cycles. Size selection of PCR products cDNA for each sample was applied using the BluePippin System: <3 kb and >3 kb. Subsequently two cDNA libraries <3 kb >3 kb were prepared using a SMRTbell Template Prep Kit 1.0 Pacific Biosciences Menlo Park CA USA and sequenced on the PacBio sequel II platform. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | PACBIO_SMRT | Sequel | SRP466518 | cell64_1.ccs.fq.gz cell64_2.ccs.fq.gz | fastq fastq | 2829660788.0 | 1238867.0 | cell64 1.ccs.fq.gz | 0:2284.07 | A:765802910;C:646754322;G:668768985;T:748334571;N:0 | 2284 | 765802910 | 646754322 | 668768985 | 748334571 | 0 | SRX22100883 | SRS19166009 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 1 | 0.37504 | 0.00108 | 0.91149 | 0.48939 | 1913 | T | long read | pacbio | pacbio_modern | full_length | poly_a | unknown | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||
| 28935 | 28935 | SRR26845669 | SRX22541151 | SRS19550737 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 2hour wt 75mM s4u r2 | GSM7903257 | tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 2hour wt 75mM s4u r2 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 2 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF] | GSM7903257 | GSM7903257: zebrafish 2hour wt 75mM s4u r2; Danio rerio; RNA Seq | GSM7903257 r1 | GSM7903257 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s2h_2.fastq.gz | fastq | 4440596805.0 | 43966305.0 | GSM7903257 r1 | 0:101 | A:1543708731;C:806593065;G:905733733;T:1182095254;N:2466022 | 101 | 1543708731 | 806593065 | 905733733 | 1182095254 | 2466022 | SRX22541151 | SRS19550737 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.63778 | 0.15677 | 0.82676 | 0.61166 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28936 | 28936 | SRR26845670 | SRX22541150 | SRS19550735 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 2hour wt 75mM s4u r1 | GSM7903256 | tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 2hour wt 75mM s4u r1 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 2 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF] | GSM7903256 | GSM7903256: zebrafish 2hour wt 75mM s4u r1; Danio rerio; RNA Seq | GSM7903256 r1 | GSM7903256 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s2h_1.fastq.gz | fastq | 4689849655.0 | 46434155.0 | GSM7903256 r1 | 0:101 | A:1611038201;C:846984275;G:953714532;T:1275424861;N:2687786 | 101 | 1611038201 | 846984275 | 953714532 | 1275424861 | 2687786 | SRX22541150 | SRS19550735 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.67301 | 0.15612 | 0.82171 | 0.63462 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28937 | 28937 | SRR26845671 | SRX22541149 | SRS19550733 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 1hour wt 75mM s4u r3 | GSM7903255 | tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 1hour wt 75mM s4u r3 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 1 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF] | GSM7903255 | GSM7903255: zebrafish 1hour wt 75mM s4u r3; Danio rerio; RNA Seq | GSM7903255 r1 | GSM7903255 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s1h_3.fastq.gz | fastq | 5540992108.0 | 54861308.0 | GSM7903255 r1 | 0:101 | A:1856189531;C:1011042624;G:1124613529;T:1546055477;N:3090947 | 101 | 1856189531 | 1011042624 | 1124613529 | 1546055477 | 3090947 | SRX22541149 | SRS19550733 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.72187 | 0.16436 | 0.82416 | 0.64431 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28938 | 28938 | SRR26845672 | SRX22541148 | SRS19550734 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 1hour wt 75mM s4u r2 | GSM7903254 | tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 1hour wt 75mM s4u r2 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 1 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF] | GSM7903254 | GSM7903254: zebrafish 1hour wt 75mM s4u r2; Danio rerio; RNA Seq | GSM7903254 r1 | GSM7903254 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s1h_2.fastq.gz | fastq | 4572239397.0 | 45269697.0 | GSM7903254 r1 | 0:101 | A:1530268631;C:831534079;G:915378596;T:1292534173;N:2523918 | 101 | 1530268631 | 831534079 | 915378596 | 1292534173 | 2523918 | SRX22541148 | SRS19550734 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.72394 | 0.15187 | 0.81753 | 0.63236 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 28939 | 28939 | SRR26845673 | SRX22541147 | SRS19550732 | SRP472252 | PRJNA1040929 | Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data] | GSE247933 | Other | Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD. | parent bioproject:PRJNA1040928 | zebrafish 1hour wt 75mM s4u r1 | GSM7903253 | tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing | zebrafish 1hour wt 75mM s4u r1 | Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature; | Embryos at 1 hpf | Embryos were injected with 1000pL of 75mM s4 UTP. | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media. | tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF] | GSM7903253 | GSM7903253: zebrafish 1hour wt 75mM s4u r1; Danio rerio; RNA Seq | GSM7903253 r1 | GSM7903253 | 1 | Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 2000 | SRP472252 | loader:fastq load.py | s1h_1.fastq.gz | fastq | 4271986597.0 | 42296897.0 | GSM7903253 r1 | 0:101 | A:1447221671;C:787487923;G:887526673;T:1147409594;N:2340736 | 101 | 1447221671 | 787487923 | 887526673 | 1147409594 | 2340736 | SRX22541147 | SRS19550732 | SRA1751928 | Bazzini Lab, Stowers Institute for Medical Research | Bazzini Lab, Stowers Institute for Medical Research | 1 | 0.68805 | 0.18469 | 0.83175 | 0.62945 | 101 | B | usable mapping rate | illumina | nextseq_v2 | 3prime | small_rna | lexogen | bulk | unknown | unknown | United States | 2023-11-15 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 29718 | 29718 | SRR27485663 | SRX23156886 | SRS20107307 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | 4 cell R3 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:3|BioSampleModel:Model organism or animal | mRNA seq of zebrafish: embryo 1 hpf rep4 | EV06010 | EV06010 | RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV06010.R1.fastq.gz | fastq | 620142356.0 | 8227837.0 | EV06010.R1.fastq.gz | 0:75.37 | A:186029536;C:118842640;G:134072972;T:181171903;N:25305 | 75 | 186029536 | 118842640 | 134072972 | 181171903 | 25305 | SRX23156886 | SRS20107307 | SRA1783314 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 0.90656 | 0.06918 | 0.80192 | 0.72472 | 76 | B | usable mapping rate | illumina | nextseq | 3prime | poly_a | lexogen | bulk | unknown | unknown | Austria | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||||||||
| 29725 | 29725 | SRR27485670 | SRX23156879 | SRS20107300 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | 4 cell R2 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:2|BioSampleModel:Model organism or animal | mRNA seq of zebrafish: embryo 1 hpf rep4 | EV06003 | EV06003 | RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV06003.R1.fastq.gz | fastq | 706095550.0 | 9366364.0 | EV06003.R1.fastq.gz | 0:75.39 | A:204324355;C:140058731;G:159377323;T:202282197;N:52944 | 75 | 204324355 | 140058731 | 159377323 | 202282197 | 52944 | SRX23156879 | SRS20107300 | SRA1783314 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 0.90788 | 0.10297 | 0.80168 | 0.71073 | 76 | B | usable mapping rate | illumina | nextseq | 3prime | poly_a | lexogen | bulk | unknown | unknown | Austria | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||||||||
| 29736 | 29736 | SRR27477296 | SRX23148651 | SRS20099370 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | 4 cell R4 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|replicate:4|BioSampleModel:Model organism or animal | mRNA seq of zebrafish: embryo 1 hpf rep4 | EV09003 | EV09003 | RNA was extracted with Trizol and processed with QuantSeq three prime mRNA Seq Library Prep Kit FWD for Illumina Lexogen. 500 ng total RNA per sample. Single indexed QuantSeq libraries were QC checked on a Bioanalyzer 2100 Agilent using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay Invitrogen. Pooled libraries were sequenced on a NextSeq500 instrument Illumina in 1x75bp single end sequencing mode | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV09003.R1.fastq.gz | fastq | 438955973.0 | 5837128.0 | EV09003.R1.fastq.gz | 0:75.20 | A:134628611;C:87460856;G:98199538;T:118638244;N:28724 | 75 | 134628611 | 87460856 | 98199538 | 118638244 | 28724 | SRX23148651 | SRS20099370 | SRA1782413 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 0.89029 | 0.11994 | 0.80833 | 0.72581 | 76 | B | usable mapping rate | illumina | nextseq | 3prime | poly_a | lexogen | bulk | unknown | unknown | Austria | 2024-01-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||||||||
| 29743 | 29743 | SRR27467676 | SRX23139230 | SRS20090273 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | 4 cell DM R2 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: embryo 1 hpf DM rep2 | EV04004 | EV04004 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV04004.R1.fastq.gz | fastq | 895671560.0 | 6397654.0 | EV04004.R1.fastq.gz | 0:140 | A:206443066;C:147067097;G:365386937;T:176734600;N:39860 | 140 | 206443066 | 147067097 | 365386937 | 176734600 | 39860 | SRX23139230 | SRS20090273 | SRA1781872 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 0.0 | 0.0 | 1.0 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-09 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||||||
| 29744 | 29744 | SRR27467677 | SRX23139229 | SRS20090274 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | 4 cell mock R2 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: embryo 1 hpf mock rep2 | EV04003 | EV04003 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV04003.R1.fastq.gz | fastq | 664112120.0 | 4743658.0 | EV04003.R1.fastq.gz | 0:140 | A:163711695;C:142612940;G:211194350;T:146562626;N:30509 | 140 | 163711695 | 142612940 | 211194350 | 146562626 | 30509 | SRX23139229 | SRS20090274 | SRA1781872 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 2e-05 | 0.0 | 0.99997 | 1.0 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-09 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||||||||
| 29758 | 29758 | SRR27437478 | SRX23109819 | SRS20064573 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | 4 cell BS R3 | strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:BS|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: embryo 1 hpf BS rep3 | EV07006 | EV07006 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV07006.R1.fastq.gz | fastq | 2584527680.0 | 18460912.0 | EV07006.R1.fastq.gz | 0:140 | A:685107500;C:367766834;G:717359848;T:814224206;N:69292 | 140 | 685107500 | 367766834 | 717359848 | 814224206 | 69292 | SRX23109819 | SRS20064573 | SRA1780298 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 2e-05 | 1e-05 | 1.0 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-06 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||||||
| 29759 | 29759 | SRR27437479 | SRX23109818 | SRS20064571 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | 4 cell DM R3 | strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: embryo 1 hpf DM rep3 | EV07005 | EV07005 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV07005.R1.fastq.gz | fastq | 713829480.0 | 5098782.0 | EV07005.R1.fastq.gz | 0:140 | A:183575304;C:168886779;G:213156258;T:148191838;N:19301 | 140 | 183575304 | 168886779 | 213156258 | 148191838 | 19301 | SRX23109818 | SRS20064571 | SRA1780298 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 5e-05 | 0.0 | 0.99989 | 1.0 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-06 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||||||||
| 29760 | 29760 | SRR27437480 | SRX23109817 | SRS20064572 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | 4 cell mock R3 | strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: embryo 1 hpf mock rep3 | EV07004 | EV07004 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV07004.R1.fastq.gz | fastq | 517336680.0 | 3695262.0 | EV07004.R1.fastq.gz | 0:140 | A:136783049;C:131207858;G:139873280;T:109458276;N:14217 | 140 | 136783049 | 131207858 | 139873280 | 109458276 | 14217 | SRX23109817 | SRS20064572 | SRA1780298 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 7e-05 | 0.0 | 0.99981 | 0.7 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-06 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||||||||
| 29779 | 29779 | SRR27435864 | SRX23108232 | SRS20063068 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | 4 cell BS R4 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:BS|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: embryo 1 hpf BS rep4 | EV08009 | EV08009 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV08009.R1.fastq.gz | fastq | 756964460.0 | 5406889.0 | EV08009.R1.fastq.gz | 0:140 | A:191381054;C:111783194;G:185694475;T:268052883;N:52854 | 140 | 191381054 | 111783194 | 185694475 | 268052883 | 52854 | SRX23108232 | SRS20063068 | SRA1780265 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 1e-05 | 0.0 | 0.99997 | 1.0 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-05 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||||||||
| 29780 | 29780 | SRR27435865 | SRX23108231 | SRS20063069 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | 4 cell DM R4 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:DM|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: embryo 1 hpf DM rep4 | EV08008 | EV08008 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV08008.R1.fastq.gz | fastq | 751794680.0 | 5369962.0 | EV08008.R1.fastq.gz | 0:140 | A:194845808;C:197389162;G:194749636;T:164756481;N:53593 | 140 | 194845808 | 197389162 | 194749636 | 164756481 | 53593 | SRX23108231 | SRS20063069 | SRA1780265 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 0.00124 | 0.00029 | 0.99853 | 0.77083 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-05 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||||||||
| 29781 | 29781 | SRR27435866 | SRX23108230 | SRS20063066 | SRP482074 | PRJNA1061456 | tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development | PRJNA1061456 | Other | 4 cell mock R4 | strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:1 hpf|collection date:2022|geo loc name:Austria|sex:mixed|tissue:whole embryo|treatment:mock|BioSampleModel:Model organism or animal | tRAM seq of zebrafish: embryo 1 hpf mock rep4 | EV08007 | EV08007 | RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers. | OTHER | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | NextSeq 500 | SRP482074 | EV08007.R1.fastq.gz | fastq | 761961760.0 | 5442584.0 | EV08007.R1.fastq.gz | 0:140 | A:194053323;C:191169414;G:194452160;T:182234253;N:52610 | 140 | 194053323 | 191169414 | 194452160 | 182234253 | 52610 | SRX23108230 | SRS20063066 | SRA1780265 | Medical University of Vienna|Cell and Developmental Biology | Medical University of Vienna | 1 | 0.00242 | 0.00062 | 0.99803 | 0.81818 | 140 | T | under 1.2% mapping rate | illumina | nextseq | unknown | size_fractionation | nebnext | bulk | unknown | unknown | Austria | 2024-01-05 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||||||||
| 30769 | 30769 | SRR28348935 | SRX23954961 | SRS20755382 | SRP495323 | PRJNA1088158 | Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis. | GSE261646 | Transcriptome Analysis | The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and nee… | pubmed:39302832 | Zebrafish Embryo 2hpf rep3 | GSM8147858 | source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing | Zebrafish Embryo 2hpf rep3 | Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates | Whole embryo | Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files. | tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF | GSM8147858 | GSM8147858: Zebrafish Embryo 2hpf rep3; Danio rerio; RNA Seq | GSM8147858 r1 | GSM8147858 | 1 | Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP495323 | s_2hpf_3.fastq | fastq | 1748504032.0 | 23006632.0 | GSM8147858 r1 | 0:76 | A:420580006;C:434589498;G:408972977;T:484281127;N:80424 | 76 | 420580006 | 434589498 | 408972977 | 484281127 | 80424 | SRX23954961 | SRS20755382 | SRA1824599 | Computational Biology, Stowers Institute for Medical Research | Computational Biology, Stowers Institute for Medical Research | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | trueseq | bulk | bulk | bulk | United States | 2024-03-14 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||||
| 30770 | 30770 | SRR28348936 | SRX23954960 | SRS20755381 | SRP495323 | PRJNA1088158 | Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis. | GSE261646 | Transcriptome Analysis | The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and nee… | pubmed:39302832 | Zebrafish Embryo 2hpf rep2 | GSM8147857 | source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing | Zebrafish Embryo 2hpf rep2 | Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates | Whole embryo | Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files. | tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF | GSM8147857 | GSM8147857: Zebrafish Embryo 2hpf rep2; Danio rerio; RNA Seq | GSM8147857 r1 | GSM8147857 | 1 | Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP495323 | s_2hpf_2.fastq | fastq | 1578919456.0 | 20775256.0 | GSM8147857 r1 | 0:76 | A:380440230;C:393721925;G:368114931;T:436571104;N:71266 | 76 | 380440230 | 393721925 | 368114931 | 436571104 | 71266 | SRX23954960 | SRS20755381 | SRA1824599 | Computational Biology, Stowers Institute for Medical Research | Computational Biology, Stowers Institute for Medical Research | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | trueseq | bulk | bulk | bulk | United States | 2024-03-14 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||||
| 30771 | 30771 | SRR28348937 | SRX23954959 | SRS20755380 | SRP495323 | PRJNA1088158 | Protein profiling of zebrafish embryos unmasks regulatory layers during early embryogenesis. | GSE261646 | Transcriptome Analysis | The maternal to zygotic transition is crucial in embryonic development marked by the degradation of maternally provided mRNAs and initiation of zygotic gene expression. However the changes occurring at the protein level during this transition remain unclear. Here we conducted protein profiling throughout zebrafish embryogenesis using quantitative mass spectrometry integrating transcriptomics and translatomics datasets. Our data shows that unlike RNA changes protein changes are less dynamic. Further increases in protein levels correlate with mRNA translation whereas declines in protein levels do not suggesting active protein degradation processes. Interestingly proteins from pure zygotic genes are present at fertilization challenging existing mRNA based gene classifications. As a proof of concept we utilized CRISPR Cas13d to target znf281b mRNA a gene whose protein significantly accumulates within the first two hpf demonstrating its crucial role in development. Consequently our protein profiling coupled with CRISPR Cas13d offers a new approach to unravel maternal mRNAs function during embryonic development. Overall design: Two biological replicate samples containing 50 zebrafish oocytes per stage were collected by pairing females in natural matings to ''purge'' mature eggs and used to establish an oogenesis time line. Fish were euthanized and ovaries harvested within 1–11 days post purging dpp. Stage I and II oocytes were collected at 1–2 dpp stage III oocytes germinal vesicle in central position at 4–7 dpp and stage IV oocytes germinal vesicle asymmetrically located at 8–10 dpp. Oocyte isolations were based on73 and conducted in isolation medium Leibovitz L 15 Sigma Aldrich #L5520 plus Collagenase I and II depending on the stages as follows. Stages I and II were isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130 and 3 mg/mL Collagenase II Gibco 17101015. Stage III was isolated with 3 mg/mL Collagenase I Sigma Aldrich C0130. Stage IV was isolated by mechanical stripping with forceps and nee… | pubmed:39302832 | Zebrafish Embryo 2hpf rep1 | GSM8147856 | source name:Whole embryo|tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF|geo loc name:missing|collection date:missing | Zebrafish Embryo 2hpf rep1 | Raw reads from zebrafish oocytes stages I IV and embryos 0 2 4 and 6 hpf were demultiplexed into FASTQ format allowing up to one mismatch using Illumina bcl convert 3.10.5. Reads were aligned to UCSC genome danRer11 with STAR aligner version 2.7.3a using Ensembl 106 gene models. Counts were converted to TPM values using RSEM version v1.3.0 and all subsequent analysis was done using TPM. Assembly: danRer11 Ensembl 106 gene models Supplementary files format and content: comma separated files with TPMs from all replicates | Whole embryo | Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer’s protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer’s protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer’s directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files. | tissue:Whole embryo|developmental stage:2hpf|genotype:AB TF and TLF | GSM8147856 | GSM8147856: Zebrafish Embryo 2hpf rep1; Danio rerio; RNA Seq | GSM8147856 r1 | GSM8147856 | 1 | Isolated oocytes were snap frozen and RNA was extracted with TRIzol Invitrogen #15596026 following manufacturer's protocols. 0 2 4 and 6 hpf zebrafish embryo RNA was extracted with Direct zol RNA MicroPrep kit Zymo Research #R2062 following manufacturer's protocols. Ribo dep Stranded RNA Seq Zebrafish embryos 0 2 4 and 6 hpf total RNA sequencing libraries were generated from 500ng of high quality total RNA as assessed using Bioanalyzer Agilent. Libraries were made according to the manufacturer's directions for the TruSeq Stranded Total RNA Library Prep Gold Illumina #20020598 and TruSeq RNA Single Indexes Sets A and B Illumina #20020492 and #20020493. Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer Agilent Technologies and Qubit Fluorometer Life Technologies. Libraries were pooled quantified and sequenced as 75bp single reads on a high output flow cell using the Illumina NextSeq500 instrument. Following sequencing Illumina Primary Analysis version RTA 2.11.3.0 and bcl convert 3.10.5 were run to demultiplex reads for all libraries and generate FASTQ files. Zebrafish oocytes stages I IV total RNA Seq libraries were generated from 100 ng of high quality total RNA as assessed by a Bioanalyzer Agilent Technologies. Libraries were prepared according to manufacturer's instructions using the TruSeq Stranded Total RNA Library Prep Gold Illumina Cat. No. 20020598 and TruSeq RNA Single Indexes; Sets A and B Illumina Cat. No. 20020492 and 20020493. Resulting short fragment libraries were checked for quality and quantity using a Bioanalyzer and a Qubit Fluorometer Life Technologies. Libraries were normalized pooled and sequenced on a NextSeq 500 instrument Illumina as 75 bp single end reads on a high output flowcell using NextSeq Control Software 2.2.0.4. Following sequencing Illumina Primary Analysis version NextSeq RTA 2.4.11 and Secondary Analysis version bcl2fastq2 v2.20 were run to demultiplex reads for all libraries and generate FASTQ files. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP495323 | s_2hpf_1.fastq | fastq | 1730435412.0 | 22768887.0 | GSM8147856 r1 | 0:76 | A:420026952;C:428388301;G:403718608;T:478219805;N:81746 | 76 | 420026952 | 428388301 | 403718608 | 478219805 | 81746 | SRX23954959 | SRS20755380 | SRA1824599 | Computational Biology, Stowers Institute for Medical Research | Computational Biology, Stowers Institute for Medical Research | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | trueseq | bulk | bulk | bulk | United States | 2024-03-14 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||||
| 36258 | 36258 | SRR062659 | SRX025027 | SRS085806 | SRP003165 | PRJNA127881 | High throughput sequencing of mRNA from oocyte 1 cell 16/32 cells 128/256 cells 3.5hpf and 5.3hpf zebrafish embryos Wild type; AB line | GSE22830 | Transcriptome Analysis | mRNA seq based approach to determine the transcriptome dynamics during early development To study the mechanisms regulating this developmental event in zebrafish we applied RNA deep sequencing technology and generated comprehensive transcriptome profiles of 6 developmental stages from oocyte to early gastrulation. We determined the expression levels of maternal and zygotic transcripts and clustered them based on expression pattern. We identified a large number of novel transcribed regions in un annotated regions of the genome as well as splice variants with an estimated frequency of 40 75% during early zebrafish embryogenesis. Our data constitute a useful resource for developmental studies gene discovery and genome annotation. Overall design: RNA was extracted from pooled embryos of desired stages and one RNA seq library was generated for each sample. Totally 6 stages were selected: Maternal 1cell 16/32 cells 128/256 cells 3.5hpf and 5.3hpf | pubmed:21555364;pubmed:24586560;pubmed:23676078 | 16/32 cells | GSM564429 | tissue:developing embryos|background:AB; wild type|developmental stage:mixure of 16/32 cell embryos | 16/32 cells | ABI pipeline BioScope v1.0.1 Data analysis: The SOLiD generated RNA Seq reads was in 50bp length and an initial filtering process was taken to remove any non desirable contamination sequences such as rRNA tRNA and repeats etc. A seed and extension mapping approach was developed to map the 50bp reads into reference genome zv7 and also into the respective zv7 refGene annotation separately. During mapping of the reads to the refGene annotation a splice junction database fasta file is generated to which the reads are mapped to. This database contains known and putative junction sequences created by taking 46bp from the joining ends of adjacent and non adjacent exons for each gene and putting them together simulating the genomic sequences of known and putative junctions respectively. The first 25bp of the 50bp read was used as the seed for alignment for each read. When an alignment cannot be found using these 25bp seed the seed window is shifted and the next 25bp seed is taken from the 21st to the 45th base of the read. An extension step follows when the seed is able to map and a score generated for each extended base to determine best alignment. A merging step is performed on the genome mapping and splice junction mapping to determine a set of alignments for each read from which a unique alignment is found based on the score generated for these alignments. Mapping parameters: Mapping was done using Applied Biosystems’ SOLiD BioScope alignment for whole transcriptome analysis pipeline. Two mismatches were allowed in the 25bp color space seed sequence with extension alignment performed to find the full mapping location. A score is computed for each mapping location and any location that scored <22 were filtered. Generation of gff and bedgraph files: GFF files were produced by parsing the output BAM format and extracted for unique alignments with score >22. The bedgraph files are then produced with the resulting gff file. | developing embryos | Embryos were frozen at the desired developmental stages and RNAs was extracted for sequencing. | mRNA seq was performed by Mission Biotech Taiwan. SOLiD sequencing libraries were prepared using the Whole Transcriptome Library Preparation for SOLiD™ Sequencing kit ABI according to manufacturer’s instructions. About 200 280 µg of total RNAs were used as starting materials which were subjected to polyA selection using Applied Biosystems PolyA Purist Kit AM1916 fragmentation and library construction using distinct adapters for each library SOLiD Barcoding. From each library equal volumes were pooled together and sequenced in SOLiD3 ABI platform generating 50bp tags. | Zebrafish embryos AB background collected just post fertilization were reared and harvested at desired time points. Unfertilized oocytes were collected by squeezing the abdomen of spawning females. Harvested embryos were snap frozen in liquid nitrogen and stored in −80°C. Total RNA was extracted from whole embryos using Trizol Invitrogen according to manufacturer’s instructions. RNA concentrations were determined using NanoDrop 2000 Thermo Scientific. Integrity of RNA samples were determined using Agilent RNA 6000 Nano chip and size separated using Agilent 2100 Bioanalyzer. Total RNA obtained per 100 embryos at each developmental stage was calculated for data normalization purposes. | background:AB; wild type|developmental stage:mixure of 16/32 cell embryos | GSM564429 | GSM564429: 16/32 cells | GSM564429: 16/32 cells | GSM564429: 16/32 cells | 1 | GEO Accession:GSM564429 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD System 3.0 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP003165 | 1792238300.0 | 35844766.0 | GSM564429 1 | 0:50 | 50 | SRX025027 | SRS085806 | SRA022850 | GEO | Computational and Systems Biology, Genome Institute of Singapore | 1 | 0.6993 | 0.04019 | 0.83763 | 0.50284 | 50 | B | usable mapping rate | legacy | early | full_length | poly_a | unknown | bulk | unknown | unknown | Singapore | 2010-07-08 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||||
| 36297 | 36297 | SRR393000 | SRX113357 | SRS284301 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Ribosome protected fragments Wild type 2hpf 2 | GSM854439 | source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf | Ribosome protected fragments Wild type 2hpf 2 | Ribo Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo wild type | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf | GSM854439 | GSM854439: Ribosome protected fragments Wild type 2hpf 2; Danio rerio; RNA Seq | GSM854439 1 | GSM854439: Ribosome protected fragments Wild type 2hpf 2 | 1 | GEO Accession:GSM854439 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | Ribo_Wt_2_B1.fq | fastq | 217015848.0 | 3014109.0 | GSM854439 r1 | 0:72 | A:73500339;C:46583724;G:47804114;T:49117423;N:10248 | 72 | 73500339 | 46583724 | 47804114 | 49117423 | 10248 | SRX113357 | SRS284301 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 2e-05 | 0.0 | 0.99997 | 1.0 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36298 | 36298 | SRR393001 | SRX113357 | SRS284301 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Ribosome protected fragments Wild type 2hpf 2 | GSM854439 | source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf | Ribosome protected fragments Wild type 2hpf 2 | Ribo Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo wild type | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf | GSM854439 | GSM854439: Ribosome protected fragments Wild type 2hpf 2; Danio rerio; RNA Seq | GSM854439 1 | GSM854439: Ribosome protected fragments Wild type 2hpf 2 | 1 | GEO Accession:GSM854439 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | instrument model:Illumina HiSeq 2000 | Ribo_Wt_2_B2.fq | fastq | 976804848.0 | 13566734.0 | GSM854439 r2 | 0:72 | A:312362919;C:205660950;G:237663406;T:221097191;N:20382 | 72 | 312362919 | 205660950 | 237663406 | 221097191 | 20382 | SRX113357 | SRS284301 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.0 | 0.0 | 1.0 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36299 | 36299 | SRR392998 | SRX113356 | SRS284300 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Ribosome protected fragments Wild type 2hpf | GSM854438 | source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf | Ribosome protected fragments Wild type 2hpf | Ribo Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo wild type | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf | GSM854438 | GSM854438: Ribosome protected fragments Wild type 2hpf; Danio rerio; RNA Seq | GSM854438 1 | GSM854438: Ribosome protected fragments Wild type 2hpf | 1 | GEO Accession:GSM854438 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | Ribo_Wt_2_A1.fq | fastq | 284876712.0 | 3956621.0 | GSM854438 r1 | 0:72 | A:88022040;C:68867093;G:63794882;T:64180749;N:11948 | 72 | 88022040 | 68867093 | 63794882 | 64180749 | 11948 | SRX113356 | SRS284300 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.00011 | 7e-05 | 0.99995 | 0.0 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36300 | 36300 | SRR392999 | SRX113356 | SRS284300 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Ribosome protected fragments Wild type 2hpf | GSM854438 | source name:Whole embryo wild type|sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|development stage:2hpf | Ribosome protected fragments Wild type 2hpf | Ribo Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo wild type | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:ribosome protected fragments|tissue:whole embryo|genotype:wild type|developmental stage:2hpf | GSM854438 | GSM854438: Ribosome protected fragments Wild type 2hpf; Danio rerio; RNA Seq | GSM854438 1 | GSM854438: Ribosome protected fragments Wild type 2hpf | 1 | GEO Accession:GSM854438 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | instrument model:Illumina HiSeq 2000 | Ribo_Wt_2_A2.fq | fastq | 1197987552.0 | 16638716.0 | GSM854438 r2 | 0:72 | A:346631182;C:288138913;G:296030268;T:267150788;N:36401 | 72 | 346631182 | 288138913 | 296030268 | 267150788 | 36401 | SRX113356 | SRS284300 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 3e-05 | 0.0 | 0.99997 | 0.0 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 36309 | 36309 | SRR392988 | SRX113351 | SRS284295 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Ribosome protected fragments MZdicer 2hpf 2 | GSM854433 | source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf | Ribosome protected fragments MZdicer 2hpf 2 | Ribo Dicer 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo MZdicer | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf | GSM854433 | GSM854433: Ribosome protected fragments MZdicer 2hpf 2; Danio rerio; RNA Seq | GSM854433 1 | GSM854433: Ribosome protected fragments MZdicer 2hpf 2 | 1 | GEO Accession:GSM854433 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | Ribo_Dicer_2_B1.fq | fastq | 72956952.0 | 1013291.0 | GSM854433 r1 | 0:72 | A:22006501;C:17986138;G:16833834;T:16127785;N:2694 | 72 | 22006501 | 17986138 | 16833834 | 16127785 | 2694 | SRX113351 | SRS284295 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.00131 | 0.00114 | 0.99991 | 0.88888 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36310 | 36310 | SRR392989 | SRX113351 | SRS284295 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Ribosome protected fragments MZdicer 2hpf 2 | GSM854433 | source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf | Ribosome protected fragments MZdicer 2hpf 2 | Ribo Dicer 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo MZdicer | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf | GSM854433 | GSM854433: Ribosome protected fragments MZdicer 2hpf 2; Danio rerio; RNA Seq | GSM854433 1 | GSM854433: Ribosome protected fragments MZdicer 2hpf 2 | 1 | GEO Accession:GSM854433 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | instrument model:Illumina HiSeq 2000 | Ribo_Dicer_2_B2.fq | fastq | 454127328.0 | 6307324.0 | GSM854433 r2 | 0:72 | A:124676855;C:112665084;G:119208313;T:97572172;N:4904 | 72 | 124676855 | 112665084 | 119208313 | 97572172 | 4904 | SRX113351 | SRS284295 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.0 | 0.0 | 1.0 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36311 | 36311 | SRR392986 | SRX113350 | SRS284294 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Ribosome protected fragments MZdicer 2hpf | GSM854432 | source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf | Ribosome protected fragments MZdicer 2hpf | Ribo Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo MZdicer | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf | GSM854432 | GSM854432: Ribosome protected fragments MZdicer 2hpf; Danio rerio; RNA Seq | GSM854432 1 | GSM854432: Ribosome protected fragments MZdicer 2hpf | 1 | GEO Accession:GSM854432 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | Ribo_Dicer_2_A1.fq | fastq | 216257400.0 | 3003575.0 | GSM854432 r1 | 0:72 | A:66784432;C:51526758;G:47615177;T:50321714;N:9319 | 72 | 66784432 | 51526758 | 47615177 | 50321714 | 9319 | SRX113350 | SRS284294 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 6e-05 | 1e-05 | 0.99995 | 1.0 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36312 | 36312 | SRR392987 | SRX113350 | SRS284294 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Ribosome protected fragments MZdicer 2hpf | GSM854432 | source name:Whole embryo MZdicer|sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf | Ribosome protected fragments MZdicer 2hpf | Ribo Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo MZdicer | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:ribosome protected fragments|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf | GSM854432 | GSM854432: Ribosome protected fragments MZdicer 2hpf; Danio rerio; RNA Seq | GSM854432 1 | GSM854432: Ribosome protected fragments MZdicer 2hpf | 1 | GEO Accession:GSM854432 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | instrument model:Illumina HiSeq 2000 | Ribo_Dicer_2_A2.fq | fastq | 953861544.0 | 13248077.0 | GSM854432 r2 | 0:72 | A:256595558;C:242054835;G:238026249;T:217176275;N:8627 | 72 | 256595558 | 242054835 | 238026249 | 217176275 | 8627 | SRX113350 | SRS284294 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 9e-05 | 3e-05 | 0.99993 | 1.0 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 36321 | 36321 | SRR392976 | SRX113345 | SRS284289 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Input mRNA Seq Wild type 2hpf 2 | GSM854427 | source name:Whole embryo wild type|sample type:input mRNA|tissue:whole embryo|genotype:wild type|development stage:2hpf|genetic background:TUAB | Input mRNA Seq Wild type 2hpf 2 | Input Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo wild type | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:input mRNA|tissue:whole embryo|genotype:wild type|developmental stage:2hpf|genetic background:TUAB | GSM854427 | GSM854427: Input mRNA Seq Wild type 2hpf 2; Danio rerio; RNA Seq | GSM854427 1 | GSM854427: Input mRNA Seq Wild type 2hpf 2 | 1 | GEO Accession:GSM854427 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | Input_Wt_2_B1.fq | fastq | 395024832.0 | 5486456.0 | GSM854427 r1 | 0:72 | A:142810926;C:92574191;G:71835480;T:87787309;N:16926 | 72 | 142810926 | 92574191 | 71835480 | 87787309 | 16926 | SRX113345 | SRS284289 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.0 | 0.0 | 1.0 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 36322 | 36322 | SRR392977 | SRX113345 | SRS284289 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Input mRNA Seq Wild type 2hpf 2 | GSM854427 | source name:Whole embryo wild type|sample type:input mRNA|tissue:whole embryo|genotype:wild type|development stage:2hpf|genetic background:TUAB | Input mRNA Seq Wild type 2hpf 2 | Input Wt 2 B.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo wild type | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:input mRNA|tissue:whole embryo|genotype:wild type|developmental stage:2hpf|genetic background:TUAB | GSM854427 | GSM854427: Input mRNA Seq Wild type 2hpf 2; Danio rerio; RNA Seq | GSM854427 1 | GSM854427: Input mRNA Seq Wild type 2hpf 2 | 1 | GEO Accession:GSM854427 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | instrument model:Illumina HiSeq 2000 | Input_Wt_2_B2.fq | fastq | 1778028768.0 | 24694844.0 | GSM854427 r2 | 0:72 | A:599303071;C:388710416;G:399829888;T:390165838;N:19555 | 72 | 599303071 | 388710416 | 399829888 | 390165838 | 19555 | SRX113345 | SRS284289 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.0 | 0.0 | 1.0 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36323 | 36323 | SRR392974 | SRX113344 | SRS284288 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Input mRNA Seq Wild type 2hpf | GSM854426 | source name:Whole embryo wild type|sample type:input mRNA|tissue:whole embryo|genotype:wild type|development stage:2hpf|genetic background:TUAB | Input mRNA Seq Wild type 2hpf | Input Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo wild type | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:input mRNA|tissue:whole embryo|genotype:wild type|developmental stage:2hpf|genetic background:TUAB | GSM854426 | GSM854426: Input mRNA Seq Wild type 2hpf; Danio rerio; RNA Seq | GSM854426 1 | GSM854426: Input mRNA Seq Wild type 2hpf | 1 | GEO Accession:GSM854426 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | Input_Wt_2_A1.fq | fastq | 315124632.0 | 4376731.0 | GSM854426 r1 | 0:72 | A:116463238;C:74027349;G:54200798;T:70419115;N:14132 | 72 | 116463238 | 74027349 | 54200798 | 70419115 | 14132 | SRX113344 | SRS284288 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.0 | 0.0 | 1.0 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 36324 | 36324 | SRR392975 | SRX113344 | SRS284288 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Input mRNA Seq Wild type 2hpf | GSM854426 | source name:Whole embryo wild type|sample type:input mRNA|tissue:whole embryo|genotype:wild type|development stage:2hpf|genetic background:TUAB | Input mRNA Seq Wild type 2hpf | Input Wt 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo wild type | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:input mRNA|tissue:whole embryo|genotype:wild type|developmental stage:2hpf|genetic background:TUAB | GSM854426 | GSM854426: Input mRNA Seq Wild type 2hpf; Danio rerio; RNA Seq | GSM854426 1 | GSM854426: Input mRNA Seq Wild type 2hpf | 1 | GEO Accession:GSM854426 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | instrument model:Illumina HiSeq 2000 | Input_Wt_2_A2.fq | fastq | 1366683048.0 | 18981709.0 | GSM854426 r2 | 0:72 | A:475749702;C:303155361;G:282027500;T:305707196;N:43289 | 72 | 475749702 | 303155361 | 282027500 | 305707196 | 43289 | SRX113344 | SRS284288 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.0 | 0.0 | 1.0 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36331 | 36331 | SRR392966 | SRX113340 | SRS284284 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Input mRNA Seq MZdicer 2hpf | GSM854422 | source name:Whole embryo MZdicer|sample type:input mRNA|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf|genetic background:TUAB | Input mRNA Seq MZdicer 2hpf | Input Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo MZdicer | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:input mRNA|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf|genetic background:TUAB | GSM854422 | GSM854422: Input mRNA Seq MZdicer 2hpf; Danio rerio; RNA Seq | GSM854422 1 | GSM854422: Input mRNA Seq MZdicer 2hpf | 1 | GEO Accession:GSM854422 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | Input_Dicer_2_A1.fq | fastq | 197997408.0 | 2749964.0 | GSM854422 r1 | 0:72 | A:73258529;C:47205089;G:34750581;T:42774230;N:8979 | 72 | 73258529 | 47205089 | 34750581 | 42774230 | 8979 | SRX113340 | SRS284284 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.0 | 0.0 | 1.0 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 36332 | 36332 | SRR392967 | SRX113340 | SRS284284 | SRP010040 | PRJNA150397 | Ribosome profiling of early zebrafish embryos miRNA mediated regulation during embryogenesis causes translational repression before mRNA decay | GSE34743 | Transcriptome Analysis | MicroRNAs regulate gene expression through deadenylation repression and mRNA decay. However the contribution of each mechanism in non steady state situations remains unclear. We monitored the impact of miR 430 on ribosome occupancy of endogenous mRNAs in wild type and dicer mutants lacking mature miR 430. Our results indicate that miR 430 reduces the number of ribosomes on target mRNAs before causing mRNA decay. Translational repression occurs before complete deadenylation and disrupting deadenylation using an internal polyA tail did not block target repression. Finally we observe that ribosome density along the length of the target mRNA remains constant suggesting that translational repression occurs by reducing the initiation rate rather than reducing elongation or causing ribosomal drop off. In summary our results show that miR 430 regulates translation initiation before inducing mRNA decay. Overall design: Time course parallel ribosome profiling and input mRNA quantification in wildtype and MZdicer mutant embryos | pubmed:22422859 | Input mRNA Seq MZdicer 2hpf | GSM854422 | source name:Whole embryo MZdicer|sample type:input mRNA|tissue:whole embryo|genotype:MZdicer mutant|development stage:2hpf|genetic background:TUAB | Input mRNA Seq MZdicer 2hpf | Input Dicer 2 A.bed; genome build: danRer7 Tophat v1.2.0 alignment to UCSC danRer7 Zv9 genome sequence guided by Ensembl r63 gene models; default settings limited to reads mapping 5 or fewer times. Reads were trimmed of three prime adapter sequence | Whole embryo MZdicer | Ribosome protected fragments were obtained from 80 embryos per sample according to an adapted protocol from Ignolia et al 2009. Embryos were incubated with 0.1 ug/ml cycloheximide in Methylene blue water for 5 min then snap frozen in 25ul Lysis buffer and clarified for 10 min at 10g 4degC. Supernatant was incubated with RNaseI and DNase at room temperature for 45 minutes with gentle mixing then digested extracts 50ul were overlain in a 100ul cushion of 1.8M sucrose in 20mM total Tris HCL ph8.0; 140mM KCl; 5 mM MgCl2; 100 ug/ml Cycloheximide; 0.5 mM DTT; 40U/ml SUPERas In Ambion #AM2694 for 14 h at 55.000 rpm in a TLS55 rotor in a Beckman TL100 ultracentrifuge. The bottom 30 ul was mixed with 4ul of PNK buffer and 4 ul of Proteinase K and incubated at 37degC for 30 minutes. RNA was extracted using Trizol then run on a 15% Urea gel to excise the 28 38 nt region. To construct barcoded Illumina small RNA libraries samples were eluted overnight in 300 mM NaOAc pH 5.5; 1 mM EDTA; 0.1U/ul SUPERas In Ambion #AM2694 followed by Ethanol precipitation. RFP and RNA input fragments were 3? dephosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer without xxx for 1 h at 37degC followed by 10 min incubation at 75degC and ethanol precipitation. Samples were resuspended and ligated to Illumina v1.5 three prime adapter using T4 RNA Ligase 2 truncated K227Q and RNAseOUT Recombinant Ribonuclease Inhibitor for 6h at 20degC then separated on a 10% Urea gel to extract the three prime ligation products. These were five prime phosphorylated with polynucleotide kinase in T4 polynucleotide kinase buffer with 1mM ATP for 30 min at 37degC and precipitated in ethanol. five prime ligation was performed using T4 RNA Ligase 1 for 6 hrs at 20degC with individual 100uM barcoded five prime adapters then separated on a 10% Urea gel. Gel purified samples were reverse transcribed using SuperScript II Reverse Transcriptase according to the Invitrogen protocol then amplified using Phusion High Fidelity DNA Polymerase. PC… | sample type:input mRNA|tissue:whole embryo|genotype:MZdicer mutant|developmental stage:2hpf|genetic background:TUAB | GSM854422 | GSM854422: Input mRNA Seq MZdicer 2hpf; Danio rerio; RNA Seq | GSM854422 1 | GSM854422: Input mRNA Seq MZdicer 2hpf | 1 | GEO Accession:GSM854422 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>72</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP010040 | instrument model:Illumina HiSeq 2000 | Input_Dicer_2_A2.fq | fastq | 821282832.0 | 11406706.0 | GSM854422 r2 | 0:72 | A:289320106;C:176199303;G:179059045;T:176687758;N:16620 | 72 | 289320106 | 176199303 | 179059045 | 176687758 | 16620 | SRX113340 | SRS284284 | SRA048903 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.0 | 0.0 | 1.0 | 72 | T | under 1.2% mapping rate | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2011-12-27 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36365 | 36365 | SRR489484 | SRX143561 | SRS310282 | SRP012376 | PRJNA160143 | Extensive alternative polyadenylation during zebrafish development | GSE37453 | Transcriptome Analysis | The post transcriptional fate of messenger RNAs mRNAs is largely dictated by their three prime' untranslated regions three prime'UTRs which are defined by cleavage and polyadenylation CPA of pre mRNAs. We used polyA position profiling by sequencing 3P Seq to map polyA sites at eight developmental stages and tissues in the zebrafish. Analysis of over 60 million 3P Seq reads substantially increased and improved existing three prime'UTR annotations resulting in confidently identified three prime'UTRs for more than 78.79% of the annotated protein coding genes in zebrafish. Most zebrafish genes undergo alternative CPA with more than a thousand genes using different dominant three prime'UTRs at different stages. three prime'UTRs tend to be shortest in the ovaries and longest in the brain. Isoforms with some of the shortest three prime'UTRs are highly expressed in the ovary yet absent in the maternally contributed RNAs of the embryo perhaps because their three prime'UTRs are too short to accommodate a uridine rich motif required for stability of the maternal mRNA. At two hpf thousands of unique polyA sites appear at locations lacking a typical polyadenylation signal which suggests a wave of widespread cytoplasmic polyadenylation of mRNA degradation intermediates. Our insights into the identities formation and evolution of zebrafish three prime'UTRs provide a resource for studying gene regulation during vertebrate development. Overall design: 3P Seq was used to map the three prime' ends of protein coding genes in the zebrafish genome | pubmed:22722342 | 3P Seq PreMZT 3 | GSM919967 | source name:whole embryo at 1.5 hpf 2 hpf type|tissue:whole embryo|development stage:1.5 hpf 2 hpf | 3P Seq PreMZT 3 | For 3P Seq: Reads were reverse complemented and aligned to the D. rerio genome Zv9/danRer7 using Bowtie. Reads that aligned to up to four genomic locus and had one or more mismatches at their three prime end within a terminal adenylate run were carried forward as 3P tags. Reads mapping to the same locus with the same number of terminal adenylates were consolidated in the processed data file. The BED file is as in Jan et al. GSE24924 For 3P PE Seq: In each read pair read #1 captured the three prime end of the polyA tail in the antisense orientation and read #2 captured a portion of the three prime region of the transcript and occasionally the beginning of the polyA tail in the sense orientation. Read #2 began with an adapter of 26 bases. Reads with more than 10 mismatches to the adapter were discarded and the first 26 bases were removed before further processing. A read pair was considered informative only if read #1 began with Ts and read #2 contained 2–39 terminal As. post leading Ts and terminal As were removed from reads #1 and #2 respectively they were mapped to the genome using Bowtie allowing for up to two mismatches and requiring a unique mapping position in the zebrafish genome. The length of the tail encoded in read #2 was defined as the maximum number of trailing As allowing for up to one mismatch. Only cases in which this number was larger than the number of As encoded in the genome at the predicted cleavage position by at least 2 bases were carried forward. Cleavage and polyadenylation position was defined as the last non A base in read #2. The length of the polyA tail at that position was estimated using the corresponding read #1 and defined as the maximal i for which >90% of the bases in the first i bases of read #1 were Ts. This criterion was used to allow for some sequencing errors expected when sequencing long homopolymers. Genome build: danRer7 Supplementary files format and content: The .bed files contain the positions where 3P Seq reads were mapped and the name of each track is the … | whole embryo at 1.5 hpf 2 hpf | Anesthetized decorioneted embryos were washed three times in PBS 137 mM NaCl 2.7 mM KCl 1.5 mM KH2PO4 8 mM Na2HP04 pH 7.4 and suspended in PBS containing 1% freshly added formaldehyde. Embryos were transferred to a dounce homogenizer dounced several times and incubated at room temperature for 15 min. Formaldehyde was quenched by adding 1/20 volume 2.5 M glycine. Cells were pelleted at 400 x g for 5 min. The supernatant was removed and pellets were rinsed twice with PBS flash frozen in liquid nitrogen and stored at 80C. | 3P Seq; see http://web.wi.mit.edu/bartel/pub/protocols.html | Zebrafish embryos or adults grown under standard condition | genotype/variation:wild type|tissue:whole embryo|developmental stage:1.5 hpf 2 hpf | GSM919967 | GSM919967: 3P Seq PreMZT 3; Danio rerio; RNA Seq | GSM919967 1 | GSM919967: 3P Seq PreMZT 3 | 1 | GEO Accession:GSM919967 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>40</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP012376 | 3P_Seq_PreMZT_3.fastq | fastq | 2568831200.0 | 64220780.0 | GSM919967 r1 | 0:40 | A:928593325;C:457629269;G:462667409;T:719889166;N:52031 | 40 | 928593325 | 457629269 | 462667409 | 719889166 | 52031 | SRX143561 | SRS310282 | SRA051955 | GEO | Whitehead Institute for Biomedical Research | 1 | 0.71138 | 0.10487 | 0.79904 | 0.51337 | 40 | B | usable mapping rate | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2012-04-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||
| 36366 | 36366 | SRR489483 | SRX143560 | SRS310281 | SRP012376 | PRJNA160143 | Extensive alternative polyadenylation during zebrafish development | GSE37453 | Transcriptome Analysis | The post transcriptional fate of messenger RNAs mRNAs is largely dictated by their three prime' untranslated regions three prime'UTRs which are defined by cleavage and polyadenylation CPA of pre mRNAs. We used polyA position profiling by sequencing 3P Seq to map polyA sites at eight developmental stages and tissues in the zebrafish. Analysis of over 60 million 3P Seq reads substantially increased and improved existing three prime'UTR annotations resulting in confidently identified three prime'UTRs for more than 78.79% of the annotated protein coding genes in zebrafish. Most zebrafish genes undergo alternative CPA with more than a thousand genes using different dominant three prime'UTRs at different stages. three prime'UTRs tend to be shortest in the ovaries and longest in the brain. Isoforms with some of the shortest three prime'UTRs are highly expressed in the ovary yet absent in the maternally contributed RNAs of the embryo perhaps because their three prime'UTRs are too short to accommodate a uridine rich motif required for stability of the maternal mRNA. At two hpf thousands of unique polyA sites appear at locations lacking a typical polyadenylation signal which suggests a wave of widespread cytoplasmic polyadenylation of mRNA degradation intermediates. Our insights into the identities formation and evolution of zebrafish three prime'UTRs provide a resource for studying gene regulation during vertebrate development. Overall design: 3P Seq was used to map the three prime' ends of protein coding genes in the zebrafish genome | pubmed:22722342 | 3P Seq PreMZT 2 | GSM919966 | source name:whole embryo at 1.5 hpf 2 hpf type|tissue:whole embryo|development stage:1.5 hpf 2 hpf | 3P Seq PreMZT 2 | For 3P Seq: Reads were reverse complemented and aligned to the D. rerio genome Zv9/danRer7 using Bowtie. Reads that aligned to up to four genomic locus and had one or more mismatches at their three prime end within a terminal adenylate run were carried forward as 3P tags. Reads mapping to the same locus with the same number of terminal adenylates were consolidated in the processed data file. The BED file is as in Jan et al. GSE24924 For 3P PE Seq: In each read pair read #1 captured the three prime end of the polyA tail in the antisense orientation and read #2 captured a portion of the three prime region of the transcript and occasionally the beginning of the polyA tail in the sense orientation. Read #2 began with an adapter of 26 bases. Reads with more than 10 mismatches to the adapter were discarded and the first 26 bases were removed before further processing. A read pair was considered informative only if read #1 began with Ts and read #2 contained 2–39 terminal As. post leading Ts and terminal As were removed from reads #1 and #2 respectively they were mapped to the genome using Bowtie allowing for up to two mismatches and requiring a unique mapping position in the zebrafish genome. The length of the tail encoded in read #2 was defined as the maximum number of trailing As allowing for up to one mismatch. Only cases in which this number was larger than the number of As encoded in the genome at the predicted cleavage position by at least 2 bases were carried forward. Cleavage and polyadenylation position was defined as the last non A base in read #2. The length of the polyA tail at that position was estimated using the corresponding read #1 and defined as the maximal i for which >90% of the bases in the first i bases of read #1 were Ts. This criterion was used to allow for some sequencing errors expected when sequencing long homopolymers. Genome build: danRer7 Supplementary files format and content: The .bed files contain the positions where 3P Seq reads were mapped and the name of each track is the … | whole embryo at 1.5 hpf 2 hpf | Anesthetized decorioneted embryos were washed three times in PBS 137 mM NaCl 2.7 mM KCl 1.5 mM KH2PO4 8 mM Na2HP04 pH 7.4 and suspended in PBS containing 1% freshly added formaldehyde. Embryos were transferred to a dounce homogenizer dounced several times and incubated at room temperature for 15 min. Formaldehyde was quenched by adding 1/20 volume 2.5 M glycine. Cells were pelleted at 400 x g for 5 min. The supernatant was removed and pellets were rinsed twice with PBS flash frozen in liquid nitrogen and stored at 80C. | 3P Seq; see http://web.wi.mit.edu/bartel/pub/protocols.html | Zebrafish embryos or adults grown under standard condition | genotype/variation:wild type|tissue:whole embryo|developmental stage:1.5 hpf 2 hpf | GSM919966 | GSM919966: 3P Seq PreMZT 2; Danio rerio; RNA Seq | GSM919966 1 | GSM919966: 3P Seq PreMZT 2 | 1 | GEO Accession:GSM919966 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP012376 | 3P_Seq_PreMZT_2.fastq | fastq | 706103748.0 | 19613993.0 | GSM919966 r1 | 0:36 | A:259247584;C:125282714;G:127103688;T:194451978;N:17784 | 36 | 259247584 | 125282714 | 127103688 | 194451978 | 17784 | SRX143560 | SRS310281 | SRA051955 | GEO | Whitehead Institute for Biomedical Research | 1 | 0.54759 | 0.0884 | 0.81371 | 0.51819 | 36 | B | usable mapping rate | illumina | early_illumina | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2012-04-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||
| 36367 | 36367 | SRR489482 | SRX143559 | SRS310280 | SRP012376 | PRJNA160143 | Extensive alternative polyadenylation during zebrafish development | GSE37453 | Transcriptome Analysis | The post transcriptional fate of messenger RNAs mRNAs is largely dictated by their three prime' untranslated regions three prime'UTRs which are defined by cleavage and polyadenylation CPA of pre mRNAs. We used polyA position profiling by sequencing 3P Seq to map polyA sites at eight developmental stages and tissues in the zebrafish. Analysis of over 60 million 3P Seq reads substantially increased and improved existing three prime'UTR annotations resulting in confidently identified three prime'UTRs for more than 78.79% of the annotated protein coding genes in zebrafish. Most zebrafish genes undergo alternative CPA with more than a thousand genes using different dominant three prime'UTRs at different stages. three prime'UTRs tend to be shortest in the ovaries and longest in the brain. Isoforms with some of the shortest three prime'UTRs are highly expressed in the ovary yet absent in the maternally contributed RNAs of the embryo perhaps because their three prime'UTRs are too short to accommodate a uridine rich motif required for stability of the maternal mRNA. At two hpf thousands of unique polyA sites appear at locations lacking a typical polyadenylation signal which suggests a wave of widespread cytoplasmic polyadenylation of mRNA degradation intermediates. Our insights into the identities formation and evolution of zebrafish three prime'UTRs provide a resource for studying gene regulation during vertebrate development. Overall design: 3P Seq was used to map the three prime' ends of protein coding genes in the zebrafish genome | pubmed:22722342 | 3P Seq PreMZT | GSM919965 | source name:whole embryo at 1.5 hpf 2 hpf type|tissue:whole embryo|development stage:1.5 hpf 2 hpf | 3P Seq PreMZT | For 3P Seq: Reads were reverse complemented and aligned to the D. rerio genome Zv9/danRer7 using Bowtie. Reads that aligned to up to four genomic locus and had one or more mismatches at their three prime end within a terminal adenylate run were carried forward as 3P tags. Reads mapping to the same locus with the same number of terminal adenylates were consolidated in the processed data file. The BED file is as in Jan et al. GSE24924 For 3P PE Seq: In each read pair read #1 captured the three prime end of the polyA tail in the antisense orientation and read #2 captured a portion of the three prime region of the transcript and occasionally the beginning of the polyA tail in the sense orientation. Read #2 began with an adapter of 26 bases. Reads with more than 10 mismatches to the adapter were discarded and the first 26 bases were removed before further processing. A read pair was considered informative only if read #1 began with Ts and read #2 contained 2–39 terminal As. post leading Ts and terminal As were removed from reads #1 and #2 respectively they were mapped to the genome using Bowtie allowing for up to two mismatches and requiring a unique mapping position in the zebrafish genome. The length of the tail encoded in read #2 was defined as the maximum number of trailing As allowing for up to one mismatch. Only cases in which this number was larger than the number of As encoded in the genome at the predicted cleavage position by at least 2 bases were carried forward. Cleavage and polyadenylation position was defined as the last non A base in read #2. The length of the polyA tail at that position was estimated using the corresponding read #1 and defined as the maximal i for which >90% of the bases in the first i bases of read #1 were Ts. This criterion was used to allow for some sequencing errors expected when sequencing long homopolymers. Genome build: danRer7 Supplementary files format and content: The .bed files contain the positions where 3P Seq reads were mapped and the name of each track is the … | whole embryo at 1.5 hpf 2 hpf | Anesthetized decorioneted embryos were washed three times in PBS 137 mM NaCl 2.7 mM KCl 1.5 mM KH2PO4 8 mM Na2HP04 pH 7.4 and suspended in PBS containing 1% freshly added formaldehyde. Embryos were transferred to a dounce homogenizer dounced several times and incubated at room temperature for 15 min. Formaldehyde was quenched by adding 1/20 volume 2.5 M glycine. Cells were pelleted at 400 x g for 5 min. The supernatant was removed and pellets were rinsed twice with PBS flash frozen in liquid nitrogen and stored at 80C. | 3P Seq; see http://web.wi.mit.edu/bartel/pub/protocols.html | Zebrafish embryos or adults grown under standard condition | genotype/variation:wild type|tissue:whole embryo|developmental stage:1.5 hpf 2 hpf | GSM919965 | GSM919965: 3P Seq PreMZT; Danio rerio; RNA Seq | GSM919965 1 | GSM919965: 3P Seq PreMZT | 1 | GEO Accession:GSM919965 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>36</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP012376 | 3P_Seq_PreMZT.fastq | fastq | 612082764.0 | 17002299.0 | GSM919965 r1 | 0:36 | A:226644687;C:107265813;G:109073433;T:168922136;N:176695 | 36 | 226644687 | 107265813 | 109073433 | 168922136 | 176695 | SRX143559 | SRS310280 | SRA051955 | GEO | Whitehead Institute for Biomedical Research | 1 | 0.56415 | 0.09075 | 0.8114 | 0.50672 | 36 | B | usable mapping rate | illumina | early_illumina | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2012-04-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||
| 36422 | 36422 | SRR516548 | SRX156334 | SRS347202 | SRP013950 | PRJNA169500 | Danio rerio embryonic promoterome | PRJNA169500 | Transcriptome Analysis | Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development. | pubmed:24531765 | Zebrafish wild type AB strain embryo 64 cells stage | D. rerio 64 cells embryo | D. rerio 64 cells embryo | CAGE D. rerio 64 cells embryo | CAGE D. rerio 64 cells embryo | D. rerio 64 cells embryo | 1 | OTHER | TRANSCRIPTOMIC | CAGE | SINGLE | ILLUMINA | Illumina Genome Analyzer IIx | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>27</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP013950 | CAGE_64cells.fastq | fastq | 162784188.0 | 6029044.0 | CAGE D. rerio 64 cells embryo | 0:27 | A:41192860;C:36547869;G:46848833;T:38194626;N:0 | 27 | 41192860 | 36547869 | 46848833 | 38194626 | 0 | SRX156334 | SRS347202 | SRA055273 | University of Bergen | ZEPROME consortium | B | usable mapping rate | illumina | early_illumina | unknown | cage | unknown | bulk | unknown | unknown | Unknown | 2013-08-31 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||||||||
| 36694 | 36694 | SRR801679 | SRX258160 | SRS406291 | SRP020469 | PRJNA195909 | RNA sequencing project for zebrafish embryo and larva development | GSE45706 | Transcriptome Analysis | Zebrafish is an important model system for the study of vertebrate embryonic development and adaptive immunese response. recent yrs have seen great advancement in the understanding of the regulatory mechanisms during zebrafish embryogenesis and immune processes yet large gaps still remain in the functional pathways critical for each developmental stage especially for the late embryonic development. We sequenced the polyA extracted mRNA from 9 stages covering 7 major developmental periods of zebrafish. Whole genome gene expression pattern were analyzed to reveal unknown pathways or factors with implicated roles during each stage of vertebrate development. Overall design: Analysis of total mRNA by highthroughput sequencing in 9 stages covering 7 periods during the embryonic and larval development of zebrafish | pubmed:23700457;pubmed:26891128 | source: Zebrafish embryos at the 64 cell stage | GSM1112155: 64 cell 2 hpf | GSM1112155 | strain:AB|developmental stage:64 cell 2 hpf|tissue:embryo | 64 cell 2 hpf | Primary processing by SOLiD 3.0 online software The short SOLiD reads were aligned against the zebrafish genome build Zv9 using the software package Bioscope v1.2 obtained from Life Techlogies. Reads per kilobase of transcript per million mapped reads RPKM were calculated using an in house developed perl script which is available upon request. Genome build: Zv9 Supplementary files format and content: tab delimited text files including RPKM values for gene models from the genome annotation release Ensembl 62 of the Zv9 assembly | Zebrafish embryos at the 64 cell stage | Liquid nitrogen rapid cooling methods were used for zebrafish embryos and larvae euthanasia. | Total RNA was extracted from each stage of about 2000 embryos or larvae using Trizol Invitrogen Carlsbad CA USA methods according to the manufacturer’s instruction. RNA quality was evaluated by gel electrophoresis and the concentration was measured with NanoDrop 2000 Thermo Scientific,Waltham MA USA.The aliquots were stored at 80 oC. A protocol/kit available from Life Technologies with minor modifications was used to construct mRNA seq libraries. First the total RNA was estimated on an Agilent 2100 Bioanalyzer Agilent Technologies Waldbronn Germany. Second The ribosomal RNA removal steps were replaced by two rounds of polyA purification with the first round using the PolyATtract® mRNA Isolation Systems Promega Madison WI USA and the second round using the PolyAPurist™ Kit Ambion Austin TX USA. About 0.8 μg of mRNA was fragmented with 10min at 37 oC RNase III treatment. The fragmented mRNA were ligated with adaptor Mix A subsequently used for reverse transcription. The first strand cDNA were separated using 6% TBE Urea Gel Invitrogen Carlsbad CA USA and 100–200 nt fraction was recovered. The fractionated cDNA were subjected to 11 15 cycles of PCR amplification with the PCR products purified to yield the SOLiD Fragment Library ready for emulsion PCR. Emulsion PCR was performed using 600 pg of the library. All experiments were performed on full sequencing slides. | Zebrafish embryos and larvae were collected and maintained at approximately 28.5°C and were staged according to their morphological features and hours h or days dpf as described previously Kimmel et al. 1995 | strain:AB|developmental stage:64 cell 2 hpf|tissue:embryo | GSM1112155 | GSM1112155: 64 cell 2 hpf; Danio rerio; RNA Seq | GSM1112155 1 | 1 | GEO Accession:GSM1112155 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ABI_SOLID | AB SOLiD System 3.0 | SRP020469 | D_rerio_64cell_F3.csfasta.bz2 D_rerio_64cell_F3_QV.qual.bz2 | SOLiD_native SOLiD_native | 11793112050.0 | 235862241.0 | GSM1112155 r1 | 0:50 | 0:2729453191;1:3189868180;2:3325229431;3:2482063391;.:66497857 | 50 | SRX258160 | SRS406291 | SRA072427 | GEO | Shanghai Chenshan Botanical Garden | 1 | 0.56575 | 0.01697 | 0.8538 | 0.48681 | 50 | B | usable mapping rate | legacy | early | unknown | poly_a | unknown | bulk | unknown | unknown | China | 2013-04-02 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||||
| 36738 | 36738 | SRR836192 | SRX272881 | SRS417387 | SRP021915 | PRJNA200706 | Ribosome Profiling over a Zebrafish Developmental Timecourse | GSE46512 | Transcriptome Analysis | To experimentally validate the non coding status of annotated lncRNAs we performed ribosome profiling over a developmental timecourse that matched our previously published Pauli et al. 2012 developmental transcriptome. We find that many previously annotated lncRNAs appear to be translated but in a pattern more akin to five prime' leaders of coding genes. Overall design: Ribosome profiling over 8 stages in early zebrafish development: 2 4 cell 256 cell 1K cell Dome Shield Bud 28hpf and 5dpf | pubmed:23698349 | 20120724 RPF Seq 2 4Cell | GSM1131530 | tissue:Whole embryos|developmental stage:2 4 cells|strain:TL/AB|target molecule:ribosome footprinted RNA | 20120724 RPF Seq 2 4Cell | Adapters trimmed using custom script Reads that mapped to zebrafish rRNAs SILVA rRNA database: http://www.arb silva.de/ by Bowtie2 N 1 L 20 k 20 were discarded Remaining reads mapped to previously assembled zebrafish developmental transcriptome Pauli et al. 2012 on top of the Zv9/danRer7 assembly of the zebrafish genome by Tophat2; no indels no novel junctions M g 10 Only RPFs of length 27nt to 32nt used. P site positions determined to be +12 for 27 28nt RPFs +13 for 29 31nt RPFs +13 for 29 31nt RPFs +14 for 32nt RPFs. Custom scripts used to generate bw files of genome wide ribosome profiles corresponding to P site occupancy in conjunction with BedTools and UCSC bedgraphToBedBed Genome build: Zv9 danRer7 Supplementary files format and content: bigwig files corresponding to P site occupancy by ribosomes | Whole embryos | Embryos were quickly washed in ice cold PBS and flash frozen in liquid nitrogen | Embryos were lysed by repeated micropipetting in 1.5ml of cold polysome buffer 20 mM Tris HCl pH 7.4 250 mM NaCl 15 mM MgCl2 1mM dithiothreitol 100 μg/ml cycloheximide with added 0.5% Triton X 100 500 μg/ml GMP PNP 24 U/ml TurboDNase Ambion AM2238 incubated with agitation for 10 min at 4°C and clarified by centrifugation at 1300 rcf for 10 min at 4°C. 20μl RNAseI Ambion AM2294 was added to the 1.5 ml of supernatant and incubated for 30 min at 37°C then stopped by chilling on ice and addition of 40 μl of SuperaseIn Ambion AM2694. Footprinted samples were pelleted through a sucrose cushion 1M sucrose in polysome buffer with added 100 U/ml SuperaseIn by centrifugation at 260 000 rcf for 4.5 hours at 4°C and resuspended in 800 μl 10mM Tris pH 7.4 with 1% SDS. RNA was purified by hot acid phenol/chloroform extraction and precipitated by standard ethanol precipitation. Libraries were prepared essentially as described by Ingolia et al. Cell 2011 | 400 600 embryos per stage from TL/AB WT strains were allowed to grow at 28.5°C and staged according to Kimmel et al. Dev. Dyn. 1995 | developmental stage:2 4 cells|strain:TL/AB|target molecule:ribosome footprinted RNA | GSM1131530 | GSM1131530: 20120724 RPF Seq 2 4Cell; Danio rerio; RNA Seq | GSM1131530 1 | 1 | Embryos were lysed by repeated micropipetting in 1.5ml of cold polysome buffer 20 mM Tris HCl pH 7.4 250 mM NaCl 15 mM MgCl2 1mM dithiothreitol 100 μg/ml cycloheximide with added 0.5% Triton X 100 500 μg/ml GMP PNP 24 U/ml TurboDNase Ambion AM2238 incubated with agitation for 10 min at 4°C and clarified by centrifugation at 1300 rcf for 10 min at 4°C. 20μl RNAseI Ambion AM2294 was added to the 1.5 ml of supernatant and incubated for 30 min at 37°C then stopped by chilling on ice and addition of 40 μl of SuperaseIn Ambion AM2694. Footprinted samples were pelleted through a sucrose cushion 1M sucrose in polysome buffer with added 100 U/ml SuperaseIn by centrifugation at 260 000 rcf for 4.5 hours at 4°C and resuspended in 800 μl 10mM Tris pH 7.4 with 1% SDS. RNA was purified by hot acid phenol/chloroform extraction and precipitated by standard ethanol precipitation. Libraries were prepared essentially as described by Ingolia et al. Cell 2011 | GEO Accession:GSM1131530 | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP021915 | 20120724_RPF-Seq_2-4Cell.fastq.gz | fastq | 1568173420.0 | 35640305.0 | GSM1131530 r1 | 0:44 | A:256220962;C:489258424;G:538563811;T:283859833;N:270390 | 44 | 256220962 | 489258424 | 538563811 | 283859833 | 270390 | SRX272881 | SRS417387 | SRA075002 | GEO | Schier, Dept of Molecular and Cellular Biology, Harvard University | 1 | 0.0297 | 0.00558 | 0.99821 | 0.89066 | 44 | B | usable mapping rate | illumina | hiseq_era | 5prime | size_fractionation | unknown | bulk | unknown | unknown | United States | 2013-04-30 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 36761 | 36761 | SRR10295266 | SRX7008094 | SRS431105 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT 2hpf Total mRNA | GSM1152440 | source name:WT 2hpf Total mRNA|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT 64c R0 | AGR000324 | AGR000324 | RNA | RNA-Seq | TRANSCRIPTOMIC | unspecified | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | AGR000324_R1.fastq.gz | fastq | 781504124.0 | 10282949.0 | AGR000324 R1.fastq.gz | 0:76 | A:151879560;C:240178928;G:220957551;T:168456166;N:31919 | 76 | 151879560 | 240178928 | 220957551 | 168456166 | 31919 | SRX7008094 | SRS431105 | SRA980383 | Yale_Giraldez|Genetics | Giraldez Lab, Genetics, Yale University | 1 | 0.88875 | 0.14141 | 0.796 | 0.72154 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | small_rna | unknown | bulk | unknown | unknown | United States | 2019-10-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 36989 | 36989 | SRR870747 | SRX288478 | SRS431105 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT 2hpf Total mRNA | GSM1152440 | source name:WT 2hpf Total mRNA|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT 2hpf Total mRNA | Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT 2hpf Total mRNA | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | GSM1152440 | GSM1152440: WT 2hpf Total mRNA; Danio rerio; RNA Seq | GSM1152440 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152440 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2.run1_f0.fastq.gz | fastq | 203106276.0 | 2672451.0 | GSM1152440 r1 | 0:76 | A:39556313;C:62215497;G:57574227;T:43753218;N:7021 | 76 | 39556313 | 62215497 | 57574227 | 43753218 | 7021 | SRX288478 | SRS431105 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.89932 | 0.14283 | 0.79537 | 0.6949 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36990 | 36990 | SRR870748 | SRX288478 | SRS431105 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT 2hpf Total mRNA | GSM1152440 | source name:WT 2hpf Total mRNA|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT 2hpf Total mRNA | Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT 2hpf Total mRNA | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | GSM1152440 | GSM1152440: WT 2hpf Total mRNA; Danio rerio; RNA Seq | GSM1152440 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152440 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2.run1_f1.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152440 r2 | 0:76 | A:59049134;C:93274080;G:86287062;T:65360620;N:29104 | 76 | 59049134 | 93274080 | 86287062 | 65360620 | 29104 | SRX288478 | SRS431105 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.89775 | 0.14047 | 0.79492 | 0.72145 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36991 | 36991 | SRR870749 | SRX288478 | SRS431105 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT 2hpf Total mRNA | GSM1152440 | source name:WT 2hpf Total mRNA|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT 2hpf Total mRNA | Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT 2hpf Total mRNA | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | GSM1152440 | GSM1152440: WT 2hpf Total mRNA; Danio rerio; RNA Seq | GSM1152440 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152440 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2.run2_f0.fastq.gz | fastq | 198979248.0 | 2618148.0 | GSM1152440 r3 | 0:76 | A:38850253;C:60847024;G:56292278;T:42982425;N:7268 | 76 | 38850253 | 60847024 | 56292278 | 42982425 | 7268 | SRX288478 | SRS431105 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.90135 | 0.14238 | 0.79525 | 0.72238 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36992 | 36992 | SRR870750 | SRX288478 | SRS431105 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT 2hpf Total mRNA | GSM1152440 | source name:WT 2hpf Total mRNA|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT 2hpf Total mRNA | Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT 2hpf Total mRNA | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | GSM1152440 | GSM1152440: WT 2hpf Total mRNA; Danio rerio; RNA Seq | GSM1152440 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152440 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2.run2_f1.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152440 r4 | 0:76 | A:59259860;C:93069912;G:86074433;T:65573954;N:21841 | 76 | 59259860 | 93069912 | 86074433 | 65573954 | 21841 | SRX288478 | SRS431105 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.90021 | 0.14063 | 0.79531 | 0.69776 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36993 | 36993 | SRR870737 | SRX288477 | SRS431103 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | GSM1152439 | source name:Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | GSM1152439 | GSM1152439: Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152439 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152439 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | NS2_RPrpf.run1_f0.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152439 r1 | 0:76 | A:78867584;C:90953343;G:79555524;T:54616280;N:7269 | 76 | 78867584 | 90953343 | 79555524 | 54616280 | 7269 | SRX288477 | SRS431103 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.87907 | 0.22745 | 0.87117 | 0.75368 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36994 | 36994 | SRR870738 | SRX288477 | SRS431103 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | GSM1152439 | source name:Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | GSM1152439 | GSM1152439: Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152439 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152439 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | NS2_RPrpf.run1_f9.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152439 r10 | 0:76 | A:78816997;C:90959159;G:79657998;T:54558551;N:7295 | 76 | 78816997 | 90959159 | 79657998 | 54558551 | 7295 | SRX288477 | SRS431103 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.88043 | 0.22855 | 0.87245 | 0.75233 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36995 | 36995 | SRR870739 | SRX288477 | SRS431103 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | GSM1152439 | source name:Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | GSM1152439 | GSM1152439: Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152439 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152439 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | NS2_RPrpf.run1_f1.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152439 r2 | 0:76 | A:78763536;C:91008400;G:79691191;T:54526580;N:10293 | 76 | 78763536 | 91008400 | 79691191 | 54526580 | 10293 | SRX288477 | SRS431103 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.8787 | 0.22722 | 0.87265 | 0.72842 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36996 | 36996 | SRR870740 | SRX288477 | SRS431103 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | GSM1152439 | source name:Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | GSM1152439 | GSM1152439: Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152439 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152439 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | NS2_RPrpf.run1_f2.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152439 r3 | 0:76 | A:78852717;C:90887124;G:79660563;T:54593984;N:5612 | 76 | 78852717 | 90887124 | 79660563 | 54593984 | 5612 | SRX288477 | SRS431103 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.87626 | 0.22621 | 0.87073 | 0.75133 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36997 | 36997 | SRR870741 | SRX288477 | SRS431103 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | GSM1152439 | source name:Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | GSM1152439 | GSM1152439: Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152439 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152439 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | NS2_RPrpf.run1_f3.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152439 r4 | 0:76 | A:78806910;C:90965443;G:79696522;T:54524188;N:6937 | 76 | 78806910 | 90965443 | 79696522 | 54524188 | 6937 | SRX288477 | SRS431103 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.87542 | 0.22492 | 0.87334 | 0.75289 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36998 | 36998 | SRR870742 | SRX288477 | SRS431103 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | GSM1152439 | source name:Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | GSM1152439 | GSM1152439: Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152439 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152439 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | NS2_RPrpf.run1_f4.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152439 r5 | 0:76 | A:78982466;C:90858124;G:79522176;T:54631788;N:5446 | 76 | 78982466 | 90858124 | 79522176 | 54631788 | 5446 | SRX288477 | SRS431103 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.87474 | 0.22857 | 0.87265 | 0.75384 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 36999 | 36999 | SRR870743 | SRX288477 | SRS431103 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | GSM1152439 | source name:Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | GSM1152439 | GSM1152439: Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152439 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152439 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | NS2_RPrpf.run1_f5.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152439 r6 | 0:76 | A:79000082;C:90859539;G:79458519;T:54675434;N:6426 | 76 | 79000082 | 90859539 | 79458519 | 54675434 | 6426 | SRX288477 | SRS431103 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.87608 | 0.22983 | 0.87203 | 0.73363 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37000 | 37000 | SRR870744 | SRX288477 | SRS431103 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | GSM1152439 | source name:Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | GSM1152439 | GSM1152439: Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152439 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152439 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | NS2_RPrpf.run1_f6.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152439 r7 | 0:76 | A:78895701;C:90912554;G:79599348;T:54584005;N:8392 | 76 | 78895701 | 90912554 | 79599348 | 54584005 | 8392 | SRX288477 | SRS431103 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.87755 | 0.2278 | 0.87083 | 0.75325 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37001 | 37001 | SRR870745 | SRX288477 | SRS431103 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | GSM1152439 | source name:Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | GSM1152439 | GSM1152439: Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152439 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152439 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | NS2_RPrpf.run1_f7.fastq.gz | fastq | 185171644.0 | 2436469.0 | GSM1152439 r8 | 0:76 | A:48221267;C:55301333;G:48330805;T:33315622;N:2617 | 76 | 48221267 | 55301333 | 48330805 | 33315622 | 2617 | SRX288477 | SRS431103 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.87439 | 0.22962 | 0.87217 | 0.76905 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37002 | 37002 | SRR870746 | SRX288477 | SRS431103 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | GSM1152439 | source name:Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:total RNA | GSM1152439 | GSM1152439: Nanog + SoxB1 ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152439 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152439 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | NS2_RPrpf.run1_f8.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152439 r9 | 0:76 | A:78852734;C:90938528;G:79608770;T:54594053;N:5915 | 76 | 78852734 | 90938528 | 79608770 | 54594053 | 5915 | SRX288477 | SRS431103 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.87805 | 0.22718 | 0.87387 | 0.75535 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37003 | 37003 | SRR870734 | SRX288476 | SRS431104 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | Nanog + SoxB1 MO input mRNA for Ribosome Profiling | GSM1152438 | source name:Nanog + SoxB1 MO input mRNA for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:polyA RNA | Nanog + SoxB1 MO input mRNA for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | Nanog + SoxB1 MO input mRNA for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:polyA RNA | GSM1152438 | GSM1152438: Nanog + SoxB1 MO input mRNA for Ribosome Profiling; Danio rerio; OTHER | GSM1152438 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152438 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | NS2_RPinput.run1_f0.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152438 r1 | 0:76 | A:83857464;C:80052271;G:74307828;T:64344163;N:1438274 | 76 | 83857464 | 80052271 | 74307828 | 64344163 | 1438274 | SRX288476 | SRS431104 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.90598 | 0.19023 | 0.75418 | 0.68209 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37004 | 37004 | SRR870735 | SRX288476 | SRS431104 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | Nanog + SoxB1 MO input mRNA for Ribosome Profiling | GSM1152438 | source name:Nanog + SoxB1 MO input mRNA for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:polyA RNA | Nanog + SoxB1 MO input mRNA for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | Nanog + SoxB1 MO input mRNA for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:polyA RNA | GSM1152438 | GSM1152438: Nanog + SoxB1 MO input mRNA for Ribosome Profiling; Danio rerio; OTHER | GSM1152438 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152438 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | NS2_RPinput.run1_f1.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152438 r2 | 0:76 | A:83962612;C:80121685;G:74457590;T:64429627;N:1028486 | 76 | 83962612 | 80121685 | 74457590 | 64429627 | 1028486 | SRX288476 | SRS431104 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.90513 | 0.18947 | 0.75272 | 0.67499 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37005 | 37005 | SRR870736 | SRX288476 | SRS431104 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | Nanog + SoxB1 MO input mRNA for Ribosome Profiling | GSM1152438 | source name:Nanog + SoxB1 MO input mRNA for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:polyA RNA | Nanog + SoxB1 MO input mRNA for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | Nanog + SoxB1 MO input mRNA for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:Nanog MO SoxB1 MO|rna subtype:polyA RNA | GSM1152438 | GSM1152438: Nanog + SoxB1 MO input mRNA for Ribosome Profiling; Danio rerio; OTHER | GSM1152438 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152438 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | NS2_RPinput.run1_f2.fastq.gz | fastq | 160896560.0 | 2117060.0 | GSM1152438 r3 | 0:76 | A:44575257;C:42531891;G:39567390;T:34216932;N:5090 | 76 | 44575257 | 42531891 | 39567390 | 34216932 | 5090 | SRX288476 | SRS431104 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.91055 | 0.1912 | 0.75274 | 0.66065 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37006 | 37006 | SRR870725 | SRX288475 | SRS431102 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT ribosome protected fragments for Ribosome Profiling | GSM1152437 | source name:WT ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | GSM1152437 | GSM1152437: WT ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152437 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152437 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2_RPrpf.run1_f0.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152437 r1 | 0:76 | A:73324431;C:87422602;G:80630616;T:62614973;N:7378 | 76 | 73324431 | 87422602 | 80630616 | 62614973 | 7378 | SRX288475 | SRS431102 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.90419 | 0.19869 | 0.88136 | 0.71823 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37007 | 37007 | SRR870726 | SRX288475 | SRS431102 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT ribosome protected fragments for Ribosome Profiling | GSM1152437 | source name:WT ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | GSM1152437 | GSM1152437: WT ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152437 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152437 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2_RPrpf.run1_f1.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152437 r2 | 0:76 | A:73470482;C:87394958;G:80424001;T:62705138;N:5421 | 76 | 73470482 | 87394958 | 80424001 | 62705138 | 5421 | SRX288475 | SRS431102 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.90116 | 0.1987 | 0.88318 | 0.75079 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37008 | 37008 | SRR870727 | SRX288475 | SRS431102 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT ribosome protected fragments for Ribosome Profiling | GSM1152437 | source name:WT ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | GSM1152437 | GSM1152437: WT ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152437 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152437 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2_RPrpf.run1_f2.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152437 r3 | 0:76 | A:73282188;C:87383719;G:80721620;T:62606436;N:6037 | 76 | 73282188 | 87383719 | 80721620 | 62606436 | 6037 | SRX288475 | SRS431102 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.90149 | 0.19861 | 0.88156 | 0.74433 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37009 | 37009 | SRR870728 | SRX288475 | SRS431102 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT ribosome protected fragments for Ribosome Profiling | GSM1152437 | source name:WT ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | GSM1152437 | GSM1152437: WT ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152437 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152437 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2_RPrpf.run1_f3.fastq.gz | fastq | 294654812.0 | 3877037.0 | GSM1152437 r4 | 0:76 | A:71307964;C:84655917;G:77925866;T:60760632;N:4433 | 76 | 71307964 | 84655917 | 77925866 | 60760632 | 4433 | SRX288475 | SRS431102 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.90098 | 0.19992 | 0.88306 | 0.75109 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37010 | 37010 | SRR870729 | SRX288475 | SRS431102 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT ribosome protected fragments for Ribosome Profiling | GSM1152437 | source name:WT ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | GSM1152437 | GSM1152437: WT ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152437 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152437 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2_RPrpf.run1_f4.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152437 r5 | 0:76 | A:73341317;C:87432113;G:80559697;T:62659513;N:7360 | 76 | 73341317 | 87432113 | 80559697 | 62659513 | 7360 | SRX288475 | SRS431102 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.90201 | 0.19896 | 0.88193 | 0.74296 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37011 | 37011 | SRR870730 | SRX288475 | SRS431102 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT ribosome protected fragments for Ribosome Profiling | GSM1152437 | source name:WT ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | GSM1152437 | GSM1152437: WT ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152437 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152437 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2_RPrpf.run1_f5.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152437 r6 | 0:76 | A:73394014;C:87396975;G:80569514;T:62631217;N:8280 | 76 | 73394014 | 87396975 | 80569514 | 62631217 | 8280 | SRX288475 | SRS431102 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.90195 | 0.19918 | 0.88288 | 0.67362 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37012 | 37012 | SRR870731 | SRX288475 | SRS431102 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT ribosome protected fragments for Ribosome Profiling | GSM1152437 | source name:WT ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | GSM1152437 | GSM1152437: WT ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152437 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152437 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2_RPrpf.run1_f6.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152437 r7 | 0:76 | A:73414493;C:87403560;G:80487273;T:62688251;N:6423 | 76 | 73414493 | 87403560 | 80487273 | 62688251 | 6423 | SRX288475 | SRS431102 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.89971 | 0.19832 | 0.88294 | 0.69934 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37013 | 37013 | SRR870732 | SRX288475 | SRS431102 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT ribosome protected fragments for Ribosome Profiling | GSM1152437 | source name:WT ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | GSM1152437 | GSM1152437: WT ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152437 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152437 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2_RPrpf.run1_f7.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152437 r8 | 0:76 | A:73241313;C:87480362;G:80680397;T:62587911;N:10017 | 76 | 73241313 | 87480362 | 80680397 | 62587911 | 10017 | SRX288475 | SRS431102 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.9034 | 0.19739 | 0.88249 | 0.73831 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37014 | 37014 | SRR870733 | SRX288475 | SRS431102 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT ribosome protected fragments for Ribosome Profiling | GSM1152437 | source name:WT ribosome protected fragments for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | WT ribosome protected fragments for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT ribosome protected fragments for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:total RNA | GSM1152437 | GSM1152437: WT ribosome protected fragments for Ribosome Profiling; Danio rerio; OTHER | GSM1152437 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152437 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2_RPrpf.run1_f8.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152437 r9 | 0:76 | A:73344291;C:87391219;G:80659159;T:62598862;N:6469 | 76 | 73344291 | 87391219 | 80659159 | 62598862 | 6469 | SRX288475 | SRS431102 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.89882 | 0.19692 | 0.88235 | 0.71249 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | rrna_depletion | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37015 | 37015 | SRR870722 | SRX288474 | SRS431101 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT input mRNA for Ribosome Profiling | GSM1152436 | source name:WT input mRNA for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:polyA RNA | WT input mRNA for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT input mRNA for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:polyA RNA | GSM1152436 | GSM1152436: WT input mRNA for Ribosome Profiling; Danio rerio; OTHER | GSM1152436 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152436 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2_RPinput.run1_f0.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152436 r1 | 0:76 | A:83756699;C:82582873;G:78095254;T:57725687;N:1839487 | 76 | 83756699 | 82582873 | 78095254 | 57725687 | 1839487 | SRX288474 | SRS431101 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.90146 | 0.2126 | 0.76215 | 0.67955 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37016 | 37016 | SRR870723 | SRX288474 | SRS431101 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT input mRNA for Ribosome Profiling | GSM1152436 | source name:WT input mRNA for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:polyA RNA | WT input mRNA for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT input mRNA for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:polyA RNA | GSM1152436 | GSM1152436: WT input mRNA for Ribosome Profiling; Danio rerio; OTHER | GSM1152436 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152436 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2_RPinput.run1_f1.fastq.gz | fastq | 286369292.0 | 3768017.0 | GSM1152436 r2 | 0:76 | A:79362208;C:78237808;G:74048528;T:54711496;N:9252 | 76 | 79362208 | 78237808 | 74048528 | 54711496 | 9252 | SRX288474 | SRS431101 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.90977 | 0.21917 | 0.76059 | 0.67269 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||
| 37017 | 37017 | SRR870724 | SRX288474 | SRS431101 | SRP023492 | PRJNA206070 | Nanog SoxB1 and Pou5f1/Oct4 regulate widespread zygotic gene activation during the maternal to zygotic transition | GSE47558 | Other | Upon fertilization maternal factors direct development in a transcriptionally silent embryo. At the maternal to zygotic transition MZT a universal step in animal development unknown maternal factors trigger zygotic genome activation ZGA. In zebrafish ZGA is required for gastrulation and clearance of maternal mRNAs which is achieved in part by the conserved microRNA miR 430. However the precise factors that activate the zygotic program remain largely unknown. Here we show that Nanog Pou5f1 and SoxB1 are required for genome activation in zebrafish. We identified several hundred genes directly activated by maternal factors thus constituting the first wave of zygotic transcription in zebrafish. Ribosome profiling in the pre MZT embryo revealed that nanog sox19b and pou5f1 are the most highly translated transcription factor mRNAs. Combined loss of function for Nanog SoxB1 and Pou5f1 resulted in developmental arrest prior to gastrulation and a failure to activate >75% of zygotic genes. Furthermore we found that Nanog binds the miR 430 locus and together with Pou5f1 and SoxB1 initiate miR 430 expression and activity. Our results demonstrate that maternal Nanog Pou5f1 and SoxB1 are required to initiate the zygotic developmental program and in turn trigger the clearance of the maternal program by activating miR 430 expression. Overall design: Wild type and loss of function total mRNA sequencing of embryonic transcriptomes pre and post MZT; ribosome profiling pre MZT | pubmed:24056933 | WT input mRNA for Ribosome Profiling | GSM1152436 | source name:WT input mRNA for Ribosome Profiling|tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:polyA RNA | WT input mRNA for Ribosome Profiling | Library strategy: Ribosome Profiling Base calling was performed using CASAVA 1.8.2. For mRNA Seq raw reads were initially filtered by aligning permissively to a ribosomal DNA index and discarded using Bowtie v0.12.9 with switches seedlen 25 n 3 k 1 y e 10000. Unaligned reads were then aligned strand specific to the zebrafish Zv9 UCSC danRer7 genome sequence using Tophat v2.0.7 with default parameters. RPKMs for gene exons are calculated based on joined Ensembl r70 and RefSeq annotations for uniquely aligning reads. Metagenes with names in the form GeneX.GeneY are constructed for reads that do not align uniquely to either gene separately but align to both genes and nowhere else in the genome. The microRNA miR 430 polycistronic precursor is also listed as a meta gene called ‘mir 430 hairpin’. RPKMs for gene introns total RNA samples only are similarly calculated normalizing against the non repetitive sum length of a gene’s introns and the total number of aligned exonic reads in the sample. For Ribosome Profiling reads were trimmed of 3’ adapter sequence and reads in the trimmed length range 28 29nts were retained for ribosome protected fragments >=18nts for input mRNA. Reads were aligned as above retaining only uniquely aligned reads to the sense CDS sequences of protein coding genes. Note: traces of exogenous RNA corresponding to a nanog antisense probe and ntla sense and antisense were detected largely outside the expected size range; these reads were discarded. Gene counts for uniquely aligning reads to CDS regions are listed with respect to RefSeq transcript annotations. Genome build: Ensembl Zv9 / UCSC danRer7 Supplementary files format and content: RPKM tables for exons and introns for mRNA Seq; and RPKM tables for CDS regions for ribosome profiling generated as described above. | WT input mRNA for Ribosome Profiling | Treated embryos were injected at 1 cell stage for all treatements except cycloheximide which was applied by bathing 32 cell embryos and incubating at xxxdegreesC. | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | tissue:Whole embryos|strain:TUAB|Stage:2hpf|treatment:n1|rna subtype:polyA RNA | GSM1152436 | GSM1152436: WT input mRNA for Ribosome Profiling; Danio rerio; OTHER | GSM1152436 | 1 | For mRNA Seq total RNA from five embryos was extracted using Trizol Invitrogen for each experimental condition. RNA was treated with TURBO DNase Ambion for 30 minutes at 37°C and extracted using phenol chloroform. For ribosome profiling 50 wild type embryos for each condition were collected at 64 cell stage. Embryos were lysed using 800ul of a mammalian cell lysis buffer containing 100ug/ml Cycloheximide as per the manufacturer’s instruction ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. For nuclease treatment 3ul of ARTseq Nuclease was used. Ribosome protected fragments were run and 28 29nt fragments were gel purified as previously described in Bazzini et al. 2012 and cloned according to the manufacturers protocol ARTseq Ribosome Profiling Kit RPHMR12126 Epicentre. TruSeq strand specific libraries were constructed according to standard protocols. For total mRNA Seq sequencing libraries were treated with Epicentre Ribo Zero Gold kits according to the published protocol in order to deplete ribosomal RNA prior to sequencing. Ribosome profiling libraries were constructed as in Bazzini et al. Science 2012. | GEO Accession:GSM1152436 | OTHER | TRANSCRIPTOMIC | other | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP023492 | W2_RPinput.run1_f2.fastq.gz | fastq | 304000000.0 | 4000000.0 | GSM1152436 r3 | SRX288474 | SRS431101 | SRA082637 | GEO | Giraldez Lab, Genetics, Yale University | 1 | 0.90005 | 0.2157 | 0.75801 | 0.66588 | 76 | B | usable mapping rate | illumina | hiseq_era | unknown | poly_a | ribozero | bulk | unknown | unknown | United States | 2013-05-31 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||||||||||||||||
| 37128 | 37128 | SRR953522 | SRX336167 | SRS470740 | SRP028862 | PRJNA215266 | Danio rerio Transcriptome or Gene expression | PRJNA215266 | Other | During early vertebrate development various small non coding RNAs sRNAs such as MicroRNAs miRNAs and Piwi interacting RNAs piRNAs are dynamically expressed for orchestrating the maternal to zygotic transition MZT. Systematic analysis of expression profiles of zebrafish small RNAome will be greatly helpful for understanding the sRNA regulation during embryonic development. | small RNA sequencing for zebrafish early development | General Sample for zebrafish | zebrafish early development | breed:wild type zebrafish | 16 cell of zebrafish development | 16 cell stage | 1 | Total RNA from embryos was isolated using Trizol reagent Invitrogen. RNAs were fractioned on 15% denaturing polyacrylamide gels and small RNAs were isolated and purified. Subsequently small RNAs were ligated with both a 5’ adapter and 3’ adapter for reverse transcription using SuperscriptTM II reverse transcription kit Invitrogen following the manufacturer's instructions at 42 oC for 1 h and 70 oC for 15 min. post that the reverse transcribed product cDNA was amplified by the following PCR program: a 15 cycle reaction at 98 oC for 30 sec followed by 15 cycles consisting of 10 sec at 98 oC 15 sec at 72 oC and then 10 min at 72 oC. post obtaining a 92bp DNA band on 6% denaturing PAGE gels the PCR products were enriched by ethanol precipitation and purified using Spin X filter columns Fisher. | RNA-Seq | TRANSCRIPTOMIC | size fractionation | SINGLE | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>49</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP028862 | s16-cell.fq | fastq | 857702468.0 | 17504132.0 | 16 cell stage | 0:49 | A:188518867;C:188172489;G:222316155;T:258636924;N:58033 | 49 | 188518867 | 188172489 | 222316155 | 258636924 | 58033 | SRX336167 | SRS470740 | SRA098041 | Huazhong University of Science and Technology|cuckoo | Huazhong University of Science and Technology | 1 | 3e-05 | 1e-05 | 0.99993 | 1.0 | 49 | T | under 1.2% mapping rate | illumina | hiseq_era | unknown | size_fractionation | unknown | bulk | unknown | unknown | China | 2015-07-22 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||||||||||
| 37234 | 37234 | SRR1146564 | SRX451693 | SRS544829 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre 155 2hpf PAL | GSM1316816 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre 155 2hpf PAL | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1316816 | GSM1316816: Dre 155 2hpf PAL; Danio rerio; RNA Seq | GSM1316816 | 1 | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | GEO Accession:GSM1316816 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP033369 | Dre_155_2hpf_PAL_sequences.txt.gz | fastq | 359788448.0 | 8775328.0 | GSM1316816 r1 | 0:41 | A:85325483;C:54760617;G:79441969;T:135974691;N:4285688 | 41 | 85325483 | 54760617 | 79441969 | 135974691 | 4285688 | SRX451693 | SRS544829 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.55281 | 0.12799 | 0.85399 | 0.57589 | 41 | B | usable mapping rate | illumina | early_illumina | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2014-01-29 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 37235 | 37235 | SRR1146563 | SRX451692 | SRS544828 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre 132 2hpf PAL | GSM1316815 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre 132 2hpf PAL | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1316815 | GSM1316815: Dre 132 2hpf PAL; Danio rerio; RNA Seq | GSM1316815 | 1 | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | GEO Accession:GSM1316815 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP033369 | Dre_132_2hpf_PAL_sequences.txt.gz | fastq | 381247110.0 | 9298710.0 | GSM1316815 r1 | 0:41 | A:89344310;C:58798497;G:80235521;T:148523775;N:4345007 | 41 | 89344310 | 58798497 | 80235521 | 148523775 | 4345007 | SRX451692 | SRS544828 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.56455 | 0.12077 | 0.86628 | 0.56964 | 41 | B | usable mapping rate | illumina | early_illumina | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2014-01-29 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 37236 | 37236 | SRR1146562 | SRX451691 | SRS544827 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre mock 2hpf PAL | GSM1316814 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre mock 2hpf PAL | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1316814 | GSM1316814: Dre mock 2hpf PAL; Danio rerio; RNA Seq | GSM1316814 | 1 | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | GEO Accession:GSM1316814 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina Genome Analyzer II | SRP033369 | Dre_mock_2hpf_PAL_sequences.txt.gz | fastq | 377647351.0 | 9210911.0 | GSM1316814 r1 | 0:41 | A:87549066;C:56716380;G:81391312;T:147721892;N:4268701 | 41 | 87549066 | 56716380 | 81391312 | 147721892 | 4268701 | SRX451691 | SRS544827 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.55884 | 0.12609 | 0.85731 | 0.55373 | 41 | B | usable mapping rate | illumina | early_illumina | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2014-01-29 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 37243 | 37243 | SRR1039875 | SRX384685 | SRS508883 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre 155 2hpf RPF | GSM1276556 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre 155 2hpf RPF | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1276556 | GSM1276556: Dre 155 2hpf RPF; Danio rerio; RNA Seq | GSM1276556 | 1 | Libraries were constructed exactly as described in Guo et al. 2010 GSE22004 RNA seq | GEO Accession:GSM1276556 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033369 | Dre_155_2hpf_RPF_GCCAAT-s_2_1_sequence.txt | fastq | 1183731400.0 | 29593285.0 | GSM1276556 r1 | 0:40 | A:294292314;C:281794141;G:332579260;T:274773786;N:291899 | 40 | 294292314 | 281794141 | 332579260 | 274773786 | 291899 | SRX384685 | SRS508883 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.04234 | 0.00777 | 0.94795 | 0.7945 | 40 | B | usable mapping rate | illumina | hiseq_era | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2013-11-27 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||||||||
| 37244 | 37244 | SRR1039874 | SRX384684 | SRS508884 | SRP033369 | PRJNA230112 | PolyA tail profiling reveals an embryonic switch in translational control | GSE52809 | Other | PolyA tails enhance the stability and translation of most eukaryotic messenger RNAs but difficulties in globally measuring polyA tail lengths have impeded greater understanding of polyA tail function. Here we describe polyA tail length profiling by sequencing PAL seq and apply it to measure tail lengths of millions of individual RNAs isolated from yeasts cell lines Arabidopsis thaliana leaves mouse liver and zebrafish and frog embryos. PolyA tail lengths were conserved between orthologous mRNAs with mRNAs encoding ribosomal proteins and other 'housekeeping' proteins tending to have shorter tails. As expected tail lengths were coupled to translational efficiencies in early zebrafish and frog embryos. However this strong coupling diminished at gastrulation and was absent in non embryonic samples indicating a rapid developmental switch in the nature of translational control. This switch complements an earlier switch to zygotic transcriptional control and explains why the predominant effect of microRNA mediated deadenylation concurrently shifts from translational repression to mRNA destabilization. Overall design: 64 samples from a variety of species | pubmed:24476825 | Dre 132 2hpf RPF | GSM1276555 | tissue:zebrafish embryo|strain:AB|developmental stage:2 hpf | Dre 132 2hpf RPF | Raw read files were stripped of adaptor and mapped to the appropriate species' genome and/or transcriptome. RNA seq and ribosome profiling reads mapping within the coding sequence of an annotated gene excluding the first 50 nucleotides of the coding sequence were assigned to that gene and used to calculate its RPKM value. PolyA tail length measurements were generated using PAL seq tags that mapped within the three prime UTR of an annotated gene. Genome build: Human: hg18; Mouse: mm9; Zebrafish: danRer7; Drosophila: dm3; Arabidopsis: tair10; S. cerevisiae: sacCer3; S. pombe: Spombe1; Xenopus: Unigene Supplementary files format and content: One set of processed data files contains abundance and polyA tail length measurements for each gene. Another set contains raw fluorescence intensities for each base for each cycle of sequencing by synthesis and streptavidin flow in for each sequencing cluster. Another set contains normalized streptavidin fluorescence intensities for each sequencing cluster. | zebrafish embryo | RNA seq: Cytoplasmically enriched RNA was extracted polyA selected randomly fragmented by partial alkaline hydrolysis and then size selected RNA fragments were used for library preparation. Ribosome profiling: Cell extracts were processed as described in Subtelny et al. 2014 GSE52809. PAL seq: Polyadenylated ends in total RNA were ligated to a biotinylated adaptor then partially digested with RNase T1. The resulting fragments were size selected 104 750 nt captured on streptavidin beads and used for library preparation. | Libraries were constructed exactly as described in Subtelny et al. 2014 GSE52809 | Each sample was grown or maintained in accordance with standard protocols. | strain:AB|developmental stage:2 hpf | GSM1276555 | GSM1276555: Dre 132 2hpf RPF; Danio rerio; RNA Seq | GSM1276555 | 1 | Libraries were constructed exactly as described in Guo et al. 2010 GSE22004 RNA seq | GEO Accession:GSM1276555 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | Illumina HiSeq 2000 | SRP033369 | Dre_132_2hpf_RPF_ACAGTG-s_2_1_sequence.txt | fastq | 1178603560.0 | 29465089.0 | GSM1276555 r1 | 0:40 | A:298397078;C:284717833;G:331869329;T:263329002;N:290318 | 40 | 298397078 | 284717833 | 331869329 | 263329002 | 290318 | SRX384684 | SRS508884 | SRA114402 | GEO | Bartel, Biology, Whitehead Institute for Biomedical Research | 1 | 0.05095 | 0.00846 | 0.94111 | 0.79521 | 40 | B | usable mapping rate | illumina | hiseq_era | 3prime | small_rna | unknown | bulk | unknown | unknown | United States | 2013-11-27 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;