run_metadata
231 rows where devstage_curation = "Cleavage" and experiment.library_layout = "PAIRED"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 3155 | 3155 | ERR1410225 | ERX1481464 | ERS1021813 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 pool12 | SAMEA3714664 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714664|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:11Z|INSDC status:public|Submitter Id:e9237f50 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCAGCTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e9237f50 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#24 | 15565967 | Illumina sequencing of library 15565967 constructed from sample accession ERS1021813 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCAGCTC. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#24.cram | cram | 682856330.0 | 5252741.0 | SC RUN 18730 4#24 | 0:55 1:75 | A:168217714;C:139075008;G:141169282;T:234338870;N:55456 | 55 | 75 | 168217714 | 139075008 | 141169282 | 234338870 | 55456 | ERX1481464 | ERS1021813 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.22601 | 0.6266 | 0.06302 | 0.07433 | 0.95848 | 0.87767 | 0.77147 | 0.72121 | 55 | 75 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3156 | 3156 | ERR1410224 | ERX1481463 | ERS1021812 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 pool11 | SAMEA3714663 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714663|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:10Z|INSDC status:public|Submitter Id:e91834b0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACTAGTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e91834b0 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#23 | 15565966 | Illumina sequencing of library 15565966 constructed from sample accession ERS1021812 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACTAGTC. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#23.cram | cram | 784669730.0 | 6035921.0 | SC RUN 18730 4#23 | 0:55 1:75 | A:193369040;C:154930839;G:157589012;T:278718023;N:62816 | 55 | 75 | 193369040 | 154930839 | 157589012 | 278718023 | 62816 | ERX1481463 | ERS1021812 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.22113 | 0.66423 | 0.05856 | 0.07177 | 0.95899 | 0.86705 | 0.76036 | 0.71777 | 55 | 75 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3157 | 3157 | ERR1410223 | ERX1481462 | ERS1021811 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 pool10 | SAMEA3714662 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714662|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:10Z|INSDC status:public|Submitter Id:e90c9bf0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCAGATTC is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e90c9bf0 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#22 | 15565965 | Illumina sequencing of library 15565965 constructed from sample accession ERS1021811 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCAGATTC. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#22.cram | cram | 1247901590.0 | 9599243.0 | SC RUN 18730 4#22 | 0:55 1:75 | A:314703461;C:244320464;G:241561095;T:447214667;N:101903 | 55 | 75 | 314703461 | 244320464 | 241561095 | 447214667 | 101903 | ERX1481462 | ERS1021811 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.20694 | 0.62963 | 0.04856 | 0.05487 | 0.95763 | 0.87026 | 0.7137 | 0.71273 | 55 | 75 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3158 | 3158 | ERR1410222 | ERX1481461 | ERS1021810 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 pool9 | SAMEA3714661 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714661|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:09Z|INSDC status:public|Submitter Id:e8fe4410 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TATGCCAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8fe4410 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#21 | 15565964 | Illumina sequencing of library 15565964 constructed from sample accession ERS1021810 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TATGCCAG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#21.cram | cram | 1160974880.0 | 8930576.0 | SC RUN 18730 4#21 | 0:55 1:75 | A:287583127;C:233701395;G:225242195;T:414354028;N:94135 | 55 | 75 | 287583127 | 233701395 | 225242195 | 414354028 | 94135 | ERX1481461 | ERS1021810 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.20242 | 0.60852 | 0.05828 | 0.06484 | 0.95568 | 0.87456 | 0.67452 | 0.38749 | 55 | 75 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3159 | 3159 | ERR1410221 | ERX1481460 | ERS1021809 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 pool8 | SAMEA3714660 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714660|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:08Z|INSDC status:public|Submitter Id:e8f2d260 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGGCTCAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8f2d260 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#20 | 15565963 | Illumina sequencing of library 15565963 constructed from sample accession ERS1021809 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGGCTCAG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#20.cram | cram | 1041644630.0 | 8012651.0 | SC RUN 18730 4#20 | 0:55 1:75 | A:250361997;C:216927117;G:209137594;T:365137042;N:80880 | 55 | 75 | 250361997 | 216927117 | 209137594 | 365137042 | 80880 | ERX1481460 | ERS1021809 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.23722 | 0.6381 | 0.05317 | 0.07562 | 0.95503 | 0.87671 | 0.75995 | 0.72353 | 55 | 75 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3160 | 3160 | ERR1410220 | ERX1481459 | ERS1021808 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 pool7 | SAMEA3714659 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714659|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:08Z|INSDC status:public|Submitter Id:e8e787c0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCATTGAG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8e787c0 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#19 | 15565962 | Illumina sequencing of library 15565962 constructed from sample accession ERS1021808 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCATTGAG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#19.cram | cram | 1002402180.0 | 7710786.0 | SC RUN 18730 4#19 | 0:55 1:75 | A:249654737;C:203437995;G:194586976;T:354640685;N:81787 | 55 | 75 | 249654737 | 203437995 | 194586976 | 354640685 | 81787 | ERX1481459 | ERS1021808 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.21081 | 0.61197 | 0.04352 | 0.05852 | 0.9529 | 0.86815 | 0.65385 | 0.64824 | 55 | 75 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3161 | 3161 | ERR1410219 | ERX1481458 | ERS1021807 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 pool6 | SAMEA3714658 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714658|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:07Z|INSDC status:public|Submitter Id:e8dc3d20 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGTATGCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8dc3d20 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#18 | 15565961 | Illumina sequencing of library 15565961 constructed from sample accession ERS1021807 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGTATGCG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#18.cram | cram | 1001271050.0 | 7702085.0 | SC RUN 18730 4#18 | 0:55 1:75 | A:249131077;C:206043698;G:193568917;T:352446609;N:80749 | 55 | 75 | 249131077 | 206043698 | 193568917 | 352446609 | 80749 | ERX1481458 | ERS1021807 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.22004 | 0.6117 | 0.05313 | 0.0656 | 0.95095 | 0.8758 | 0.70135 | 0.69364 | 55 | 75 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3162 | 3162 | ERR1410218 | ERX1481457 | ERS1021806 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 pool5 | SAMEA3714657 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714657|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:06Z|INSDC status:public|Submitter Id:e8b183a0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCCAGTCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8b183a0 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#17 | 15565960 | Illumina sequencing of library 15565960 constructed from sample accession ERS1021806 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCCAGTCG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#17.cram | cram | 1240938140.0 | 9545678.0 | SC RUN 18730 4#17 | 0:55 1:75 | A:302318036;C:249218633;G:246601321;T:442702025;N:98125 | 55 | 75 | 302318036 | 249218633 | 246601321 | 442702025 | 98125 | ERX1481457 | ERS1021806 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.23057 | 0.63523 | 0.05319 | 0.067 | 0.95213 | 0.86695 | 0.69753 | 0.68537 | 55 | 75 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3163 | 3163 | ERR1410217 | ERX1481456 | ERS1021805 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 pool4 | SAMEA3714656 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714656|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:06Z|INSDC status:public|Submitter Id:e8ab9030 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAAGTTCG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8ab9030 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#16 | 15565959 | Illumina sequencing of library 15565959 constructed from sample accession ERS1021805 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAAGTTCG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#16.cram | cram | 942829030.0 | 7252531.0 | SC RUN 18730 4#16 | 0:55 1:75 | A:225274547;C:196341691;G:188483755;T:332654028;N:75009 | 55 | 75 | 225274547 | 196341691 | 188483755 | 332654028 | 75009 | ERX1481456 | ERS1021805 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.21889 | 0.64365 | 0.04363 | 0.07265 | 0.95181 | 0.87478 | 0.70501 | 0.69162 | 55 | 75 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3164 | 3164 | ERR1410216 | ERX1481455 | ERS1021804 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 pool3 | SAMEA3714655 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714655|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:05Z|INSDC status:public|Submitter Id:e8a5eae0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCAGGAGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8a5eae0 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#15 | 15565958 | Illumina sequencing of library 15565958 constructed from sample accession ERS1021804 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCAGGAGG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#15.cram | cram | 992671030.0 | 7635931.0 | SC RUN 18730 4#15 | 0:55 1:75 | A:241776762;C:210080049;G:195284057;T:345448849;N:81313 | 55 | 75 | 241776762 | 210080049 | 195284057 | 345448849 | 81313 | ERX1481455 | ERS1021804 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.21439 | 0.6195 | 0.04725 | 0.05379 | 0.95191 | 0.87606 | 0.67336 | 0.65016 | 55 | 75 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3165 | 3165 | ERR1410215 | ERX1481454 | ERS1021803 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 pool2 | SAMEA3714654 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714654|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:05Z|INSDC status:public|Submitter Id:e89cc320 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCTCACGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e89cc320 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#14 | 15565957 | Illumina sequencing of library 15565957 constructed from sample accession ERS1021803 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCTCACGG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#14.cram | cram | 1234311910.0 | 9494707.0 | SC RUN 18730 4#14 | 0:55 1:75 | A:301439259;C:257228602;G:244500849;T:431043241;N:99959 | 55 | 75 | 301439259 | 257228602 | 244500849 | 431043241 | 99959 | ERX1481454 | ERS1021803 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.19348 | 0.62337 | 0.04021 | 0.05986 | 0.95574 | 0.87941 | 0.67064 | 0.69696 | 55 | 75 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3166 | 3166 | ERR1410214 | ERX1481453 | ERS1021802 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 pool1 | SAMEA3714653 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714653|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:04Z|INSDC status:public|Submitter Id:e897ba10 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a pool of 8 wild type zebrafish embryos from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACTTCGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e897ba10 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#13 | 15565956 | Illumina sequencing of library 15565956 constructed from sample accession ERS1021802 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACTTCGG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#13.cram | cram | 1039867140.0 | 7998978.0 | SC RUN 18730 4#13 | 0:55 1:75 | A:252384576;C:218519074;G:206578085;T:362298880;N:86525 | 55 | 75 | 252384576 | 218519074 | 206578085 | 362298880 | 86525 | ERX1481453 | ERS1021802 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.18713 | 0.60956 | 0.05049 | 0.0817 | 0.95556 | 0.87618 | 0.66594 | 0.68034 | 55 | 75 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3167 | 3167 | ERR1410213 | ERX1481452 | ERS1021801 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 12 | SAMEA3714652 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714652|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:04Z|INSDC status:public|Submitter Id:e89262e0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGAACTGG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e89262e0 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#12 | 15565955 | Illumina sequencing of library 15565955 constructed from sample accession ERS1021801 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGAACTGG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#12.cram | cram | 1071792020.0 | 8244554.0 | SC RUN 18730 4#12 | 0:55 1:75 | A:266291261;C:216074486;G:207838804;T:381495628;N:91841 | 55 | 75 | 266291261 | 216074486 | 207838804 | 381495628 | 91841 | ERX1481452 | ERS1021801 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.19027 | 0.64477 | 0.0489 | 0.06997 | 0.95268 | 0.86371 | 0.66594 | 0.67162 | 55 | 75 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3168 | 3168 | ERR1410212 | ERX1481451 | ERS1021800 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 11 | SAMEA3714651 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714651|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:03Z|INSDC status:public|Submitter Id:e88d59d0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTGGTATG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88d59d0 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#11 | 15565954 | Illumina sequencing of library 15565954 constructed from sample accession ERS1021800 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTGGTATG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#11.cram | cram | 686164570.0 | 5278189.0 | SC RUN 18730 4#11 | 0:55 1:75 | A:165352345;C:146328635;G:134343947;T:240083817;N:55826 | 55 | 75 | 165352345 | 146328635 | 134343947 | 240083817 | 55826 | ERX1481451 | ERS1021800 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.22823 | 0.61844 | 0.08567 | 0.10696 | 0.95106 | 0.86797 | 0.62805 | 0.63179 | 55 | 75 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3169 | 3169 | ERR1410211 | ERX1481450 | ERS1021799 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 10 | SAMEA3714650 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714650|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:03Z|INSDC status:public|Submitter Id:e88829b0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAACGCTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88829b0 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#10 | 15565953 | Illumina sequencing of library 15565953 constructed from sample accession ERS1021799 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAACGCTG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#10.cram | cram | 889043870.0 | 6838799.0 | SC RUN 18730 4#10 | 0:55 1:75 | A:223435089;C:179282347;G:171273337;T:314981588;N:71509 | 55 | 75 | 223435089 | 179282347 | 171273337 | 314981588 | 71509 | ERX1481450 | ERS1021799 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.19054 | 0.6472 | 0.0467 | 0.06495 | 0.953 | 0.86519 | 0.68221 | 0.68725 | 55 | 75 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3170 | 3170 | ERR1410210 | ERX1481449 | ERS1021798 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 9 | SAMEA3714649 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714649|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:02Z|INSDC status:public|Submitter Id:e88320a0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCGAAGTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e88320a0 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#9 | 15565952 | Illumina sequencing of library 15565952 constructed from sample accession ERS1021798 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCGAAGTG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#9.cram | cram | 987809940.0 | 7598538.0 | SC RUN 18730 4#9 | 0:55 1:75 | A:248484130;C:197140774;G:188385871;T:353715305;N:83860 | 55 | 75 | 248484130 | 197140774 | 188385871 | 353715305 | 83860 | ERX1481449 | ERS1021798 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.2215 | 0.62639 | 0.05009 | 0.06362 | 0.94959 | 0.86689 | 0.63702 | 0.63984 | 55 | 75 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3171 | 3171 | ERR1410209 | ERX1481448 | ERS1021797 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 8 | SAMEA3714648 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714648|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:02Z|INSDC status:public|Submitter Id:e87d5440 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCCATTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e87d5440 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#8 | 15565951 | Illumina sequencing of library 15565951 constructed from sample accession ERS1021797 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCCATTG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#8.cram | cram | 991993340.0 | 7630718.0 | SC RUN 18730 4#8 | 0:55 1:75 | A:248601530;C:201637312;G:190701521;T:350971271;N:81706 | 55 | 75 | 248601530 | 201637312 | 190701521 | 350971271 | 81706 | ERX1481448 | ERS1021797 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.18071 | 0.60546 | 0.04372 | 0.05614 | 0.95556 | 0.87182 | 0.64904 | 0.68316 | 55 | 75 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3172 | 3172 | ERR1410208 | ERX1481447 | ERS1021796 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 7 | SAMEA3714647 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714647|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e871e290 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAGTCTTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e871e290 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#7 | 15565950 | Illumina sequencing of library 15565950 constructed from sample accession ERS1021796 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAGTCTTG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#7.cram | cram | 1355591770.0 | 10427629.0 | SC RUN 18730 4#7 | 0:55 1:75 | A:333761549;C:285155703;G:270975293;T:465589806;N:109419 | 55 | 75 | 333761549 | 285155703 | 270975293 | 465589806 | 109419 | ERX1481447 | ERS1021796 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.19403 | 0.63995 | 0.03449 | 0.07104 | 0.957 | 0.88641 | 0.73288 | 0.71598 | 55 | 75 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3173 | 3173 | ERR1410207 | ERX1481446 | ERS1021795 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 6 | SAMEA3714646 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714646|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e86670e0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGTGGTTG is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e86670e0 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#6 | 15565949 | Illumina sequencing of library 15565949 constructed from sample accession ERS1021795 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGTGGTTG. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#6.cram | cram | 1121411330.0 | 8626241.0 | SC RUN 18730 4#6 | 0:55 1:75 | A:275436070;C:245845272;G:219970219;T:380067436;N:92333 | 55 | 75 | 275436070 | 245845272 | 219970219 | 380067436 | 92333 | ERX1481446 | ERS1021795 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.185 | 0.59026 | 0.03934 | 0.06143 | 0.95268 | 0.88968 | 0.59393 | 0.69736 | 55 | 75 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3174 | 3174 | ERR1410206 | ERX1481445 | ERS1021794 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 5 | SAMEA3714645 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714645|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:01Z|INSDC status:public|Submitter Id:e85b2640 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TCCTCAAT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e85b2640 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#5 | 15565948 | Illumina sequencing of library 15565948 constructed from sample accession ERS1021794 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TCCTCAAT. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#5.cram | cram | 852544290.0 | 6558033.0 | SC RUN 18730 4#5 | 0:55 1:75 | A:202033234;C:177211087;G:169900063;T:303332405;N:67501 | 55 | 75 | 202033234 | 177211087 | 169900063 | 303332405 | 67501 | ERX1481445 | ERS1021794 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.21445 | 0.62891 | 0.0753 | 0.09655 | 0.95278 | 0.86929 | 0.61569 | 0.48656 | 55 | 75 | T | B | mate1 technical by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3175 | 3175 | ERR1410205 | ERX1481444 | ERS1021793 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 4 | SAMEA3714644 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714644|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:42:00Z|INSDC status:public|Submitter Id:e84f8d80 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TACAGGAT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e84f8d80 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#4 | 15565947 | Illumina sequencing of library 15565947 constructed from sample accession ERS1021793 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TACAGGAT. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#4.cram | cram | 989803880.0 | 7613876.0 | SC RUN 18730 4#4 | 0:55 1:75 | A:241562947;C:196888151;G:193862254;T:357404172;N:86356 | 55 | 75 | 241562947 | 196888151 | 193862254 | 357404172 | 86356 | ERX1481444 | ERS1021793 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.27131 | 0.63988 | 0.04128 | 0.04919 | 0.95923 | 0.88292 | 0.81011 | 0.7508 | 55 | 75 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3176 | 3176 | ERR1410204 | ERX1481443 | ERS1021792 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 3 | SAMEA3714643 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714643|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:42:00Z|INSDC status:public|Submitter Id:e8441bd0 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TAGTGACT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8441bd0 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#3 | 15565946 | Illumina sequencing of library 15565946 constructed from sample accession ERS1021792 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TAGTGACT. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#3.cram | cram | 1144202930.0 | 8801561.0 | SC RUN 18730 4#3 | 0:55 1:75 | A:278906912;C:230946498;G:229591661;T:404660425;N:97434 | 55 | 75 | 278906912 | 230946498 | 229591661 | 404660425 | 97434 | ERX1481443 | ERS1021792 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.24055 | 0.6437 | 0.04616 | 0.05861 | 0.9554 | 0.88221 | 0.30306 | 0.73916 | 55 | 75 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3177 | 3177 | ERR1410203 | ERX1481442 | ERS1021791 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 2 | SAMEA3714642 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714642|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:44Z|INSDC last update:2015 12 16T13:41:59Z|INSDC status:public|Submitter Id:e8385c00 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TTCCTGCT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e8385c00 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#2 | 15565945 | Illumina sequencing of library 15565945 constructed from sample accession ERS1021791 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TTCCTGCT. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#2.cram | cram | 1459339960.0 | 11225692.0 | SC RUN 18730 4#2 | 0:55 1:75 | A:361580033;C:294777861;G:295641568;T:507221717;N:118781 | 55 | 75 | 361580033 | 294777861 | 295641568 | 507221717 | 118781 | ERX1481442 | ERS1021791 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.25446 | 0.64481 | 0.04258 | 0.05864 | 0.95473 | 0.88562 | 0.32211 | 0.75437 | 55 | 75 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3178 | 3178 | ERR1410202 | ERX1481441 | ERS1021790 | ERP013756 | PRJEB12296 | Baseline expression from transcriptional profiling of zebrafish developmental stages 2 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_2-sc-4029 | Transcriptome Analysis | Paired end sequence data from the IlluminaHiSeq was prepared from RNA of wild type zebrafish embryos at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 453 | ZMP phenotype 128 1 1 | SAMEA3714641 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 10|ENA last update:2015 12 16|External Id:SAMEA3714641|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 10T14:31:45Z|INSDC last update:2015 12 16T13:41:58Z|INSDC status:public|Submitter Id:e73ff240 a000 11e5 800b 68b59976a382|common name:zebrafish|sample description:3 prime end enriched mRNA from a single wild type zebrafish embryo from ZMP phenotype 128 clutch 1 collected at cleavage 2 cell stage plus ERCC spike mix 2 Ambion. A 8 base indexing sequence TGCGATCT is bases 13 to 20 of read 1 followed by CG and polyT.|sample name:e73ff240 a000 11e5 800b 68b59976a382|strain:mixed | Illumina HiSeq 2000 paired end sequencing | SC EXP 18730 4#1 | 15565944 | Illumina sequencing of library 15565944 constructed from sample accession ERS1021790 for study accession ERP013756. This is part of an Illumina multiplexed sequencing run 18730 4. This submission includes reads tagged with the sequence TGCGATCT. | Transcriptome counting qPCR only | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP013756 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2016 05 10|ENA LAST UPDATE:2018 11 16 | 18730_4#1.cram | cram | 869624210.0 | 6689417.0 | SC RUN 18730 4#1 | 0:55 1:75 | A:211816407;C:178380016;G:176641186;T:302714073;N:72528 | 55 | 75 | 211816407 | 178380016 | 176641186 | 302714073 | 72528 | ERX1481441 | ERS1021790 | ERA620320 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.26789 | 0.63129 | 0.0568 | 0.09239 | 0.95978 | 0.88978 | 0.82999 | 0.78005 | 55 | 75 | B | B | mate1-mate2 similar by mapping diff | illumina | hiseq_era | 3prime | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2015-12-16 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3788 | 3788 | ERR1442900 | ERX1513277 | ERS1079219 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 F | SAMEA3892085 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19912 2#70 | 16564972 | Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence GATCTCTT. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19912_2#70.cram | cram | 364410400.0 | 1822052.0 | SC RUN 19912 2#70 | 0:100 1:100 | A:96471898;C:85460940;G:85739185;T:96152266;N:586111 | 100 | 100 | 96471898 | 85460940 | 85739185 | 96152266 | 586111 | ERX1513277 | ERS1079219 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96377 | 0.96719 | 0.0976 | 0.09955 | 0.79667 | 0.79693 | 0.58832 | 0.58226 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3789 | 3789 | ERR1442899 | ERX1513276 | ERS1079218 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 E | SAMEA3892084 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19912 2#69 | 16564960 | Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence GGTGAGTT. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19912_2#69.cram | cram | 312144800.0 | 1560724.0 | SC RUN 19912 2#69 | 0:100 1:100 | A:82044388;C:74027006;G:73985684;T:81583681;N:504041 | 100 | 100 | 82044388 | 74027006 | 73985684 | 81583681 | 504041 | ERX1513276 | ERS1079218 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96275 | 0.9677 | 0.10631 | 0.10791 | 0.79496 | 0.79535 | 0.57643 | 0.57303 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3790 | 3790 | ERR1442898 | ERX1513275 | ERS1079217 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 D | SAMEA3892083 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19912 2#68 | 16564948 | Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TGCGTGAA. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19912_2#68.cram | cram | 330453000.0 | 1652265.0 | SC RUN 19912 2#68 | 0:100 1:100 | A:87696659;C:77248972;G:77394239;T:87578108;N:535022 | 100 | 100 | 87696659 | 77248972 | 77394239 | 87578108 | 535022 | ERX1513275 | ERS1079217 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96171 | 0.96419 | 0.10779 | 0.11047 | 0.79902 | 0.80018 | 0.57383 | 0.56925 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3791 | 3791 | ERR1442897 | ERX1513274 | ERS1079216 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 C | SAMEA3892082 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19912 2#67 | 16564936 | Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TACCACCA. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19912_2#67.cram | cram | 327261000.0 | 1636305.0 | SC RUN 19912 2#67 | 0:100 1:100 | A:87523901;C:75771535;G:75871608;T:87573282;N:520674 | 100 | 100 | 87523901 | 75771535 | 75871608 | 87573282 | 520674 | ERX1513274 | ERS1079216 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.95986 | 0.96354 | 0.1123 | 0.11468 | 0.80156 | 0.80229 | 0.58372 | 0.58338 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3792 | 3792 | ERR1442896 | ERX1513273 | ERS1079215 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 B | SAMEA3892081 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19912 2#66 | 16564924 | Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 2. This submission includes reads tagged with the sequence TGAAGCCA. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19912_2#66.cram | cram | 328496600.0 | 1642483.0 | SC RUN 19912 2#66 | 0:100 1:100 | A:86841947;C:77278436;G:77262516;T:86589805;N:523896 | 100 | 100 | 86841947 | 77278436 | 77262516 | 86589805 | 523896 | ERX1513273 | ERS1079215 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96091 | 0.96535 | 0.1279 | 0.13047 | 0.79805 | 0.79857 | 0.58551 | 0.58209 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3878 | 3878 | ERR1442810 | ERX1513187 | ERS1079219 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 F | SAMEA3892085 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19912 1#70 | 16564972 | Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence GATCTCTT. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19912_1#70.cram | cram | 364912600.0 | 1824563.0 | SC RUN 19912 1#70 | 0:100 1:100 | A:96642496;C:85588675;G:85883202;T:96301393;N:496834 | 100 | 100 | 96642496 | 85588675 | 85883202 | 96301393 | 496834 | ERX1513187 | ERS1079219 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96362 | 0.96689 | 0.09725 | 0.09882 | 0.79592 | 0.79703 | 0.59097 | 0.5784 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3879 | 3879 | ERR1442809 | ERX1513186 | ERS1079218 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 E | SAMEA3892084 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19912 1#69 | 16564960 | Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence GGTGAGTT. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19912_1#69.cram | cram | 312470400.0 | 1562352.0 | SC RUN 19912 1#69 | 0:100 1:100 | A:82160555;C:74100532;G:74069193;T:81696066;N:444054 | 100 | 100 | 82160555 | 74100532 | 74069193 | 81696066 | 444054 | ERX1513186 | ERS1079218 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96376 | 0.96859 | 0.10642 | 0.1079 | 0.79417 | 0.79474 | 0.5752 | 0.57 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3880 | 3880 | ERR1442808 | ERX1513185 | ERS1079217 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 D | SAMEA3892083 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19912 1#68 | 16564948 | Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TGCGTGAA. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19912_1#68.cram | cram | 330554000.0 | 1652770.0 | SC RUN 19912 1#68 | 0:100 1:100 | A:87747224;C:77298685;G:77439701;T:87616982;N:451408 | 100 | 100 | 87747224 | 77298685 | 77439701 | 87616982 | 451408 | ERX1513185 | ERS1079217 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96163 | 0.96436 | 0.10875 | 0.1111 | 0.79928 | 0.79965 | 0.57561 | 0.5708 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3881 | 3881 | ERR1442807 | ERX1513184 | ERS1079216 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 C | SAMEA3892082 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19912 1#67 | 16564936 | Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TACCACCA. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19912_1#67.cram | cram | 327019400.0 | 1635097.0 | SC RUN 19912 1#67 | 0:100 1:100 | A:87453957;C:75726607;G:75847551;T:87546870;N:444415 | 100 | 100 | 87453957 | 75726607 | 75847551 | 87546870 | 444415 | ERX1513184 | ERS1079216 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96147 | 0.9625 | 0.11258 | 0.11475 | 0.79825 | 0.79924 | 0.58372 | 0.56917 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3882 | 3882 | ERR1442806 | ERX1513183 | ERS1079215 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 B | SAMEA3892081 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19912 1#66 | 16564924 | Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19912 1. This submission includes reads tagged with the sequence TGAAGCCA. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19912_1#66.cram | cram | 327613800.0 | 1638069.0 | SC RUN 19912 1#66 | 0:100 1:100 | A:86594522;C:77121933;G:77114321;T:86338082;N:444942 | 100 | 100 | 86594522 | 77121933 | 77114321 | 86338082 | 444942 | ERX1513183 | ERS1079215 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.9614 | 0.96527 | 0.12823 | 0.13043 | 0.79762 | 0.79922 | 0.58597 | 0.5851 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3968 | 3968 | ERR1442720 | ERX1513097 | ERS1079219 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 F | SAMEA3892085 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19850 2#70 | 16564972 | Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence GATCTCTT. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19850_2#70.cram | cram | 371283800.0 | 1856419.0 | SC RUN 19850 2#70 | 0:100 1:100 | A:98443439;C:87187703;G:87417381;T:98100142;N:135135 | 100 | 100 | 98443439 | 87187703 | 87417381 | 98100142 | 135135 | ERX1513097 | ERS1079219 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96411 | 0.96451 | 0.09692 | 0.09902 | 0.79657 | 0.7964 | 0.58932 | 0.57779 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3969 | 3969 | ERR1442719 | ERX1513096 | ERS1079218 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 E | SAMEA3892084 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19850 2#69 | 16564960 | Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence GGTGAGTT. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19850_2#69.cram | cram | 318491400.0 | 1592457.0 | SC RUN 19850 2#69 | 0:100 1:100 | A:83845999;C:75642375;G:75561647;T:83330437;N:110942 | 100 | 100 | 83845999 | 75642375 | 75561647 | 83330437 | 110942 | ERX1513096 | ERS1079218 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96388 | 0.96834 | 0.10544 | 0.10741 | 0.79336 | 0.79417 | 0.57217 | 0.56939 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3970 | 3970 | ERR1442718 | ERX1513095 | ERS1079217 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 D | SAMEA3892083 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19850 2#68 | 16564948 | Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TGCGTGAA. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19850_2#68.cram | cram | 335548800.0 | 1677744.0 | SC RUN 19850 2#68 | 0:100 1:100 | A:89188408;C:78543202;G:78653253;T:89044211;N:119726 | 100 | 100 | 89188408 | 78543202 | 78653253 | 89044211 | 119726 | ERX1513095 | ERS1079217 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96211 | 0.96612 | 0.10777 | 0.11055 | 0.79724 | 0.79876 | 0.57249 | 0.43044 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3971 | 3971 | ERR1442717 | ERX1513094 | ERS1079216 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 C | SAMEA3892082 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19850 2#67 | 16564936 | Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TACCACCA. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19850_2#67.cram | cram | 331952200.0 | 1659761.0 | SC RUN 19850 2#67 | 0:100 1:100 | A:88872903;C:76957606;G:77065688;T:88935012;N:120991 | 100 | 100 | 88872903 | 76957606 | 77065688 | 88935012 | 120991 | ERX1513094 | ERS1079216 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96191 | 0.96393 | 0.11342 | 0.11468 | 0.799 | 0.79908 | 0.58219 | 0.58045 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 3972 | 3972 | ERR1442716 | ERX1513093 | ERS1079215 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 B | SAMEA3892081 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19850 2#66 | 16564924 | Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 2. This submission includes reads tagged with the sequence TGAAGCCA. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19850_2#66.cram | cram | 333024200.0 | 1665121.0 | SC RUN 19850 2#66 | 0:100 1:100 | A:88172616;C:78454066;G:78393792;T:87885914;N:117812 | 100 | 100 | 88172616 | 78454066 | 78393792 | 87885914 | 117812 | ERX1513093 | ERS1079215 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96249 | 0.96556 | 0.1289 | 0.13166 | 0.79945 | 0.79961 | 0.58336 | 0.58063 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 4058 | 4058 | ERR1442630 | ERX1513007 | ERS1079219 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 F | SAMEA3892085 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892085|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:07Z|INSDC status:public|Submitter Id:744149e0 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:744149e0 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19850 1#70 | 16564972 | Illumina sequencing of library 16564972 constructed from sample accession ERS1079219 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence GATCTCTT. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19850_1#70.cram | cram | 371578800.0 | 1857894.0 | SC RUN 19850 1#70 | 0:100 1:100 | A:98533022;C:87264222;G:87555118;T:98151909;N:74529 | 100 | 100 | 98533022 | 87264222 | 87555118 | 98151909 | 74529 | ERX1513007 | ERS1079219 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.9636 | 0.96761 | 0.09699 | 0.09916 | 0.79525 | 0.79553 | 0.58618 | 0.57988 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 4059 | 4059 | ERR1442629 | ERX1513006 | ERS1079218 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 E | SAMEA3892084 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892084|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74358a10 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74358a10 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19850 1#69 | 16564960 | Illumina sequencing of library 16564960 constructed from sample accession ERS1079218 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence GGTGAGTT. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19850_1#69.cram | cram | 318342200.0 | 1591711.0 | SC RUN 19850 1#69 | 0:100 1:100 | A:83801083;C:75621628;G:75578752;T:83271737;N:69000 | 100 | 100 | 83801083 | 75621628 | 75578752 | 83271737 | 69000 | ERX1513006 | ERS1079218 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96351 | 0.96877 | 0.10486 | 0.10713 | 0.79423 | 0.79444 | 0.57288 | 0.57375 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 4060 | 4060 | ERR1442628 | ERX1513005 | ERS1079217 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 D | SAMEA3892083 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892083|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:74295510 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74295510 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19850 1#68 | 16564948 | Illumina sequencing of library 16564948 constructed from sample accession ERS1079217 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TGCGTGAA. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19850_1#68.cram | cram | 334846000.0 | 1674230.0 | SC RUN 19850 1#68 | 0:100 1:100 | A:88989528;C:78413149;G:78541907;T:88833028;N:68388 | 100 | 100 | 88989528 | 78413149 | 78541907 | 88833028 | 68388 | ERX1513005 | ERS1079217 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96197 | 0.96681 | 0.10873 | 0.11111 | 0.79805 | 0.7992 | 0.57474 | 0.57198 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 4061 | 4061 | ERR1442627 | ERX1513004 | ERS1079216 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 C | SAMEA3892082 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892082|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:06Z|INSDC status:public|Submitter Id:741d9540 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:741d9540 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19850 1#67 | 16564936 | Illumina sequencing of library 16564936 constructed from sample accession ERS1079216 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TACCACCA. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19850_1#67.cram | cram | 332077800.0 | 1660389.0 | SC RUN 19850 1#67 | 0:100 1:100 | A:88958890;C:76946124;G:77079866;T:89022508;N:70412 | 100 | 100 | 88958890 | 76946124 | 77079866 | 89022508 | 70412 | ERX1513004 | ERS1079216 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96162 | 0.96369 | 0.11367 | 0.11586 | 0.7992 | 0.79855 | 0.58505 | 0.58088 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 4062 | 4062 | ERR1442626 | ERX1513003 | ERS1079215 | ERP014517 | PRJEB12982 | Baseline expression from transcriptional profiling of zebrafish developmental stages 3 | Baseline_expression_from_transcriptional_profiling_of_zebrafish_developmental_stages_3-sc-4130 | Transcriptome Analysis | RNA Seq data was generated from RNA of wild type zebrafish embryo pools at different stages of development for baseline transcriptional profiling | ArrayExpress:E ERAD 475 | ZMP phenotype 128 B | SAMEA3892081 | Wellcome Sanger Institute | ArrayExpress DevelopmentalStage:Cleavage:2 cell ZFS:0000002|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 06 06|ENA last update:2016 03 10|External Id:SAMEA3892081|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 06 06T15:24:12Z|INSDC last update:2016 03 10T13:38:05Z|INSDC status:public|Submitter Id:74118750 e60c 11e5 bc69 3c4a9275d6c6|common name:zebrafish|sample description:RNA from a pool of 12 single wild type zebrafish embryos plus ERCC spike mix 2 Ambion. The sample has been DNAse treated.|sample name:74118750 e60c 11e5 bc69 3c4a9275d6c6|strain:mixed | Illumina HiSeq 2500 paired end sequencing | SC EXP 19850 1#66 | 16564924 | Illumina sequencing of library 16564924 constructed from sample accession ERS1079215 for study accession ERP014517. This is part of an Illumina multiplexed sequencing run 19850 1. This submission includes reads tagged with the sequence TGAAGCCA. | RNA seq dUTP eukaryotic | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | ERP014517 | Illumina HiSeq 2500 paired end sequencing | ENA FIRST PUBLIC:2016 06 06|ENA LAST UPDATE:2018 11 16 | 19850_1#66.cram | cram | 332776400.0 | 1663882.0 | SC RUN 19850 1#66 | 0:100 1:100 | A:88108657;C:78400833;G:78371292;T:87823689;N:71929 | 100 | 100 | 88108657 | 78400833 | 78371292 | 87823689 | 71929 | ERX1513003 | ERS1079215 | ERA648700 | European Nucleotide Archive | Wellcome Sanger Institute | 2 | 0.96154 | 0.96535 | 0.12909 | 0.13161 | 0.79815 | 0.79959 | 0.58756 | 0.58417 | 100 | 100 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2016-03-10 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||
| 8055 | 8055 | ERR022484 | ERX008924 | ERS017427 | ERP000400 | PRJEB2333 | Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer | E-MTAB-434 | Other | E MTAB 434:ZF 2cells | SAMEA898400 | Wellcome Sanger Institute | Alias:E MTAB 434:ZF 2cells|Broker name:ArrayExpress|Description:Protocols: Zebrafish embyos or tissues were collected from a Tuebingen strain incross and grown at 28 C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were resuspended RNase free 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments. Total RNA was made into an RNAseq Illumina library following the manufacturer's protocol including a DNase treatment between to 2 rounds of polyA pull down. The libraries have fragment size of 250 to 300 bp.|DevelopmentalStage:embryo|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2011 03 10T17:55:05Z|INSDC last update:2018 03 08T15:25:14Z|INSDC status:public|SRA accession:ERS017427|Sample Name:ERS017427|Sex:mixed|StrainOrLine:Tuebingen|Title:ZF 2cells | Illumina Genome Analyzer II paired end sequencing; Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer | E MTAB 434:sequencing of Zebrafish embryo 2cells | RNA from Zebrafish embryo 2cells | Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer | Zebrafish embyos or tissues were collected from a Tuebingen strain incross and grown at 28 C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were resuspended RNase free 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments. Total RNA was made into an RNAseq Illumina library following the manufacturer's protocol including a DNase treatment between to 2 rounds of polyA pull down. The libraries have fragment size of 250 to 300 bp. | Experimental Factor: DEVELPOMENTAL STAGE:embryo|Experimental Factor: ORGANISM PART:cell | FL-cDNA | TRANSCRIPTOMIC | unspecified | PAIRED | ILLUMINA | Illumina Genome Analyzer II | ERP000400 | Illumina Genome Analyzer II paired end sequencing; Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer | ENA FIRST PUBLIC:2011 03 10|ENA LAST UPDATE:2018 11 16 | 4946_5.srf | srf | 3947547008.0 | 25970704.0 | E MTAB 434:4946 5.srf | 0:76 1:76 | A:1069302461;C:914233601;G:902631356;T:1055986090;N:5393500 | 76 | 76 | 1069302461 | 914233601 | 902631356 | 1055986090 | 5393500 | ERX008924 | ERS017427 | ERA015179 | SC|Wellcome Trust Sanger Institute | SC|Wellcome Trust Sanger Institute | 2 | 0.93356 | 0.93346 | 0.03988 | 0.04022 | 0.79135 | 0.79198 | 0.48864 | 0.48464 | 76 | 76 | B | B | biological fallback assumption | illumina | early_illumina | unknown | poly_a | unknown | bulk | unknown | unknown | United Kingdom | 2011-03-10 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||
| 9296 | 9296 | ERR202508 | ERX177193 | ERS092407 | ERP001280 | PRJEB2925 | maternal to Zygotic Transition | maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 | Transcriptome Analysis | During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing. | SAMEA1570569 | SC | ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:T/LF|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:29Z|External Id:SAMEA1570569|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:29Z|INSDC status:public|Submitter Id:2C TotRNA sc 2012 02 06T13:12:17Z 1121923|common name:zebrafish|sample description:RNA seq|sample name:2C TotRNA sc 2012 02 06T13:12:17Z 1121923|scientific name:Danio rerio|strain:T/LF | 1 | SC EXP 6683 2 | 2532385 | Illumina sequencing of library 2532385 constructed from sample accession ERS092407 for study accession ERP001280. | Illumina cDNA protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP001280 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 | 6683_2.bam | bam | 11463941550.0 | 76426277.0 | SC RUN 6683 2 | 0:75 1:75 | A:2384324967;C:3291391074;G:3291238330;T:2457078635;N:39908544 | 75 | 75 | 2384324967 | 3291391074 | 3291238330 | 2457078635 | 39908544 | ERX177193 | ERS092407 | ERA176708 | SC | Wellcome Sanger Institute | 2 | 0.96484 | 0.95918 | 0.35968 | 0.35526 | 0.88404 | 0.88485 | 0.84949 | 0.8524 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2012-11-28 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 9298 | 9298 | ERR202506 | ERX177191 | ERS092405 | ERP001280 | PRJEB2925 | maternal to Zygotic Transition | maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 | Transcriptome Analysis | During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing. | SAMEA1570534 | SC | ArrayExpress DevelopmentalStage:16 cell|ArrayExpress Genotype:T/LF|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:25Z|External Id:SAMEA1570534|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:25Z|INSDC status:public|Submitter Id:16C stan pro sc 2012 02 06T13:12:14Z 1121921|common name:zebrafish|sample description:RNA seq|sample name:16C stan pro sc 2012 02 06T13:12:14Z 1121921|scientific name:Danio rerio|strain:T/LF | 1 | SC EXP 6317 5 | 2532383 | Illumina sequencing of library 2532383 constructed from sample accession ERS092405 for study accession ERP001280. | Illumina cDNA protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | ERP001280 | Illumina HiSeq 2000 paired end sequencing | ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 | 6317_5.bam | bam | 7092438300.0 | 47282922.0 | SC RUN 6317 5 | 0:75 1:75 | A:1947926886;C:1582039071;G:1595096528;T:1959471222;N:7904593 | 75 | 75 | 1947926886 | 1582039071 | 1595096528 | 1959471222 | 7904593 | ERX177191 | ERS092405 | ERA176708 | SC | Wellcome Sanger Institute | 2 | 0.90801 | 0.90631 | 0.0426 | 0.04216 | 0.78486 | 0.78539 | 0.4795 | 0.47872 | 75 | 75 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2012-11-28 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 9301 | 9301 | ERR202503 | ERX177188 | ERS092094 | ERP001280 | PRJEB2925 | maternal to Zygotic Transition | maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 | Transcriptome Analysis | During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing. | SAMEA1570566 | SC | ArrayExpress DevelopmentalStage:64 cell|ArrayExpress Genotype:SAT/WIK|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:31Z|External Id:SAMEA1570566|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:31Z|INSDC status:public|Submitter Id:SAT b sc 2012 02 06T13:05:45Z 998060|common name:zebrafish|sample description:RNA seq|sample name:SAT b sc 2012 02 06T13:05:45Z 998060|scientific name:Danio rerio|strain:SAT | 1 | SC EXP 5552 6 | 1476240 | Illumina sequencing of library 1476240 constructed from sample accession ERS092094 for study accession ERP001280. | Illumina cDNA protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina Genome Analyzer II | ERP001280 | Illumina Genome Analyzer II paired end sequencing | ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 | 5552_6.bam | bam | 3031861428.0 | 28072791.0 | SC RUN 5552 6 | 0:54 1:54 | A:827548202;C:685397282;G:689217947;T:827560833;N:2137164 | 54 | 54 | 827548202 | 685397282 | 689217947 | 827560833 | 2137164 | ERX177188 | ERS092094 | ERA176708 | SC | Wellcome Sanger Institute | 2 | 0.88709 | 0.8867 | 0.04219 | 0.04381 | 0.76836 | 0.76978 | 0.48688 | 0.48607 | 54 | 54 | B | B | biological fallback assumption | illumina | early_illumina | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2012-11-28 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 9304 | 9304 | ERR202500 | ERX177185 | ERS092093 | ERP001280 | PRJEB2925 | maternal to Zygotic Transition | maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 | Transcriptome Analysis | During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing. | SAMEA1570541 | SC | ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:SAT/WIK|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:13Z|External Id:SAMEA1570541|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:13Z|INSDC status:public|Submitter Id:SAT a sc 2012 02 06T13:05:43Z 998059|common name:zebrafish|sample description:RNA seq|sample name:SAT a sc 2012 02 06T13:05:43Z 998059|scientific name:Danio rerio|strain:SAT | 1 | SC EXP 5540 7 | 1392795 | Illumina sequencing of library 1392795 constructed from sample accession ERS092093 for study accession ERP001280. | Illumina cDNA protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina Genome Analyzer II | ERP001280 | Illumina Genome Analyzer II paired end sequencing | ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 | 5540_7.bam | bam | 4139896608.0 | 38332376.0 | SC RUN 5540 7 | 0:54 1:54 | A:1123995667;C:935834208;G:933659183;T:1138309303;N:8098247 | 54 | 54 | 1123995667 | 935834208 | 933659183 | 1138309303 | 8098247 | ERX177185 | ERS092093 | ERA176708 | SC | Wellcome Sanger Institute | 2 | 0.89473 | 0.89261 | 0.0475 | 0.0496 | 0.80413 | 0.80551 | 0.49672 | 0.49064 | 54 | 54 | B | B | biological fallback assumption | illumina | early_illumina | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2012-11-28 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 9308 | 9308 | ERR202496 | ERX177181 | ERS092089 | ERP001280 | PRJEB2925 | maternal to Zygotic Transition | maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 | Transcriptome Analysis | During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing. | SAMEA1570537 | SC | ArrayExpress DevelopmentalStage:64 cell|ArrayExpress Genotype:WIK/SAT|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:15Z|External Id:SAMEA1570537|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:15Z|INSDC status:public|Submitter Id:WIK b sc 2012 02 06T13:05:39Z 998055|common name:zebrafish|sample description:RNA seq|sample name:WIK b sc 2012 02 06T13:05:39Z 998055|scientific name:Danio rerio|strain:WIK | 1 | SC EXP 5540 2 | 1392791 | Illumina sequencing of library 1392791 constructed from sample accession ERS092089 for study accession ERP001280. | Illumina cDNA protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina Genome Analyzer II | ERP001280 | Illumina Genome Analyzer II paired end sequencing | ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 | 5540_2.bam | bam | 3934066536.0 | 36426542.0 | SC RUN 5540 2 | 0:54 1:54 | A:1089272408;C:875257818;G:871131618;T:1090449345;N:7955347 | 54 | 54 | 1089272408 | 875257818 | 871131618 | 1090449345 | 7955347 | ERX177181 | ERS092089 | ERA176708 | SC | Wellcome Sanger Institute | 2 | 0.92002 | 0.92014 | 0.04875 | 0.05104 | 0.76061 | 0.76161 | 0.4821 | 0.48296 | 54 | 54 | B | B | biological fallback assumption | illumina | early_illumina | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2012-11-28 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 9309 | 9309 | ERR202495 | ERX177180 | ERS092088 | ERP001280 | PRJEB2925 | maternal to Zygotic Transition | maternal_to_Zygotic_Transition-sc-2012-03-12T11:38:43Z-599 | Transcriptome Analysis | During early stages of embryonic development the genome is transcriptionally inactive and cells are under the control of maternally provided mRNA and proteins. At a key point in development known as the maternal to zygotic transition MZT the genome becomes activated and the maternally provided mRNAs begin to degrade. We plan to map the mRNA profiles of genes during the maternal to zygotic transition by using solexa sequencing. | SAMEA1570572 | SC | ArrayExpress DevelopmentalStage:2 cell|ArrayExpress Genotype:WIK/SAT|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Phenotype:WT|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2012 11 28T14:59:05Z|ENA LAST UPDATE:2018 03 08T15:36:31Z|External Id:SAMEA1570572|INSDC center name:SC|INSDC first public:2012 11 28T14:59:05Z|INSDC last update:2018 03 08T15:36:31Z|INSDC status:public|Submitter Id:WIK a sc 2012 02 06T13:05:37Z 998054|common name:zebrafish|sample description:RNA seq|sample name:WIK a sc 2012 02 06T13:05:37Z 998054|scientific name:Danio rerio|strain:WIK | 1 | SC EXP 5540 1 | 1392790 | Illumina sequencing of library 1392790 constructed from sample accession ERS092088 for study accession ERP001280. | Illumina cDNA protocol | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina Genome Analyzer II | ERP001280 | Illumina Genome Analyzer II paired end sequencing | ENA FIRST PUBLIC:2012 11 28|ENA LAST UPDATE:2018 11 16 | 5540_1.bam | bam | 4120158204.0 | 38149613.0 | SC RUN 5540 1 | 0:54 1:54 | A:1165514767;C:896704109;G:892695229;T:1156428740;N:8815359 | 54 | 54 | 1165514767 | 896704109 | 892695229 | 1156428740 | 8815359 | ERX177180 | ERS092088 | ERA176708 | SC | Wellcome Sanger Institute | 2 | 0.9228 | 0.92241 | 0.05498 | 0.05795 | 0.79091 | 0.79235 | 0.50034 | 0.50151 | 54 | 54 | B | B | biological fallback assumption | illumina | early_illumina | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | United Kingdom | 2012-11-28 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||
| 28560 | 28560 | SRR26395034 | SRX22100899 | SRS19166025 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep8 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 8|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate8 | DR 035 | DR 035 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-8_1.fq.gz C64-8_2.fq.gz | fastq fastq | 13755975120.0 | 50948056.0 | C64 8 1.fq.gz | 0:135 1:135 | A:3658420874;C:3226727105;G:3239474262;T:3628930832;N:2422047 | 135 | 135 | 3658420874 | 3226727105 | 3239474262 | 3628930832 | 2422047 | SRX22100899 | SRS19166025 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.92463 | 0.92386 | 0.0253 | 0.02389 | 0.77441 | 0.77851 | 0.48196 | 0.47927 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28561 | 28561 | SRR26395035 | SRX22100898 | SRS19166024 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep7 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 7|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate7 | DR 034 | DR 034 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-7_1.fq.gz C64-7_2.fq.gz | fastq fastq | 14250954780.0 | 52781314.0 | C64 7 1.fq.gz | 0:135 1:135 | A:3810945650;C:3320623800;G:3339892194;T:3776960886;N:2532250 | 135 | 135 | 3810945650 | 3320623800 | 3339892194 | 3776960886 | 2532250 | SRX22100898 | SRS19166024 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.93734 | 0.93685 | 0.02705 | 0.02576 | 0.77553 | 0.7791 | 0.47481 | 0.47745 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28562 | 28562 | SRR26395036 | SRX22100897 | SRS19166023 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep6 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 6|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate6 | DR 033 | DR 033 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-6_1.fq.gz C64-6_2.fq.gz | fastq fastq | 14251193190.0 | 52782197.0 | C64 6 1.fq.gz | 0:135 1:135 | A:3801408063;C:3332053069;G:3345233238;T:3769986735;N:2512085 | 135 | 135 | 3801408063 | 3332053069 | 3345233238 | 3769986735 | 2512085 | SRX22100897 | SRS19166023 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.94348 | 0.94342 | 0.02571 | 0.02414 | 0.77112 | 0.77492 | 0.48218 | 0.4777 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28563 | 28563 | SRR26395037 | SRX22100896 | SRS19166022 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep5 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 5|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate5 | DR 032 | DR 032 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-5_1.fq.gz C64-5_2.fq.gz | fastq fastq | 15142948650.0 | 56084995.0 | C64 5 1.fq.gz | 0:135 1:135 | A:4031434744;C:3549307228;G:3562636129;T:3996868396;N:2702153 | 135 | 135 | 4031434744 | 3549307228 | 3562636129 | 3996868396 | 2702153 | SRX22100896 | SRS19166022 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.93753 | 0.93663 | 0.02519 | 0.024 | 0.77301 | 0.77674 | 0.47421 | 0.46951 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28564 | 28564 | SRR26395038 | SRX22100895 | SRS19166021 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep4 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 4|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate4 | DR 031 | DR 031 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-4_1.fq.gz C64-4_2.fq.gz | fastq fastq | 14488466220.0 | 53660986.0 | C64 4 1.fq.gz | 0:135 1:135 | A:3863267905;C:3389148218;G:3402037749;T:3831469669;N:2542679 | 135 | 135 | 3863267905 | 3389148218 | 3402037749 | 3831469669 | 2542679 | SRX22100895 | SRS19166021 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.93879 | 0.93825 | 0.02613 | 0.02437 | 0.77212 | 0.77577 | 0.47796 | 0.47196 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28566 | 28566 | SRR26395040 | SRX22100893 | SRS19166019 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep3 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 3|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate3 | DR 030 | DR 030 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-3_1.fq.gz C64-3_2.fq.gz | fastq fastq | 16017940620.0 | 59325706.0 | C64 3 1.fq.gz | 0:135 1:135 | A:4273558549;C:3744205640;G:3760255830;T:4237074764;N:2845837 | 135 | 135 | 4273558549 | 3744205640 | 3760255830 | 4237074764 | 2845837 | SRX22100893 | SRS19166019 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.93688 | 0.9383 | 0.02702 | 0.02595 | 0.77433 | 0.7767 | 0.47319 | 0.47413 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28567 | 28567 | SRR26395041 | SRX22100892 | SRS19166018 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep2 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 2|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate2 | DR 029 | DR 029 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-2_1.fq.gz C64-2_2.fq.gz | fastq fastq | 16732836630.0 | 61973469.0 | C64 2 1.fq.gz | 0:135 1:135 | A:4451249064;C:3924735460;G:3940154978;T:4413679398;N:3017730 | 135 | 135 | 4451249064 | 3924735460 | 3940154978 | 4413679398 | 3017730 | SRX22100892 | SRS19166018 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.94302 | 0.94257 | 0.02459 | 0.02333 | 0.77248 | 0.77479 | 0.47902 | 0.47678 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 28568 | 28568 | SRR26395042 | SRX22100891 | SRS19166017 | SRP466518 | PRJNA1028258 | Zygotic activation of transposable elements during zebrafish early embryogenesis | PRJNA1028258 | Other | Here we leverage high quality long reads plus manual annotation to establish a high resolution landscape of TE activation and transcription at the levels of locus transcript and allele over zebrafish early embryonic development. Moreover we reveal a previously unknown temporal trajectory and subcellular distribution of zygotic TE activation ZTA in zebrafish where extensive variation exists among TE families subfamilies loci transcripts and alleles with respect to evolutionary age. | pubmed:40246845 | 64 cell RNA seq rep1 | strain:AB x India|age:2 hpf|dev stage:64 cell|collection date:2018 12|geo loc name:China:Beijing|sex:N/A|tissue:embryo|source material identifier:SR 64 1|BioSampleModel:Model organism or animal | Illumina RNA seq of zebrafish: 64 cell replicate1 | DR 028 | DR 028 | mRNA from five stages fertilized egg 1 cell 64 cell 1k cell and shield was extracted with Dynabeads@ mRNA Purification Kit Ambion and subjected to TURBOTM DNase lnvitrogen treatment. RNA Seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina NEB USA and then sequenced at 275 bp paired end mode on an Illumina HiSeq X Ten system with 8 replicates for each stage. | RNA-Seq | TRANSCRIPTOMIC | Oligo-dT | PAIRED | ILLUMINA | HiSeq X Ten | SRP466518 | C64-1_1.fq.gz C64-1_2.fq.gz | fastq fastq | 16459047450.0 | 60959435.0 | C64 1 1.fq.gz | 0:135 1:135 | A:4391773658;C:3847087464;G:3866793612;T:4350489494;N:2903222 | 135 | 135 | 4391773658 | 3847087464 | 3866793612 | 4350489494 | 2903222 | SRX22100891 | SRS19166017 | SRA1731898 | University of Michigan|Computational Medicine and Bioinformatics | University of Michigan | 2 | 0.94676 | 0.94707 | 0.02568 | 0.0244 | 0.77236 | 0.77593 | 0.48374 | 0.47691 | 135 | 135 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | nebnext | bulk | unknown | unknown | United States | 2023-10-16 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 29229 | 29229 | SRR27489746 | SRX23160963 | SRS20111121 | SRP483112 | PRJNA1056276 | five prime UTR MPRA during early zebrafish embryogenesis | PRJNA1056276 | Other | The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter. | polysome fraction | HMW fraction 2hpf replica C | MPRA repC fractions 8 9 2hpf | strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:36|replicate:replicate C|BioSampleModel:Model organism or animal | HMW fraction 2hpf replica C | Library 36 | Library 36 | Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing. | OTHER | TRANSCRIPTOMIC | RT-PCR | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483112 | BSSE_QGF_206671_HGWLYDSX3_3_MPRA_repC_fractions_8_9_2hpf_ATATGGAT_CTGTATTA_S36_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206671_HGWLYDSX3_3_MPRA_repC_fractions_8_9_2hpf_ATATGGAT_CTGTATTA_S36_L003_R2_001_MM_1.fastq.gz | fastq fastq | 13085558528.0 | 43329664.0 | BSSE QGF 206671 HGWLYDSX3 3 MPRA repC fractions 8 9 2hpf ATATGGAT CTGTATTA S36 L003 R1 001 MM 1.fastq.gz | 0:151 1:151 | A:3305413622;C:3391845548;G:3249932870;T:3137708503;N:657985 | 151 | 151 | 3305413622 | 3391845548 | 3249932870 | 3137708503 | 657985 | SRX23160963 | SRS20111121 | SRA1775336 | University of Basel|Biozentrum Basel | University of Basel | 2 | 0.01098 | 8e-05 | 0.00025 | 0.0 | 0.99216 | 0.99973 | 0.4317 | 0.61538 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | novaseq_era | 5prime | other | unknown | bulk | unknown | unknown | Switzerland | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 29230 | 29230 | SRR27489747 | SRX23160962 | SRS20111119 | SRP483112 | PRJNA1056276 | five prime UTR MPRA during early zebrafish embryogenesis | PRJNA1056276 | Other | The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter. | polysome fraction | LMW fraction 2hpf replica C | MPRA repC fractions 6 7 2hpf | strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:35|replicate:replicate C|BioSampleModel:Model organism or animal | LMW fraction 2hpf replica C | Library 35 | Library 35 | Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing. | OTHER | TRANSCRIPTOMIC | RT-PCR | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483112 | BSSE_QGF_206670_HGWLYDSX3_3_MPRA_repC_fractions_6_7_2hpf_CGGACAAC_TCCGGATT_S35_L003_R2_001_MM_1.fastq.gz BSSE_QGF_206670_HGWLYDSX3_3_MPRA_repC_fractions_6_7_2hpf_CGGACAAC_TCCGGATT_S35_L003_R1_001_MM_1.fastq.gz | fastq fastq | 16647721914.0 | 55124907.0 | BSSE QGF 206670 HGWLYDSX3 3 MPRA repC fractions 6 7 2hpf CGGACAAC TCCGGATT S35 L003 R1 001 MM 1.fastq.gz | 0:151 1:151 | A:4231542934;C:4348688006;G:4050131444;T:4016534422;N:825108 | 151 | 151 | 4231542934 | 4348688006 | 4050131444 | 4016534422 | 825108 | SRX23160962 | SRS20111119 | SRA1775336 | University of Basel|Biozentrum Basel | University of Basel | 2 | 0.01514 | 0.00017 | 0.00035 | 3e-05 | 0.99109 | 0.99955 | 0.4372 | 0.30434 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | novaseq_era | 5prime | other | unknown | bulk | unknown | unknown | Switzerland | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 29231 | 29231 | SRR27489748 | SRX23160961 | SRS20111118 | SRP483112 | PRJNA1056276 | five prime UTR MPRA during early zebrafish embryogenesis | PRJNA1056276 | Other | The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter. | polysome fraction | 80S fraction 2hpf replica C | MPRA repC fractions 4 5 2hpf | strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:34|replicate:replicate C|BioSampleModel:Model organism or animal | 80S fraction 2hpf replica C | Library 34 | Library 34 | Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing. | OTHER | TRANSCRIPTOMIC | RT-PCR | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483112 | BSSE_QGF_206669_HGWLYDSX3_3_MPRA_repC_fractions_4_5_2hpf_TAAGTGGT_CTTAAGCC_S34_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206669_HGWLYDSX3_3_MPRA_repC_fractions_4_5_2hpf_TAAGTGGT_CTTAAGCC_S34_L003_R2_001_MM_1.fastq.gz | fastq fastq | 15431181052.0 | 51096626.0 | BSSE QGF 206669 HGWLYDSX3 3 MPRA repC fractions 4 5 2hpf TAAGTGGT CTTAAGCC S34 L003 R1 001 MM 1.fastq.gz | 0:151 1:151 | A:3856018869;C:4036338306;G:3877988553;T:3660059325;N:775999 | 151 | 151 | 3856018869 | 4036338306 | 3877988553 | 3660059325 | 775999 | SRX23160961 | SRS20111118 | SRA1775336 | University of Basel|Biozentrum Basel | University of Basel | 2 | 0.01114 | 8e-05 | 0.00028 | 0.0 | 0.99192 | 0.99975 | 0.42956 | 0.5 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | novaseq_era | 5prime | other | unknown | bulk | unknown | unknown | Switzerland | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 29232 | 29232 | SRR27489749 | SRX23160960 | SRS20111117 | SRP483112 | PRJNA1056276 | five prime UTR MPRA during early zebrafish embryogenesis | PRJNA1056276 | Other | The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter. | input sample | Total 2hpf replica C | MPRA repC input 2hpf | strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:33|replicate:replicate C|BioSampleModel:Model organism or animal | Total 2hpf replica C | Library 33 | Library 33 | Total RNA was extracted from input sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing. | OTHER | TRANSCRIPTOMIC | RT-PCR | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483112 | BSSE_QGF_206668_HGWLYDSX3_3_MPRA_repC_input_2hpf_CTACGACA_GAGTCCAA_S33_L003_R2_001_MM_1.fastq.gz BSSE_QGF_206668_HGWLYDSX3_3_MPRA_repC_input_2hpf_CTACGACA_GAGTCCAA_S33_L003_R1_001_MM_1.fastq.gz | fastq fastq | 11771229160.0 | 38977580.0 | BSSE QGF 206668 HGWLYDSX3 3 MPRA repC input 2hpf CTACGACA GAGTCCAA S33 L003 R1 001 MM 1.fastq.gz | 0:151 1:151 | A:2999574420;C:3115525474;G:2806539264;T:2849003922;N:586080 | 151 | 151 | 2999574420 | 3115525474 | 2806539264 | 2849003922 | 586080 | SRX23160960 | SRS20111117 | SRA1775336 | University of Basel|Biozentrum Basel | University of Basel | 2 | 0.01997 | 2e-05 | 0.00054 | 0.0 | 0.99022 | 0.99993 | 0.41853 | 0.33333 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | novaseq_era | 5prime | other | unknown | bulk | unknown | unknown | Switzerland | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 29235 | 29235 | SRR27489752 | SRX23160957 | SRS20111114 | SRP483112 | PRJNA1056276 | five prime UTR MPRA during early zebrafish embryogenesis | PRJNA1056276 | Other | The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter. | polysome fraction | HMW fraction 2hpf replica A | MPRA repA fractions 8 9 2hpf | strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:4|replicate:replicate A|BioSampleModel:Model organism or animal | HMW fraction 2hpf replica A | Library 4 | Library 4 | Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing. | OTHER | TRANSCRIPTOMIC | RT-PCR | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483112 | BSSE_QGF_206639_HGWLYDSX3_3_MPRA_repA_fractions_8_9_2hpf_GCTTGTCA_GAACATAC_S4_L003_R2_001_MM_1.fastq.gz BSSE_QGF_206639_HGWLYDSX3_3_MPRA_repA_fractions_8_9_2hpf_GCTTGTCA_GAACATAC_S4_L003_R1_001_MM_1.fastq.gz | fastq fastq | 12108626278.0 | 40094789.0 | BSSE QGF 206639 HGWLYDSX3 3 MPRA repA fractions 8 9 2hpf GCTTGTCA GAACATAC S4 L003 R1 001 MM 1.fastq.gz | 0:151 1:151 | A:3079403604;C:3149095123;G:2953175005;T:2926352278;N:600268 | 151 | 151 | 3079403604 | 3149095123 | 2953175005 | 2926352278 | 600268 | SRX23160957 | SRS20111114 | SRA1775336 | University of Basel|Biozentrum Basel | University of Basel | 2 | 0.014 | 5e-05 | 0.00032 | 0.0 | 0.99137 | 0.99987 | 0.45127 | 0.28571 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | novaseq_era | 5prime | other | unknown | bulk | unknown | unknown | Switzerland | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 29246 | 29246 | SRR27489763 | SRX23160946 | SRS20111108 | SRP483112 | PRJNA1056276 | five prime UTR MPRA during early zebrafish embryogenesis | PRJNA1056276 | Other | The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter. | polysome fraction | LMW fraction 2hpf replica A | MPRA repA fractions 6 7 2hpf | strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:3|replicate:replicate A|BioSampleModel:Model organism or animal | LMW fraction 2hpf replica A | Library 3 | Library 3 | Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing. | OTHER | TRANSCRIPTOMIC | RT-PCR | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483112 | BSSE_QGF_206638_HGWLYDSX3_3_MPRA_repA_fractions_6_7_2hpf_ATCCACTG_AGGTGCGT_S3_L003_R2_001_MM_1.fastq.gz BSSE_QGF_206638_HGWLYDSX3_3_MPRA_repA_fractions_6_7_2hpf_ATCCACTG_AGGTGCGT_S3_L003_R1_001_MM_1.fastq.gz | fastq fastq | 12524202136.0 | 41470868.0 | BSSE QGF 206638 HGWLYDSX3 3 MPRA repA fractions 6 7 2hpf ATCCACTG AGGTGCGT S3 L003 R1 001 MM 1.fastq.gz | 0:151 1:151 | A:3168466372;C:3269998328;G:3075956662;T:3009160932;N:619842 | 151 | 151 | 3168466372 | 3269998328 | 3075956662 | 3009160932 | 619842 | SRX23160946 | SRS20111108 | SRA1775336 | University of Basel|Biozentrum Basel | University of Basel | 2 | 0.01351 | 7e-05 | 0.00028 | 0.0 | 0.99168 | 0.99977 | 0.43472 | 0.54545 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | novaseq_era | 5prime | other | unknown | bulk | unknown | unknown | Switzerland | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 29247 | 29247 | SRR27489764 | SRX23160945 | SRS20111103 | SRP483112 | PRJNA1056276 | five prime UTR MPRA during early zebrafish embryogenesis | PRJNA1056276 | Other | The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter. | polysome fraction | HMW fraction 2hpf replica B | MPRA repB fractions 8 9 2hpf | strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:20|replicate:replicate B|BioSampleModel:Model organism or animal | HMW fraction 2hpf replica B | Library 20 | Library 20 | Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing. | OTHER | TRANSCRIPTOMIC | RT-PCR | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483112 | BSSE_QGF_206655_HGWLYDSX3_3_MPRA_repB_fractions_8_9_2hpf_AACGTTCC_GGAGTACT_S20_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206655_HGWLYDSX3_3_MPRA_repB_fractions_8_9_2hpf_AACGTTCC_GGAGTACT_S20_L003_R2_001_MM_1.fastq.gz | fastq fastq | 12514444214.0 | 41438557.0 | BSSE QGF 206655 HGWLYDSX3 3 MPRA repB fractions 8 9 2hpf AACGTTCC GGAGTACT S20 L003 R1 001 MM 1.fastq.gz | 0:151 1:151 | A:3174354240;C:3246812350;G:3082021359;T:3010633962;N:622303 | 151 | 151 | 3174354240 | 3246812350 | 3082021359 | 3010633962 | 622303 | SRX23160945 | SRS20111103 | SRA1775336 | University of Basel|Biozentrum Basel | University of Basel | 2 | 0.01121 | 0.00016 | 0.00027 | 1e-05 | 0.99204 | 0.99953 | 0.43533 | 0.5 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | novaseq_era | 5prime | other | unknown | bulk | unknown | unknown | Switzerland | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 29248 | 29248 | SRR27489765 | SRX23160944 | SRS20111102 | SRP483112 | PRJNA1056276 | five prime UTR MPRA during early zebrafish embryogenesis | PRJNA1056276 | Other | The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter. | polysome fraction | LMW fraction 2hpf replica B | MPRA repB fractions 6 7 2hpf | strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:19|replicate:replicate B|BioSampleModel:Model organism or animal | LMW fraction 2hpf replica B | Library 19 | Library 19 | Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing. | OTHER | TRANSCRIPTOMIC | RT-PCR | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483112 | BSSE_QGF_206654_HGWLYDSX3_3_MPRA_repB_fractions_6_7_2hpf_GGTACCTT_AAGACGTC_S19_L003_R2_001_MM_1.fastq.gz BSSE_QGF_206654_HGWLYDSX3_3_MPRA_repB_fractions_6_7_2hpf_GGTACCTT_AAGACGTC_S19_L003_R1_001_MM_1.fastq.gz | fastq fastq | 16535129670.0 | 54752085.0 | BSSE QGF 206654 HGWLYDSX3 3 MPRA repB fractions 6 7 2hpf GGTACCTT AAGACGTC S19 L003 R1 001 MM 1.fastq.gz | 0:151 1:151 | A:4184643114;C:4312135767;G:4051628900;T:3985895468;N:826421 | 151 | 151 | 4184643114 | 4312135767 | 4051628900 | 3985895468 | 826421 | SRX23160944 | SRS20111102 | SRA1775336 | University of Basel|Biozentrum Basel | University of Basel | 2 | 0.01416 | 0.00017 | 0.00031 | 1e-05 | 0.9917 | 0.99941 | 0.40732 | 0.6 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | novaseq_era | 5prime | other | unknown | bulk | unknown | unknown | Switzerland | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 29249 | 29249 | SRR27489766 | SRX23160943 | SRS20111101 | SRP483112 | PRJNA1056276 | five prime UTR MPRA during early zebrafish embryogenesis | PRJNA1056276 | Other | The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter. | polysome fraction | 80S fraction 2hpf replica B | MPRA repB fractions 4 5 2hpf | strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:18|replicate:replicate B|BioSampleModel:Model organism or animal | 80S fraction 2hpf replica B | Library 18 | Library 18 | Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing. | OTHER | TRANSCRIPTOMIC | RT-PCR | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483112 | BSSE_QGF_206653_HGWLYDSX3_3_MPRA_repB_fractions_4_5_2hpf_GCACGGAC_GTCTCGCA_S18_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206653_HGWLYDSX3_3_MPRA_repB_fractions_4_5_2hpf_GCACGGAC_GTCTCGCA_S18_L003_R2_001_MM_1.fastq.gz | fastq fastq | 12692870042.0 | 42029371.0 | BSSE QGF 206653 HGWLYDSX3 3 MPRA repB fractions 4 5 2hpf GCACGGAC GTCTCGCA S18 L003 R1 001 MM 1.fastq.gz | 0:151 1:151 | A:3179006274;C:3325152682;G:3173386021;T:3014687781;N:637284 | 151 | 151 | 3179006274 | 3325152682 | 3173386021 | 3014687781 | 637284 | SRX23160943 | SRS20111101 | SRA1775336 | University of Basel|Biozentrum Basel | University of Basel | 2 | 0.01199 | 8e-05 | 0.0003 | 1e-05 | 0.99145 | 0.99979 | 0.40897 | 0.36363 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | novaseq_era | 5prime | other | unknown | bulk | unknown | unknown | Switzerland | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 29250 | 29250 | SRR27489767 | SRX23160942 | SRS20111100 | SRP483112 | PRJNA1056276 | five prime UTR MPRA during early zebrafish embryogenesis | PRJNA1056276 | Other | The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter. | input sample | Total 2hpf replica B | MPRA repB input 2hpf | strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:17|replicate:replicate B|BioSampleModel:Model organism or animal | Total 2hpf replica B | Library 17 | Library 17 | Total RNA was extracted from input sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing. | OTHER | TRANSCRIPTOMIC | RT-PCR | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483112 | BSSE_QGF_206652_HGWLYDSX3_3_MPRA_repB_input_2hpf_ATGTAAGT_ACTCTATG_S17_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206652_HGWLYDSX3_3_MPRA_repB_input_2hpf_ATGTAAGT_ACTCTATG_S17_L003_R2_001_MM_1.fastq.gz | fastq fastq | 13169436008.0 | 43607404.0 | BSSE QGF 206652 HGWLYDSX3 3 MPRA repB input 2hpf ATGTAAGT ACTCTATG S17 L003 R1 001 MM 1.fastq.gz | 0:151 1:151 | A:3341908647;C:3485072739;G:3171200836;T:3170595031;N:658755 | 151 | 151 | 3341908647 | 3485072739 | 3171200836 | 3170595031 | 658755 | SRX23160942 | SRS20111100 | SRA1775336 | University of Basel|Biozentrum Basel | University of Basel | 2 | 0.01868 | 5e-05 | 0.0006 | 0.0 | 0.99038 | 0.99983 | 0.41955 | 0.125 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | novaseq_era | 5prime | other | unknown | bulk | unknown | unknown | Switzerland | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 29257 | 29257 | SRR27489774 | SRX23160935 | SRS20111093 | SRP483112 | PRJNA1056276 | five prime UTR MPRA during early zebrafish embryogenesis | PRJNA1056276 | Other | The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter. | polysome fraction | 80S fraction 2hpf replica A | MPRA repA fractions 4 5 2hpf | strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:2|replicate:replicate A|BioSampleModel:Model organism or animal | 80S fraction 2hpf replica A | Library 2 | Library 2 | Total RNA was extracted from polysome fractionated sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing. | OTHER | TRANSCRIPTOMIC | RT-PCR | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483112 | BSSE_QGF_206637_HGWLYDSX3_3_MPRA_repA_fractions_4_5_2hpf_TTGGACTT_TATGAGTA_S2_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206637_HGWLYDSX3_3_MPRA_repA_fractions_4_5_2hpf_TTGGACTT_TATGAGTA_S2_L003_R2_001_MM_1.fastq.gz | fastq fastq | 16111078182.0 | 53347941.0 | BSSE QGF 206637 HGWLYDSX3 3 MPRA repA fractions 4 5 2hpf TTGGACTT TATGAGTA S2 L003 R1 001 MM 1.fastq.gz | 0:151 1:151 | A:4069536779;C:4222816450;G:3957789955;T:3860129964;N:805034 | 151 | 151 | 4069536779 | 4222816450 | 3957789955 | 3860129964 | 805034 | SRX23160935 | SRS20111093 | SRA1775336 | University of Basel|Biozentrum Basel | University of Basel | 2 | 0.01511 | 5e-05 | 0.00034 | 0.0 | 0.99135 | 0.99985 | 0.41564 | 0.42857 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | novaseq_era | 5prime | other | unknown | bulk | unknown | unknown | Switzerland | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 29258 | 29258 | SRR27489775 | SRX23160934 | SRS20111092 | SRP483112 | PRJNA1056276 | five prime UTR MPRA during early zebrafish embryogenesis | PRJNA1056276 | Other | The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter. | input sample | Total 2hpf replica A | MPRA repA input 2hpf | strain:TLAB|age:2 hpf|dev stage:64 cells|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:whole embryo|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:WT|growth protocol:E3 buffer standard conditions|sample type:100 embryos|sample number:1|replicate:replicate A|BioSampleModel:Model organism or animal | Total 2hpf replica A | Library 1 | Library 1 | Total RNA was extracted from input sample RT was performed with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing. | OTHER | TRANSCRIPTOMIC | RT-PCR | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP483112 | BSSE_QGF_206636_HGWLYDSX3_3_MPRA_repA_input_2hpf_GGACTTGG_CGCAGACG_S1_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206636_HGWLYDSX3_3_MPRA_repA_input_2hpf_GGACTTGG_CGCAGACG_S1_L003_R2_001_MM_1.fastq.gz | fastq fastq | 9769305890.0 | 32348695.0 | BSSE QGF 206636 HGWLYDSX3 3 MPRA repA input 2hpf GGACTTGG CGCAGACG S1 L003 R1 001 MM 1.fastq.gz | 0:151 1:151 | A:2477269774;C:2598109179;G:2338444856;T:2354997596;N:484485 | 151 | 151 | 2477269774 | 2598109179 | 2338444856 | 2354997596 | 484485 | SRX23160934 | SRS20111092 | SRA1775336 | University of Basel|Biozentrum Basel | University of Basel | 2 | 0.0205 | 4e-05 | 0.00059 | 0.0 | 0.99013 | 0.99987 | 0.41957 | 0.33333 | 151 | 151 | T | T | mates < 9% mapping rate | illumina | novaseq_era | 5prime | other | unknown | bulk | unknown | unknown | Switzerland | 2024-01-11 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||
| 31528 | 31528 | SRR28423881 | SRX24027916 | SRS20821688 | SRP497294 | PRJNA1090898 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169 | GSE262247 | Transcriptome Analysis | The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq. | parent bioproject:PRJNA1090894 | pubmed:39271818 | ventricular cells myd88 / 24 hpci | GSM8161054 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing | ventricular cells myd88 / 24 hpci | Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs | cardiac ventricles | cardiac cryoinjury 24 hours prior to heart extraction | Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury | GSM8161054 | GSM8161054: ventricular cells myd88 / 24 hpci; Danio rerio; RNA Seq | GSM8161054 r1 | GSM8161054 | 1 | Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121. | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 2000 | SRP497294 | Pinelopi_10x_Zebrafish_Mut_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_Mut_Lib_R2.fastq.gz | fastq fastq | 31356990530.0 | 394538049.0 | GSM8161054 r1 | 0:28 1:51.48 | A:8573180857;C:6884590114;G:7520784498;T:8220228225;N:158206836 | 28 | 51 | 8573180857 | 6884590114 | 7520784498 | 8220228225 | 158206836 | SRX24027916 | SRS20821688 | SRA1832827 | MPI for heart and lung research | MPI for heart and lung research | T | B | sc-like readlen | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | Germany | 2024-03-22 | Cleavage | Embryo | Heart | Cardiovascular System | |||||||||||||||||||||
| 31529 | 31529 | SRR28423882 | SRX24027915 | SRS20821687 | SRP497294 | PRJNA1090898 | The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169 | GSE262247 | Transcriptome Analysis | The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq. | parent bioproject:PRJNA1090894 | pubmed:39271818 | ventricular cells myd88+/+ 24 hpci | GSM8161053 | source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing | ventricular cells myd88+/+ 24 hpci | Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs | cardiac ventricles | cardiac cryoinjury 24 hours prior to heart extraction | Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121. | tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury | GSM8161053 | GSM8161053: ventricular cells myd88+/+ 24 hpci; Danio rerio; RNA Seq | GSM8161053 r1 | GSM8161053 | 1 | Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121. | RNA-Seq | TRANSCRIPTOMIC SINGLE CELL | cDNA | PAIRED | ILLUMINA | NextSeq 2000 | SRP497294 | Pinelopi_10x_Zebrafish_WT_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_WT_Lib_R2.fastq.gz | fastq fastq | 40672259373.0 | 511650018.0 | GSM8161053 r1 | 0:28 1:51.49 | A:11079272327;C:8809520398;G:9307205642;T:11269370263;N:206890743 | 28 | 51 | 11079272327 | 8809520398 | 9307205642 | 11269370263 | 206890743 | SRX24027915 | SRS20821687 | SRA1832827 | MPI for heart and lung research | MPI for heart and lung research | T | B | sc-like readlen | illumina | nextseq_v2 | unknown | cdna_unspecified | unknown | sc | single_cell_droplet | 10x | Germany | 2024-03-22 | Cleavage | Embryo | Heart | Cardiovascular System | |||||||||||||||||||||
| 32033 | 32033 | SRR28976522 | SRX24505963 | SRS21254128 | SRP506702 | PRJNA1109723 | rbm24a is an organizer component of germ plasm to determine germ cell fate | GSE267086 | Other | The formation of germ cells is a critical issue for the continuation of species. A large group of animals follow a preformation strategy to generate their primordial germ cells PGCs. They produce a set of localized maternal mRNAs and proteins to form phase separated germ plasm that functions as the PGC determinants but the mechanisms underlying the assembly of germ plasm is poorly understood. This study identifies Rbm24a as an enssential localized germ plasm protein component that controls the formation of large and functional germ plasm granules. Rbm24a is complexed with Buc and interacts with germ plasm mRNAs which determines the specific grasp of germ plasm mRNAs into the phase separated aggregates. Rbm24a absent granules fail to undergo kinesin dependent transport towards the cleavage furrows where small particles fuse into large ones. The loss of maternal rbm24a causes the complete degradation of germ plasm components and the disappearance of PGCs resulting in totally sterile animals. Our work establishes that Rbm24 is a critical nucleating organizer component of germ plasm highlighting an emerging common mechanism to read and recruit RNA component into phase separated condensates. Overall design: To elucidate the comprehensive RNA binding landscape of Rbm24a in zebrafish we employed RIP seq analysis on both rbm24a GFP knock in and wild type zebrafish. | Zebrafish RIP seq Rbm24a Knock in IP | GSM8259538 | source name:whole embryo|tissue:whole embryo|developmental stage:4 cell stage|cell type:embryonic cell|genotype:Rbm24a Knock in|antibody:GFP|geo loc name:missing|collection date:missing | Zebrafish RIP seq Rbm24a Knock in IP | Each library was amplified by a 15 cycle PCR and 150 bp paired end sequencing was subjected to Illumina Nova seq 6000 to obtain the raw data. Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: Bigwig file for each Sample | whole embryo | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA and RIP IP RNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina Nova seq 6000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. | Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C | tissue:whole embryo|developmental stage:4 cell stage|cell type:embryonic cell|genotype:Rbm24a Knock in|antibody:GFP | GSM8259538 | GSM8259538: Zebrafish RIP seq Rbm24a Knock in IP; Danio rerio; RIP Seq | GSM8259538 r1 | GSM8259538 | 1 | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA and RIP IP RNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina Nova seq 6000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions. | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP506702 | RIP_KI_IP_R2.fq.gz RIP_KI_IP_R1.fq.gz | fastq fastq | 6457893104.0 | 21383752.0 | GSM8259538 r1 | 0:151 1:151 | A:975588225;C:2019180290;G:2469634919;T:992947702;N:541968 | 151 | 151 | 975588225 | 2019180290 | 2469634919 | 992947702 | 541968 | SRX24505963 | SRS21254128 | SRA1863578 | Ang Li, College of Life Sciences, shandong university | Ang Li, College of Life Sciences, shandong university | 2 | 0.90304 | 0.86018 | 0.20083 | 0.20471 | 0.96382 | 0.96743 | 0.96102 | 0.98876 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | China | 2024-05-09 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 32034 | 32034 | SRR28976523 | SRX24505962 | SRS21254127 | SRP506702 | PRJNA1109723 | rbm24a is an organizer component of germ plasm to determine germ cell fate | GSE267086 | Other | The formation of germ cells is a critical issue for the continuation of species. A large group of animals follow a preformation strategy to generate their primordial germ cells PGCs. They produce a set of localized maternal mRNAs and proteins to form phase separated germ plasm that functions as the PGC determinants but the mechanisms underlying the assembly of germ plasm is poorly understood. This study identifies Rbm24a as an enssential localized germ plasm protein component that controls the formation of large and functional germ plasm granules. Rbm24a is complexed with Buc and interacts with germ plasm mRNAs which determines the specific grasp of germ plasm mRNAs into the phase separated aggregates. Rbm24a absent granules fail to undergo kinesin dependent transport towards the cleavage furrows where small particles fuse into large ones. The loss of maternal rbm24a causes the complete degradation of germ plasm components and the disappearance of PGCs resulting in totally sterile animals. Our work establishes that Rbm24 is a critical nucleating organizer component of germ plasm highlighting an emerging common mechanism to read and recruit RNA component into phase separated condensates. Overall design: To elucidate the comprehensive RNA binding landscape of Rbm24a in zebrafish we employed RIP seq analysis on both rbm24a GFP knock in and wild type zebrafish. | Zebrafish RIP seq wild type IP | GSM8259537 | source name:whole embryo|tissue:whole embryo|developmental stage:4 cell stage|cell type:embryonic cell|genotype:wild type|antibody:GFP|geo loc name:missing|collection date:missing | Zebrafish RIP seq wild type IP | Each library was amplified by a 15 cycle PCR and 150 bp paired end sequencing was subjected to Illumina Nova seq 6000 to obtain the raw data. Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: Bigwig file for each Sample | whole embryo | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA and RIP IP RNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina Nova seq 6000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. | Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C | tissue:whole embryo|developmental stage:4 cell stage|cell type:embryonic cell|genotype:wild type|antibody:GFP | GSM8259537 | GSM8259537: Zebrafish RIP seq wild type IP; Danio rerio; RIP Seq | GSM8259537 r1 | GSM8259537 | 1 | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA and RIP IP RNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina Nova seq 6000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions. | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP506702 | RIP_WT_IP_R2.fq.gz RIP_WT_IP_R1.fq.gz | fastq fastq | 4501412680.0 | 14905340.0 | GSM8259537 r1 | 0:151 1:151 | A:651609366;C:1285679784;G:1901211768;T:662533141;N:378621 | 151 | 151 | 651609366 | 1285679784 | 1901211768 | 662533141 | 378621 | SRX24505962 | SRS21254127 | SRA1863578 | Ang Li, College of Life Sciences, shandong university | Ang Li, College of Life Sciences, shandong university | 2 | 0.96426 | 0.81361 | 0.26579 | 0.2253 | 0.97784 | 0.97806 | 0.8699 | 0.93379 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | China | 2024-05-09 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 32035 | 32035 | SRR28976524 | SRX24505961 | SRS21254126 | SRP506702 | PRJNA1109723 | rbm24a is an organizer component of germ plasm to determine germ cell fate | GSE267086 | Other | The formation of germ cells is a critical issue for the continuation of species. A large group of animals follow a preformation strategy to generate their primordial germ cells PGCs. They produce a set of localized maternal mRNAs and proteins to form phase separated germ plasm that functions as the PGC determinants but the mechanisms underlying the assembly of germ plasm is poorly understood. This study identifies Rbm24a as an enssential localized germ plasm protein component that controls the formation of large and functional germ plasm granules. Rbm24a is complexed with Buc and interacts with germ plasm mRNAs which determines the specific grasp of germ plasm mRNAs into the phase separated aggregates. Rbm24a absent granules fail to undergo kinesin dependent transport towards the cleavage furrows where small particles fuse into large ones. The loss of maternal rbm24a causes the complete degradation of germ plasm components and the disappearance of PGCs resulting in totally sterile animals. Our work establishes that Rbm24 is a critical nucleating organizer component of germ plasm highlighting an emerging common mechanism to read and recruit RNA component into phase separated condensates. Overall design: To elucidate the comprehensive RNA binding landscape of Rbm24a in zebrafish we employed RIP seq analysis on both rbm24a GFP knock in and wild type zebrafish. | Zebrafish RIP seq Rbm24a Knock in input | GSM8259536 | source name:whole embryo|tissue:whole embryo|developmental stage:4 cell stage|cell type:embryonic cell|genotype:Rbm24a Knock in|antibody:input|geo loc name:missing|collection date:missing | Zebrafish RIP seq Rbm24a Knock in input | Each library was amplified by a 15 cycle PCR and 150 bp paired end sequencing was subjected to Illumina Nova seq 6000 to obtain the raw data. Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: Bigwig file for each Sample | whole embryo | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA and RIP IP RNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina Nova seq 6000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. | Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C | tissue:whole embryo|developmental stage:4 cell stage|cell type:embryonic cell|genotype:Rbm24a Knock in|antibody:input | GSM8259536 | GSM8259536: Zebrafish RIP seq Rbm24a Knock in input; Danio rerio; RIP Seq | GSM8259536 r1 | GSM8259536 | 1 | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA and RIP IP RNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina Nova seq 6000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions. | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP506702 | RIP_KI_Input_R2.fq.gz RIP_KI_Input_R1.fq.gz | fastq fastq | 9539398726.0 | 31587413.0 | GSM8259536 r1 | 0:151 1:151 | A:2233069830;C:2078359171;G:3009942870;T:2217201959;N:824896 | 151 | 151 | 2233069830 | 2078359171 | 3009942870 | 2217201959 | 824896 | SRX24505961 | SRS21254126 | SRA1863578 | Ang Li, College of Life Sciences, shandong university | Ang Li, College of Life Sciences, shandong university | 2 | 0.90112 | 0.81448 | 0.02415 | 0.01993 | 0.79287 | 0.79807 | 0.47884 | 0.48186 | 151 | 151 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | China | 2024-05-09 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 32036 | 32036 | SRR28976525 | SRX24505960 | SRS21254125 | SRP506702 | PRJNA1109723 | rbm24a is an organizer component of germ plasm to determine germ cell fate | GSE267086 | Other | The formation of germ cells is a critical issue for the continuation of species. A large group of animals follow a preformation strategy to generate their primordial germ cells PGCs. They produce a set of localized maternal mRNAs and proteins to form phase separated germ plasm that functions as the PGC determinants but the mechanisms underlying the assembly of germ plasm is poorly understood. This study identifies Rbm24a as an enssential localized germ plasm protein component that controls the formation of large and functional germ plasm granules. Rbm24a is complexed with Buc and interacts with germ plasm mRNAs which determines the specific grasp of germ plasm mRNAs into the phase separated aggregates. Rbm24a absent granules fail to undergo kinesin dependent transport towards the cleavage furrows where small particles fuse into large ones. The loss of maternal rbm24a causes the complete degradation of germ plasm components and the disappearance of PGCs resulting in totally sterile animals. Our work establishes that Rbm24 is a critical nucleating organizer component of germ plasm highlighting an emerging common mechanism to read and recruit RNA component into phase separated condensates. Overall design: To elucidate the comprehensive RNA binding landscape of Rbm24a in zebrafish we employed RIP seq analysis on both rbm24a GFP knock in and wild type zebrafish. | Zebrafish RIP seq wild type input | GSM8259535 | source name:whole embryo|tissue:whole embryo|developmental stage:4 cell stage|cell type:embryonic cell|genotype:wild type|antibody:input|geo loc name:missing|collection date:missing | Zebrafish RIP seq wild type input | Each library was amplified by a 15 cycle PCR and 150 bp paired end sequencing was subjected to Illumina Nova seq 6000 to obtain the raw data. Assembly: GRCz11 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: Bigwig file for each Sample | whole embryo | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA and RIP IP RNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina Nova seq 6000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. | Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C | tissue:whole embryo|developmental stage:4 cell stage|cell type:embryonic cell|genotype:wild type|antibody:input | GSM8259535 | GSM8259535: Zebrafish RIP seq wild type input; Danio rerio; RIP Seq | GSM8259535 r1 | GSM8259535 | 1 | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA and RIP IP RNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina Nova seq 6000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions. | RIP-Seq | TRANSCRIPTOMIC | other | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP506702 | RIP_WT_Input_R2.fq.gz RIP_WT_Input_R1.fq.gz | fastq fastq | 14180410302.0 | 46955001.0 | GSM8259535 r1 | 0:151 1:151 | A:3380011534;C:2883841476;G:4593876270;T:3321465622;N:1215400 | 151 | 151 | 3380011534 | 2883841476 | 4593876270 | 3321465622 | 1215400 | SRX24505960 | SRS21254125 | SRA1863578 | Ang Li, College of Life Sciences, shandong university | Ang Li, College of Life Sciences, shandong university | 2 | 0.86497 | 0.64685 | 0.04432 | 0.02854 | 0.79324 | 0.8031 | 0.52927 | 0.53304 | 151 | 151 | B | B | mate2-mate1 similar by mapping diff | illumina | novaseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | China | 2024-05-09 | Cleavage | Embryo | Whole Organism | All anatomical structures | ||||||||||||
| 34036 | 34036 | SRR31033345 | SRX26418807 | SRS22938440 | SRP539223 | PRJNA1174207 | Rbm24 dictates mRNA recruitment for germ plasm assembly | GSE279756 | Transcriptome Analysis | Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf. | Zebrafish Riboseq M 4cell 5 | GSM8579730 | source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing | Zebrafish Riboseq M 4cell 5 | Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample | whole embryo | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. | Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C | tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a | GSM8579730 | GSM8579730: Zebrafish Riboseq M 4cell 5; Danio rerio; RNA Seq | GSM8579730 r1 | GSM8579730 | 1 | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP539223 | M-4cell-5_L1_1.fq.gz M-4cell-5_L1_2.fq.gz | fastq fastq | 5643278100.0 | 18810927.0 | GSM8579730 r1 | 0:150 1:150 | A:1555401034;C:1268722567;G:1323837426;T:1495279385;N:37688 | 150 | 150 | 1555401034 | 1268722567 | 1323837426 | 1495279385 | 37688 | SRX26418807 | SRS22938440 | SRA1993092 | Shandong university | Shandong university | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | China | 2024-10-17 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||
| 34037 | 34037 | SRR31033351 | SRX26418806 | SRS22938443 | SRP539223 | PRJNA1174207 | Rbm24 dictates mRNA recruitment for germ plasm assembly | GSE279756 | Transcriptome Analysis | Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf. | Zebrafish Riboseq M 4cell 4 | GSM8579729 | source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing | Zebrafish Riboseq M 4cell 4 | Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample | whole embryo | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. | Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C | tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a | GSM8579729 | GSM8579729: Zebrafish Riboseq M 4cell 4; Danio rerio; RNA Seq | GSM8579729 r1 | GSM8579729 | 1 | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP539223 | M-4cell-4_L1_1.fq.gz M-4cell-4_L1_2.fq.gz | fastq fastq | 6607232100.0 | 22024107.0 | GSM8579729 r1 | 0:150 1:150 | A:1825603885;C:1480833466;G:1538474482;T:1762276005;N:44262 | 150 | 150 | 1825603885 | 1480833466 | 1538474482 | 1762276005 | 44262 | SRX26418806 | SRS22938443 | SRA1993092 | Shandong university | Shandong university | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | China | 2024-10-17 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||
| 34038 | 34038 | SRR31033346 | SRX26418805 | SRS22938438 | SRP539223 | PRJNA1174207 | Rbm24 dictates mRNA recruitment for germ plasm assembly | GSE279756 | Transcriptome Analysis | Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf. | Zebrafish Riboseq M 4cell 3 | GSM8579728 | source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing | Zebrafish Riboseq M 4cell 3 | Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample | whole embryo | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. | Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C | tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a | GSM8579728 | GSM8579728: Zebrafish Riboseq M 4cell 3; Danio rerio; RNA Seq | GSM8579728 r1 | GSM8579728 | 1 | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP539223 | M-4cell-3_L1_1.fq.gz M-4cell-3_L1_2.fq.gz | fastq fastq | 7948794900.0 | 26495983.0 | GSM8579728 r1 | 0:150 1:150 | A:2183592013;C:1794605656;G:1863773539;T:2106770087;N:53605 | 150 | 150 | 2183592013 | 1794605656 | 1863773539 | 2106770087 | 53605 | SRX26418805 | SRS22938438 | SRA1993092 | Shandong university | Shandong university | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | China | 2024-10-17 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||
| 34039 | 34039 | SRR31033350 | SRX26418804 | SRS22938441 | SRP539223 | PRJNA1174207 | Rbm24 dictates mRNA recruitment for germ plasm assembly | GSE279756 | Transcriptome Analysis | Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf. | Zebrafish Riboseq M 4cell 2 | GSM8579727 | source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a|geo loc name:missing|collection date:missing | Zebrafish Riboseq M 4cell 2 | Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample | whole embryo | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. | Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C | tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:Mrbm24a | GSM8579727 | GSM8579727: Zebrafish Riboseq M 4cell 2; Danio rerio; RNA Seq | GSM8579727 r1 | GSM8579727 | 1 | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP539223 | M-4cell-2_L1_1.fq.gz M-4cell-2_L1_2.fq.gz | fastq fastq | 7036510200.0 | 23455034.0 | GSM8579727 r1 | 0:150 1:150 | A:1830698676;C:1686461802;G:1754202163;T:1765099649;N:47910 | 150 | 150 | 1830698676 | 1686461802 | 1754202163 | 1765099649 | 47910 | SRX26418804 | SRS22938441 | SRA1993092 | Shandong university | Shandong university | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | China | 2024-10-17 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||
| 34047 | 34047 | SRR31033355 | SRX26418796 | SRS22938428 | SRP539223 | PRJNA1174207 | Rbm24 dictates mRNA recruitment for germ plasm assembly | GSE279756 | Transcriptome Analysis | Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf. | Zebrafish RNAseq Sibling 4cell 4 | GSM8579719 | source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing | Zebrafish RNAseq Sibling 4cell 4 | Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample | whole embryo | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. | Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C | tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type | GSM8579719 | GSM8579719: Zebrafish RNAseq Sibling 4cell 4; Danio rerio; RNA Seq | GSM8579719 r1 | GSM8579719 | 1 | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP539223 | Sibling-4cell-4_L1_1.fq.gz Sibling-4cell-4_L1_2.fq.gz | fastq fastq | 7424662500.0 | 24748875.0 | GSM8579719 r1 | 0:150 1:150 | A:2045351766;C:1671617139;G:1731338149;T:1976305596;N:49850 | 150 | 150 | 2045351766 | 1671617139 | 1731338149 | 1976305596 | 49850 | SRX26418796 | SRS22938428 | SRA1993092 | Shandong university | Shandong university | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | China | 2024-10-17 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||
| 34048 | 34048 | SRR31033358 | SRX26418795 | SRS22938431 | SRP539223 | PRJNA1174207 | Rbm24 dictates mRNA recruitment for germ plasm assembly | GSE279756 | Transcriptome Analysis | Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf. | Zebrafish RNAseq Sibling 4cell 2 | GSM8579718 | source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing | Zebrafish RNAseq Sibling 4cell 2 | Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample | whole embryo | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. | Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C | tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type | GSM8579718 | GSM8579718: Zebrafish RNAseq Sibling 4cell 2; Danio rerio; RNA Seq | GSM8579718 r1 | GSM8579718 | 1 | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP539223 | Sibling-4cell-2_L1_1.fq.gz Sibling-4cell-2_L1_2.fq.gz | fastq fastq | 6484454400.0 | 21614848.0 | GSM8579718 r1 | 0:150 1:150 | A:1701212104;C:1544478776;G:1597991536;T:1640728663;N:43321 | 150 | 150 | 1701212104 | 1544478776 | 1597991536 | 1640728663 | 43321 | SRX26418795 | SRS22938431 | SRA1993092 | Shandong university | Shandong university | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | China | 2024-10-17 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||
| 34049 | 34049 | SRR31033356 | SRX26418794 | SRS22938430 | SRP539223 | PRJNA1174207 | Rbm24 dictates mRNA recruitment for germ plasm assembly | GSE279756 | Transcriptome Analysis | Ribonucleoprotein RNP granules are the most common membrane less biomolecular condensates. However the mechanisms underlying their assembly are largely unknown. The aggregation of germ plasm determines the fate of primordial germ cells PGCs and serves as a model for RNP granule assembly. Here we show that maternal RNA binding protein Rbm24a is the key factor governing specific sorting of mRNAs. Mechanistically Rbm24a complexes with Buc and interacts to dictate the specific grasp of germ plasm mRNAs into phase separated condensates. Germ plasm particles lacking Rbm24a and mRNAs fail to undergo kinesin dependent transport towards the cleavage furrows where small granules fuse into large aggregates. Therefore the loss of maternal Rbm24a causes a complete degradation of germ plasm and the disappearance of PGCs. These findings demonstrate that Rbm24a functions as a nucleating organizer of the germ plasm highlighting an emerging mechanism for RNA binding proteins in reading and recruiting RNA components into the phase separated protein scaffold. Overall design: To examine the global transcriptome alterations following the loss of maternal Rbm24a we conducted bulk RNA seq analysis on Mrbm24a and their sibling embyos at 4 cell sphere stage and 24 hpf. | Zebrafish RNAseq Sibling 4cell 1 | GSM8579717 | source name:whole embryo|tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type|geo loc name:missing|collection date:missing | Zebrafish RNAseq Sibling 4cell 1 | Each library was amplified by a 11 cycle PCR and 150 bp paired end sequencing was subjected to Illumina HiSeq 2000 to obtain the raw data. Assembly: GRCz10 Supplementary files format and content: tab delimited text file includes raw counts for each Sample Supplementary files format and content: tab delimited text file includes FPKM values for each Sample | whole embryo | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer’s instructions. | Zebrafish embryos were maintained in 1/3x Ringer's at 28.5C | tissue:whole embryo|Stage:4 cell stage|cell type:embryonic cell|genotype:wild type | GSM8579717 | GSM8579717: Zebrafish RNAseq Sibling 4cell 1; Danio rerio; RNA Seq | GSM8579717 r1 | GSM8579717 | 1 | Total RNAs were extracted from WT and Mrbm24a embryos at 4 cell sphere 24 hpf stage using TRIzol reagent Invitrogen and were precipitated by cold isopropanol 50% v/v in the presence of carrier glycogen 20 µg/each sample. 1 μg total RNA was used for following library preparation. The polyA mRNA isolation was performed using OligodT beads. The mRNA fragmentation was performed using divalent cations and high temperature. Priming was performed using Random Primers. First strand cDNA and the second strand cDNA were synthesized. The purified double stranded cDNA was then treated to repair both ends and add a dA tailing in one reaction followed by a T A ligation to add adaptors to both ends. Size selection of Adaptor ligated DNA was then performed using DNA Clean Beads. Each sample was then amplified by PCR using P5 and P7 primers and the PCR products were validated. Then libraries with different indexs were multiplexed and loaded on an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2x150 paired end PE configuration according to manufacturer's instructions. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP539223 | Sibling-4cell-1_L1_1.fq.gz Sibling-4cell-1_L1_2.fq.gz | fastq fastq | 8126999700.0 | 27089999.0 | GSM8579717 r1 | 0:150 1:150 | A:2195769442;C:1872416059;G:1934390760;T:2124367874;N:55565 | 150 | 150 | 2195769442 | 1872416059 | 1934390760 | 2124367874 | 55565 | SRX26418794 | SRS22938430 | SRA1993092 | Shandong university | Shandong university | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | bulk | bulk | China | 2024-10-17 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||||||||||||||
| 36355 | 36355 | SRR372788 | SRX107384 | SRS280824 | SRP009426 | PRJNA154389 | Comprehensive identification of long non coding RNAs expressed during zebrafish embryogenesis [RNA seq] | GSE32898 | Transcriptome Analysis | Long non coding RNAs lncRNAs comprise a diverse class of transcripts that structurally resemble mRNAs but do not encode proteins. Recent genome wide studies in human and mouse have annotated lncRNAs expressed in cell lines and adult tissues but a systematic analysis of lncRNAs expressed during vertebrate embryogenesis has been elusive. To identify lncRNAs with potential functions in vertebrate embryogenesis we performed a time series of RNA Seq experiments at eight stages during early zebrafish development. We reconstructed 56 535 high confidence transcripts in 28 912 loci recovering the vast majority of expressed RefSeq transcripts while identifying thousands of novel isoforms and expressed loci. We defined a stringent set of 1 133 non coding multi exonic transcripts expressed during embryogenesis. These include long intergenic ncRNAs lincRNAs intronic overlapping lncRNAs exonic antisense overlapping lncRNAs and precursors for small RNAs sRNAs. Zebrafish lncRNAs share many of the characteristics of their mammalian counterparts: relatively short length low exon number low expression and conservation levels comparable to introns. Subsets of lncRNAs carry chromatin signatures characteristic of genes with developmental functions. The temporal expression profile of lncRNAs revealed two novel properties: lncRNAs are expressed in narrower time windows than protein coding genes and are specifically enriched in early stage embryos. In addition several lncRNAs show tissue specific expression and distinct subcellular localization patterns. Integrative computational analyses associated individual lncRNAs with specific pathways and functions ranging from cell cycle regulation to morphogenesis. Our study provides the first comprehensive identification of lncRNAs in a vertebrate embryo and forms the foundation for future genetic genomic and evolutionary studies. Overall design: RNA Seq for 8 zebrafish developmental stages 2 lanes for each stage 3 for shield. | parent bioproject:PRJNA146503 | pubmed:22110045;pubmed:23698349 | 2 4cell 2 | GSM831504 | source name:2 4cell RNA Seq|tissue:embryo|development stage:embryogenesis: 2 4 cell stage|stdev for insert size:1301.769583 | 2 4cell 2 | Th summary result files of he developmental transcriptome of all samples are available as supplementary information with the paper. | 2 4cell RNA Seq | Total RNA was isolated using the standard Trizol Invitrogen protocol. Two rounds of PolyA+ RNA purification were performed for each sample using the PolyAPuristTM MAG kit Ambion. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bioanalyzer. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed in Levin et al. 2010. | Zebrafish embryos were dechorionated at the 1 cell stage followed by incubation at 28C. | tissue:embryo|developmental stage:embryogenesis: 2 4 cell stage|average insert size fragment length:673.36217|stdev for insert size:1301.769583 | GSM831504 | GSM831504: 2 4cell 2 | GSM831504: 2 4cell 2 | GSM831504: 2 4cell 2 | 1 | GEO Accession:GSM831504 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>152</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>77</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP009426 | 9256767320.0 | 60899785.0 | GSM831504 1 | 0:76 1:76 | A:2412461359;C:2170215834;G:2234888308;T:2438303823;N:897996 | 76 | 76 | 2412461359 | 2170215834 | 2234888308 | 2438303823 | 897996 | SRX107384 | SRS280824 | SRA048184 | GEO | Sandelin, Dep. of Biology, University of Copenhagen | 2 | 0.93703 | 0.94416 | 0.03525 | 0.03149 | 0.80129 | 0.79188 | 0.49723 | 0.49656 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Denmark | 2011-11-11 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||
| 36356 | 36356 | SRR372787 | SRX107383 | SRS280823 | SRP009426 | PRJNA154389 | Comprehensive identification of long non coding RNAs expressed during zebrafish embryogenesis [RNA seq] | GSE32898 | Transcriptome Analysis | Long non coding RNAs lncRNAs comprise a diverse class of transcripts that structurally resemble mRNAs but do not encode proteins. Recent genome wide studies in human and mouse have annotated lncRNAs expressed in cell lines and adult tissues but a systematic analysis of lncRNAs expressed during vertebrate embryogenesis has been elusive. To identify lncRNAs with potential functions in vertebrate embryogenesis we performed a time series of RNA Seq experiments at eight stages during early zebrafish development. We reconstructed 56 535 high confidence transcripts in 28 912 loci recovering the vast majority of expressed RefSeq transcripts while identifying thousands of novel isoforms and expressed loci. We defined a stringent set of 1 133 non coding multi exonic transcripts expressed during embryogenesis. These include long intergenic ncRNAs lincRNAs intronic overlapping lncRNAs exonic antisense overlapping lncRNAs and precursors for small RNAs sRNAs. Zebrafish lncRNAs share many of the characteristics of their mammalian counterparts: relatively short length low exon number low expression and conservation levels comparable to introns. Subsets of lncRNAs carry chromatin signatures characteristic of genes with developmental functions. The temporal expression profile of lncRNAs revealed two novel properties: lncRNAs are expressed in narrower time windows than protein coding genes and are specifically enriched in early stage embryos. In addition several lncRNAs show tissue specific expression and distinct subcellular localization patterns. Integrative computational analyses associated individual lncRNAs with specific pathways and functions ranging from cell cycle regulation to morphogenesis. Our study provides the first comprehensive identification of lncRNAs in a vertebrate embryo and forms the foundation for future genetic genomic and evolutionary studies. Overall design: RNA Seq for 8 zebrafish developmental stages 2 lanes for each stage 3 for shield. | parent bioproject:PRJNA146503 | pubmed:22110045;pubmed:23698349 | 2 4cell 1 | GSM831503 | source name:2 4cell RNA Seq|tissue:embryo|developmental stage:embryogenesis: 2 4 cell stage|stdev for insert size:1336.039246 | 2 4cell 1 | Th summary result files of he developmental transcriptome of all samples are available as supplementary information with the paper. | 2 4cell RNA Seq | Total RNA was isolated using the standard Trizol Invitrogen protocol. Two rounds of PolyA+ RNA purification were performed for each sample using the PolyAPuristTM MAG kit Ambion. The quality of the RNA and lack of contaminating ribosomal RNA were confirmed using the Agilent 2100 Bioanalyzer. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed in Levin et al. 2010. | Zebrafish embryos were dechorionated at the 1 cell stage followed by incubation at 28C. | tissue:embryo|developmental stage:embryogenesis: 2 4 cell stage|average insert size fragment length:710.502832|stdev for insert size:1336.039246 | GSM831503 | GSM831503: 2 4cell 1 | GSM831503: 2 4cell 1 | GSM831503: 2 4cell 1 | 1 | GEO Accession:GSM831503 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>152</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>77</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP009426 | 6454083552.0 | 42461076.0 | GSM831503 1 | 0:76 1:76 | A:1659789336;C:1511027834;G:1564153032;T:1683582419;N:35530931 | 76 | 76 | 1659789336 | 1511027834 | 1564153032 | 1683582419 | 35530931 | SRX107383 | SRS280823 | SRA048184 | GEO | Sandelin, Dep. of Biology, University of Copenhagen | 2 | 0.82115 | 0.94097 | 0.02927 | 0.02775 | 0.84362 | 0.79864 | 0.49872 | 0.49708 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | Denmark | 2011-11-11 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | |||||||||||
| 36358 | 36358 | SRR489491 | SRX143568 | SRS310289 | SRP012376 | PRJNA160143 | Extensive alternative polyadenylation during zebrafish development | GSE37453 | Transcriptome Analysis | The post transcriptional fate of messenger RNAs mRNAs is largely dictated by their three prime' untranslated regions three prime'UTRs which are defined by cleavage and polyadenylation CPA of pre mRNAs. We used polyA position profiling by sequencing 3P Seq to map polyA sites at eight developmental stages and tissues in the zebrafish. Analysis of over 60 million 3P Seq reads substantially increased and improved existing three prime'UTR annotations resulting in confidently identified three prime'UTRs for more than 78.79% of the annotated protein coding genes in zebrafish. Most zebrafish genes undergo alternative CPA with more than a thousand genes using different dominant three prime'UTRs at different stages. three prime'UTRs tend to be shortest in the ovaries and longest in the brain. Isoforms with some of the shortest three prime'UTRs are highly expressed in the ovary yet absent in the maternally contributed RNAs of the embryo perhaps because their three prime'UTRs are too short to accommodate a uridine rich motif required for stability of the maternal mRNA. At two hpf thousands of unique polyA sites appear at locations lacking a typical polyadenylation signal which suggests a wave of widespread cytoplasmic polyadenylation of mRNA degradation intermediates. Our insights into the identities formation and evolution of zebrafish three prime'UTRs provide a resource for studying gene regulation during vertebrate development. Overall design: 3P Seq was used to map the three prime' ends of protein coding genes in the zebrafish genome | pubmed:22722342 | 3P PE Seq PreMZT | GSM919974 | source name:whole embryo at 1.5 hpf 2 hpf type|tissue:whole embryo|development stage:1.5 hpf 2 hpf | 3P PE Seq PreMZT | For 3P Seq: Reads were reverse complemented and aligned to the D. rerio genome Zv9/danRer7 using Bowtie. Reads that aligned to up to four genomic locus and had one or more mismatches at their three prime end within a terminal adenylate run were carried forward as 3P tags. Reads mapping to the same locus with the same number of terminal adenylates were consolidated in the processed data file. The BED file is as in Jan et al. GSE24924 For 3P PE Seq: In each read pair read #1 captured the three prime end of the polyA tail in the antisense orientation and read #2 captured a portion of the three prime region of the transcript and occasionally the beginning of the polyA tail in the sense orientation. Read #2 began with an adapter of 26 bases. Reads with more than 10 mismatches to the adapter were discarded and the first 26 bases were removed before further processing. A read pair was considered informative only if read #1 began with Ts and read #2 contained 2–39 terminal As. post leading Ts and terminal As were removed from reads #1 and #2 respectively they were mapped to the genome using Bowtie allowing for up to two mismatches and requiring a unique mapping position in the zebrafish genome. The length of the tail encoded in read #2 was defined as the maximum number of trailing As allowing for up to one mismatch. Only cases in which this number was larger than the number of As encoded in the genome at the predicted cleavage position by at least 2 bases were carried forward. Cleavage and polyadenylation position was defined as the last non A base in read #2. The length of the polyA tail at that position was estimated using the corresponding read #1 and defined as the maximal i for which >90% of the bases in the first i bases of read #1 were Ts. This criterion was used to allow for some sequencing errors expected when sequencing long homopolymers. Genome build: danRer7 Supplementary files format and content: The .bed files contain the positions where 3P Seq reads were mapped and the name of each track is the … | whole embryo at 1.5 hpf 2 hpf | Anesthetized decorioneted embryos were washed three times in PBS 137 mM NaCl 2.7 mM KCl 1.5 mM KH2PO4 8 mM Na2HP04 pH 7.4 and suspended in PBS containing 1% freshly added formaldehyde. Embryos were transferred to a dounce homogenizer dounced several times and incubated at room temperature for 15 min. Formaldehyde was quenched by adding 1/20 volume 2.5 M glycine. Cells were pelleted at 400 x g for 5 min. The supernatant was removed and pellets were rinsed twice with PBS flash frozen in liquid nitrogen and stored at 80C. | 3P PE Seq: To selectively capture polyadenylated ends for paired end sequencing 2.5 µg of total RNA from 2–2.2 or 6 hpf zebrafish embryos was splint ligated to a three prime biotinylated adapter p AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGACACATAC biotin IDT in the presence of bridge oligo TTCCGATCTTTTTTTTT IDT using T4 Rnl2 NEB in an overnight reaction at 18°C. Following partial digestion with RNase T1 Ambion 115–750 nt RNAs were isolated from a denaturing polyacrylamide gel and ligation products were captured on streptavidin M 280 Dynabeads Invitrogen. RNAs were phosphorylated at the five prime end on beads using PNK NEB and subsequently ligated to an adapter C3.spacer GTTCAGAGTTCTAcaguccgacgauc uppercase DNA; lowercase RNA; IDT using T4 Rnl1 NEB in an overnight reaction at room temperature. Complementary DNA was synthesized on beads using SuperScript II Invitrogen primed with AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACG IDT liberated from the beads by base hydrolysis size selected 155–790 nt on a denaturing polyacrylamide gel and amplified by PCR for 15 cycles. 180–750 nt products were isolated from a formamide gel and amplified for four additional cycles using primers that contain the Illumina paired end sequencing primer binding sites. post a final formamide gel purification and size selection 220–800 nt 80x80 paired end sequencing was performed on the Illumina Hi Seq platform. | Zebrafish embryos or adults grown under standard condition | genotype/variation:wild type|tissue:whole embryo|developmental stage:1.5 hpf 2 hpf | GSM919974 | GSM919974: 3P PE Seq PreMZT; Danio rerio; RNA Seq | GSM919974 2 | GSM919974: 3P PE Seq PreMZT | 1 | GEO Accession:GSM919974 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>160</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>81</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP012376 | PolyALengths_PreMZT_read2.fastq PolyALengths_PreMZT_read1.fastq | fastq fastq | 35175463040.0 | 219846644.0 | GSM919974 r1 | 0:80 1:80 | A:6774783678;C:5489443100;G:6337298045;T:13536245767;N:3037692450 | 80 | 80 | 6774783678 | 5489443100 | 6337298045 | 13536245767 | 3037692450 | SRX143568 | SRS310289 | SRA051955 | GEO | Whitehead Institute for Biomedical Research | 2 | 0.87245 | 0.00013 | 0.4503 | 5e-05 | 0.98912 | 0.99993 | 0.92784 | 1.0 | 80 | 80 | B | T | mate2 technical by mapping diff | illumina | hiseq_era | 5prime | cdna_unspecified | unknown | bulk | unknown | unknown | United States | 2012-04-20 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||
| 36408 | 36408 | SRR546817 | SRX180747 | SRS358988 | SRP013950 | PRJNA169500 | Danio rerio embryonic promoterome | PRJNA169500 | Transcriptome Analysis | Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development. | pubmed:24531765 | Zebrafish wild type AB strain embryo 2 cells stage | D. rerio 2 cells embryo | D. rerio 2 cells embryo | RNAseq D. rerio 2 cells embryo | RNAseq D. rerio 2 cells embryo | 1 | 1 | RNA-Seq | TRANSCRIPTOMIC | unspecified | PAIRED | ILLUMINA | Illumina Genome Analyzer IIx | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><SPOT_LENGTH>152</SPOT_LENGTH><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Reverse</READ_TYPE><BASE_COORD>77</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP013950 | 2799828144.0 | 18419922.0 | RNAseq D. rerio 2 cells embryo | 0:76 1:76 | A:678251421;C:711410510;G:729905459;T:677312772;N:2947982 | 76 | 76 | 678251421 | 711410510 | 729905459 | 677312772 | 2947982 | SRX180747 | SRS358988 | SRA055273 | University of Bergen | ZEPROME consortium | 2 | 0.9498 | 0.94704 | 0.02363 | 0.02442 | 0.7988 | 0.80221 | 0.48657 | 0.49361 | 76 | 76 | B | B | biological fallback assumption | illumina | early_illumina | unknown | unknown | unknown | bulk | unknown | unknown | Unknown | 2015-07-22 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 39738 | 39738 | SRR2087761 | SRX1081749 | SRS979503 | SRP060373 | PRJNA288987 | RNA Seq matched to ribosome profiling over a zebrafish developmental timecourse | GSE70549 | Transcriptome Analysis | RNA Seq data that is sample matched to a previous ribosome profiling dataset GSE46512 Overall design: RNA Seq over 8 stages in early zebrafish development matched to ribosome profiling data in : 2 4 cell 256 cell 1K cell Dome Shield Bud 28hpf and 5dpf | 2012 07 26 2 4Cell | GSM1808905 | tissue:Whole embryos|developmental stage:2 4 cells|strain:TL/AB | 2012 07 26 2 4Cell | Aligned using Tophat2 with supplied transcript junctions from Ensembl 72 Timecourse quantified with Cufflinks on Ensembl 72 transcripts Genome build: danRer7/Zv9 Supplementary files format and content: genes.fpkm tracking from cufflinks for gene expression quantification at loci level FPKM | Whole embryos | Embryos were quickly washed in ice cold PBS and flash frozen in liquid nitrogen | Total RNA was isolated using the standard TRIzol Invitrogen protocol. Genomic DNA was removed by DNase treatment. Two rounds of PolyA+ RNA purification were performed for each sample. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed by Levin et al. 2010. Libraries were sequenced on the Illumina HiSeq 2000 | 100 embryos per stage from TL/AB WT strains were allowed to grow at 28.5°C and staged according to Kimmel et al. Dev. Dyn. 1995 | developmental stage:2 4 cells|strain:TL/AB | GSM1808905 | GSM1808905: 2012 07 26 2 4Cell; Danio rerio; RNA Seq | GSM1808905 | 1 | Total RNA was isolated using the standard TRIzol Invitrogen protocol. Genomic DNA was removed by DNase treatment. Two rounds of PolyA+ RNA purification were performed for each sample. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed by Levin et al. 2010. Libraries were sequenced on the Illumina HiSeq 2000 | GEO Accession:GSM1808905 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP060373 | RPF-RNASeq_2-4Cell_1.bam | bam | 2493603168.0 | 16405284.0 | GSM1808905 r1 | 0:76 1:76 | A:653480215;C:593647296;G:601478048;T:643527127;N:1470482 | 76 | 76 | 653480215 | 593647296 | 601478048 | 643527127 | 1470482 | SRX1081749 | SRS979503 | SRA275803 | GEO | Schier, Dept of Molecular and Cellular Biology, Harvard University | 2 | 0.93694 | 0.95551 | 0.05738 | 0.05822 | 0.79099 | 0.79226 | 0.49354 | 0.49441 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2015-07-06 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||
| 39739 | 39739 | SRR2087762 | SRX1081749 | SRS979503 | SRP060373 | PRJNA288987 | RNA Seq matched to ribosome profiling over a zebrafish developmental timecourse | GSE70549 | Transcriptome Analysis | RNA Seq data that is sample matched to a previous ribosome profiling dataset GSE46512 Overall design: RNA Seq over 8 stages in early zebrafish development matched to ribosome profiling data in : 2 4 cell 256 cell 1K cell Dome Shield Bud 28hpf and 5dpf | 2012 07 26 2 4Cell | GSM1808905 | tissue:Whole embryos|developmental stage:2 4 cells|strain:TL/AB | 2012 07 26 2 4Cell | Aligned using Tophat2 with supplied transcript junctions from Ensembl 72 Timecourse quantified with Cufflinks on Ensembl 72 transcripts Genome build: danRer7/Zv9 Supplementary files format and content: genes.fpkm tracking from cufflinks for gene expression quantification at loci level FPKM | Whole embryos | Embryos were quickly washed in ice cold PBS and flash frozen in liquid nitrogen | Total RNA was isolated using the standard TRIzol Invitrogen protocol. Genomic DNA was removed by DNase treatment. Two rounds of PolyA+ RNA purification were performed for each sample. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed by Levin et al. 2010. Libraries were sequenced on the Illumina HiSeq 2000 | 100 embryos per stage from TL/AB WT strains were allowed to grow at 28.5°C and staged according to Kimmel et al. Dev. Dyn. 1995 | developmental stage:2 4 cells|strain:TL/AB | GSM1808905 | GSM1808905: 2012 07 26 2 4Cell; Danio rerio; RNA Seq | GSM1808905 | 1 | Total RNA was isolated using the standard TRIzol Invitrogen protocol. Genomic DNA was removed by DNase treatment. Two rounds of PolyA+ RNA purification were performed for each sample. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed by Levin et al. 2010. Libraries were sequenced on the Illumina HiSeq 2000 | GEO Accession:GSM1808905 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP060373 | RPF-RNASeq_2-4Cell_2.bam | bam | 2456941680.0 | 16164090.0 | GSM1808905 r2 | 0:76 1:76 | A:642965989;C:586039305;G:592847465;T:633961685;N:1127236 | 76 | 76 | 642965989 | 586039305 | 592847465 | 633961685 | 1127236 | SRX1081749 | SRS979503 | SRA275803 | GEO | Schier, Dept of Molecular and Cellular Biology, Harvard University | 2 | 0.93956 | 0.95625 | 0.05603 | 0.05613 | 0.7906 | 0.79348 | 0.49129 | 0.49177 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2015-07-06 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||
| 39740 | 39740 | SRR2087763 | SRX1081749 | SRS979503 | SRP060373 | PRJNA288987 | RNA Seq matched to ribosome profiling over a zebrafish developmental timecourse | GSE70549 | Transcriptome Analysis | RNA Seq data that is sample matched to a previous ribosome profiling dataset GSE46512 Overall design: RNA Seq over 8 stages in early zebrafish development matched to ribosome profiling data in : 2 4 cell 256 cell 1K cell Dome Shield Bud 28hpf and 5dpf | 2012 07 26 2 4Cell | GSM1808905 | tissue:Whole embryos|developmental stage:2 4 cells|strain:TL/AB | 2012 07 26 2 4Cell | Aligned using Tophat2 with supplied transcript junctions from Ensembl 72 Timecourse quantified with Cufflinks on Ensembl 72 transcripts Genome build: danRer7/Zv9 Supplementary files format and content: genes.fpkm tracking from cufflinks for gene expression quantification at loci level FPKM | Whole embryos | Embryos were quickly washed in ice cold PBS and flash frozen in liquid nitrogen | Total RNA was isolated using the standard TRIzol Invitrogen protocol. Genomic DNA was removed by DNase treatment. Two rounds of PolyA+ RNA purification were performed for each sample. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed by Levin et al. 2010. Libraries were sequenced on the Illumina HiSeq 2000 | 100 embryos per stage from TL/AB WT strains were allowed to grow at 28.5°C and staged according to Kimmel et al. Dev. Dyn. 1995 | developmental stage:2 4 cells|strain:TL/AB | GSM1808905 | GSM1808905: 2012 07 26 2 4Cell; Danio rerio; RNA Seq | GSM1808905 | 1 | Total RNA was isolated using the standard TRIzol Invitrogen protocol. Genomic DNA was removed by DNase treatment. Two rounds of PolyA+ RNA purification were performed for each sample. Strand specific libraries for 76 bp paired end sequencing were prepared according to a modified UTP method Parkhomchuk et al. 2009 as detailed by Levin et al. 2010. Libraries were sequenced on the Illumina HiSeq 2000 | GEO Accession:GSM1808905 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP060373 | RPF-RNASeq_2-4Cell_3.bam | bam | 2221368432.0 | 14614266.0 | GSM1808905 r3 | 0:76 1:76 | A:583022149;C:529325209;G:538117340;T:569984927;N:918807 | 76 | 76 | 583022149 | 529325209 | 538117340 | 569984927 | 918807 | SRX1081749 | SRS979503 | SRA275803 | GEO | Schier, Dept of Molecular and Cellular Biology, Harvard University | 2 | 0.94898 | 0.95604 | 0.0573 | 0.05616 | 0.78973 | 0.79147 | 0.49226 | 0.48034 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2015-07-06 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||
| 41391 | 41391 | SRR4375176 | SRX2226710 | SRS1732686 | SRP090954 | PRJNA345638 | RESA identifies mRNA regulatory sequences with high resolution | PRJNA345638 | Other | Gene expression is regulated extensively at the level of mRNA stability localization and translation. However decoding functional RNA regulatory features remains a limitation to understanding post transcriptional regulation in vivo. Here we developed RNA Element Selection Assay RESA a method that selects RNA elements based on their activity in vivo and uses high throughput sequencing to provide quantitative measurement of their regulatory function with near nucleotide resolution. We implemented RESA to identify sequence elements modulating mRNA stability during zebrafish embryogenesis. RESA provides a sensitive and quantitative measure of microRNA activity in vivo and also identifies novel regulatory sequences. To uncover specific sequence requirements within regulatory elements we developed a bisulfite mediated nucleotide conversion strategy for large scale mutational analysis RESA bisulfite. Finally we used the versatile RESA platform to map candidate protein RNA interactions in vivo RESA CLIP. The RESA platform can be broadly applicable to uncover the regulatory features shaping gene expression and cellular function. | RESA Seq WT 64c pA r3 B2 | resa AG01061 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:500utr|molecule:RNA|selection:pA|replicate:2|BioSampleModel:Model organism or animal | RESA Seq WT 64c pA r3 B2 | AG01061.1 | AG01061.1 | 1 | RNA-Seq | TRANSCRIPTOMIC | unspecified | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP090954 | AG01061.1_R1.fastq.gz AG01061.1_R2.fastq.gz | fastq fastq | 724448416.0 | 4766108.0 | AG01061.1 R2.fastq.gz | 0:76 1:76 | A:224701149;C:138989041;G:139762199;T:220977796;N:18231 | 76 | 76 | 224701149 | 138989041 | 139762199 | 220977796 | 18231 | SRX2226710 | SRS1732686 | SRA482696 | Yale University|Genetics | Yale University | 2 | 0.84913 | 0.84756 | 0.03557 | 0.03568 | 0.97153 | 0.97116 | 0.47281 | 0.46157 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2016-10-06 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 41402 | 41402 | SRR4375094 | SRX2226666 | SRS1732677 | SRP090954 | PRJNA345638 | RESA identifies mRNA regulatory sequences with high resolution | PRJNA345638 | Other | Gene expression is regulated extensively at the level of mRNA stability localization and translation. However decoding functional RNA regulatory features remains a limitation to understanding post transcriptional regulation in vivo. Here we developed RNA Element Selection Assay RESA a method that selects RNA elements based on their activity in vivo and uses high throughput sequencing to provide quantitative measurement of their regulatory function with near nucleotide resolution. We implemented RESA to identify sequence elements modulating mRNA stability during zebrafish embryogenesis. RESA provides a sensitive and quantitative measure of microRNA activity in vivo and also identifies novel regulatory sequences. To uncover specific sequence requirements within regulatory elements we developed a bisulfite mediated nucleotide conversion strategy for large scale mutational analysis RESA bisulfite. Finally we used the versatile RESA platform to map candidate protein RNA interactions in vivo RESA CLIP. The RESA platform can be broadly applicable to uncover the regulatory features shaping gene expression and cellular function. | RESA Seq WT 64c pA r3 B1 | resa AG01060 | strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:500utr|molecule:RNA|selection:pA|replicate:1|BioSampleModel:Model organism or animal | RESA Seq WT 64c pA r3 B1 | AG01060.1 | AG01060.1 | 1 | RNA-Seq | TRANSCRIPTOMIC | unspecified | PAIRED | ILLUMINA | Illumina HiSeq 2000 | SRP090954 | AG01060.1_R1.fastq.gz AG01060.1_R2.fastq.gz | fastq fastq | 531097120.0 | 3494060.0 | AG01060.1 R1.fastq.gz | 0:76 1:76 | A:164891814;C:101739900;G:102440303;T:162011179;N:13924 | 76 | 76 | 164891814 | 101739900 | 102440303 | 162011179 | 13924 | SRX2226666 | SRS1732677 | SRA482696 | Yale University|Genetics | Yale University | 2 | 0.84523 | 0.84587 | 0.03561 | 0.03503 | 0.9723 | 0.97161 | 0.46204 | 0.47901 | 76 | 76 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | poly_a | unknown | bulk | unknown | unknown | United States | 2016-12-31 | Cleavage | Embryo | Embryo Imprecise | All anatomical structures | ||||||||||||||||||||
| 41950 | 41950 | SRR5342786 | SRX2639462 | SRS2047365 | SRP101876 | PRJNA379145 | Transcriptomic analysis of depleted uranium effects on adult zebrafish and progeny | GSE96603 | Transcriptome Analysis | This dataset describe the transcriptomic profiling of adult brain gonades testis and ovaries of adult zebrafish exposed to 20µg/L of depleted uranium for 10 days. The progeny of the exposed fishes were also analysed at two cells stage and 96 hpf Overall design: Biological samples adult dissected tissues and whole embryos and larvae were tested by RNASeq in duplicates | pubmed:28531178;pubmed:28831411 | U2cells r5 | GSM2536458 | source name:2 cells embryos|developmental stage:2 cells embryos|tissue:whole embryo|genotype:wild type AB|treatment:progeny of adult exposed fish | U2cells r5 | Base call with CASAVA v1.7 Mapping with RNASTAR and the exon exon reference from ensembl v85 Quantification of reads to genes from RNASTAR output in quantMode GeneCounts Genome build: Zv10 Supplementary files format and content: Non normalized read count at the gene levels ensembl gene identifier from release 85 | 2 cells embryos | exposure of adults to 20µg/L of depleted uranium for 10 days | total RNA extracted from mouse tissu in Trizol Life Technologies TruSeq mRNA version 2 | developmental stage:2 cells embryos|tissue:whole embryo|genotype:wild type AB|treatment:progeny of adult exposed fish | GSM2536458 | GSM2536458: U2cells r5; Danio rerio; RNA Seq | GSM2536458 | 1 | total RNA extracted from mouse tissu in Trizol Life Technologies TruSeq mRNA version 2 | GEO Accession:GSM2536458 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 1500 | SRP101876 | U2cells_r5.R2.fastq.gz U2cells_r5.R1.fastq.gz | fastq fastq | 5964130536.0 | 58471868.0 | GSM2536458 r1 | 0:51 1:51 | A:1592526357;C:1397499784;G:1378816007;T:1595009850;N:278538 | 51 | 51 | 1592526357 | 1397499784 | 1378816007 | 1595009850 | 278538 | SRX2639462 | SRS2047365 | SRA545799 | GEO | LECO, SERIS, IRSN | 2 | 0.90325 | 0.90838 | 0.0333 | 0.03299 | 0.84684 | 0.84581 | 0.48491 | 0.476 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | France | 2017-03-14 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||
| 41951 | 41951 | SRR5342785 | SRX2639461 | SRS2047364 | SRP101876 | PRJNA379145 | Transcriptomic analysis of depleted uranium effects on adult zebrafish and progeny | GSE96603 | Transcriptome Analysis | This dataset describe the transcriptomic profiling of adult brain gonades testis and ovaries of adult zebrafish exposed to 20µg/L of depleted uranium for 10 days. The progeny of the exposed fishes were also analysed at two cells stage and 96 hpf Overall design: Biological samples adult dissected tissues and whole embryos and larvae were tested by RNASeq in duplicates | pubmed:28531178;pubmed:28831411 | U2cells r3 | GSM2536457 | source name:2 cells embryos|developmental stage:2 cells embryos|tissue:whole embryo|genotype:wild type AB|treatment:progeny of adult exposed fish | U2cells r3 | Base call with CASAVA v1.7 Mapping with RNASTAR and the exon exon reference from ensembl v85 Quantification of reads to genes from RNASTAR output in quantMode GeneCounts Genome build: Zv10 Supplementary files format and content: Non normalized read count at the gene levels ensembl gene identifier from release 85 | 2 cells embryos | exposure of adults to 20µg/L of depleted uranium for 10 days | total RNA extracted from mouse tissu in Trizol Life Technologies TruSeq mRNA version 2 | developmental stage:2 cells embryos|tissue:whole embryo|genotype:wild type AB|treatment:progeny of adult exposed fish | GSM2536457 | GSM2536457: U2cells r3; Danio rerio; RNA Seq | GSM2536457 | 1 | total RNA extracted from mouse tissu in Trizol Life Technologies TruSeq mRNA version 2 | GEO Accession:GSM2536457 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 1500 | SRP101876 | U2cells_r3.R1.fastq.gz U2cells_r3.R2.fastq.gz | fastq fastq | 6071891292.0 | 59528346.0 | GSM2536457 r1 | 0:51 1:51 | A:1621755803;C:1421696553;G:1395635686;T:1632521277;N:281973 | 51 | 51 | 1621755803 | 1421696553 | 1395635686 | 1632521277 | 281973 | SRX2639461 | SRS2047364 | SRA545799 | GEO | LECO, SERIS, IRSN | 2 | 0.89366 | 0.89931 | 0.03914 | 0.03903 | 0.84378 | 0.84307 | 0.47143 | 0.48231 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | France | 2017-03-14 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||
| 41952 | 41952 | SRR5342784 | SRX2639460 | SRS2047363 | SRP101876 | PRJNA379145 | Transcriptomic analysis of depleted uranium effects on adult zebrafish and progeny | GSE96603 | Transcriptome Analysis | This dataset describe the transcriptomic profiling of adult brain gonades testis and ovaries of adult zebrafish exposed to 20µg/L of depleted uranium for 10 days. The progeny of the exposed fishes were also analysed at two cells stage and 96 hpf Overall design: Biological samples adult dissected tissues and whole embryos and larvae were tested by RNASeq in duplicates | pubmed:28531178;pubmed:28831411 | U2cells r1 | GSM2536456 | source name:2 cells embryos|developmental stage:2 cells embryos|tissue:whole embryo|genotype:wild type AB|treatment:progeny of adult exposed fish | U2cells r1 | Base call with CASAVA v1.7 Mapping with RNASTAR and the exon exon reference from ensembl v85 Quantification of reads to genes from RNASTAR output in quantMode GeneCounts Genome build: Zv10 Supplementary files format and content: Non normalized read count at the gene levels ensembl gene identifier from release 85 | 2 cells embryos | exposure of adults to 20µg/L of depleted uranium for 10 days | total RNA extracted from mouse tissu in Trizol Life Technologies TruSeq mRNA version 2 | developmental stage:2 cells embryos|tissue:whole embryo|genotype:wild type AB|treatment:progeny of adult exposed fish | GSM2536456 | GSM2536456: U2cells r1; Danio rerio; RNA Seq | GSM2536456 | 1 | total RNA extracted from mouse tissu in Trizol Life Technologies TruSeq mRNA version 2 | GEO Accession:GSM2536456 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 1500 | SRP101876 | U2cells_r1.R2.fastq.gz U2cells_r1.R1.fastq.gz | fastq fastq | 5816247060.0 | 57022030.0 | GSM2536456 r1 | 0:51 1:51 | A:1522608974;C:1395184383;G:1376342899;T:1521841594;N:269210 | 51 | 51 | 1522608974 | 1395184383 | 1376342899 | 1521841594 | 269210 | SRX2639460 | SRS2047363 | SRA545799 | GEO | LECO, SERIS, IRSN | 2 | 0.89975 | 0.90427 | 0.10054 | 0.0936 | 0.85823 | 0.85689 | 0.5043 | 0.50936 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | France | 2017-03-14 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||
| 41968 | 41968 | SRR5342768 | SRX2639444 | SRS2047346 | SRP101876 | PRJNA379145 | Transcriptomic analysis of depleted uranium effects on adult zebrafish and progeny | GSE96603 | Transcriptome Analysis | This dataset describe the transcriptomic profiling of adult brain gonades testis and ovaries of adult zebrafish exposed to 20µg/L of depleted uranium for 10 days. The progeny of the exposed fishes were also analysed at two cells stage and 96 hpf Overall design: Biological samples adult dissected tissues and whole embryos and larvae were tested by RNASeq in duplicates | pubmed:28531178;pubmed:28831411 | C2cells r4 | GSM2536440 | source name:2 cells embryos|developmental stage:2 cells embryos|tissue:whole embryo|genotype:wild type AB|treatment:progeny of adult exposed fish | C2cells r4 | Base call with CASAVA v1.7 Mapping with RNASTAR and the exon exon reference from ensembl v85 Quantification of reads to genes from RNASTAR output in quantMode GeneCounts Genome build: Zv10 Supplementary files format and content: Non normalized read count at the gene levels ensembl gene identifier from release 85 | 2 cells embryos | exposure of adults to 20µg/L of depleted uranium for 10 days | total RNA extracted from mouse tissu in Trizol Life Technologies TruSeq mRNA version 2 | developmental stage:2 cells embryos|tissue:whole embryo|genotype:wild type AB|treatment:progeny of adult exposed fish | GSM2536440 | GSM2536440: C2cells r4; Danio rerio; RNA Seq | GSM2536440 | 1 | total RNA extracted from mouse tissu in Trizol Life Technologies TruSeq mRNA version 2 | GEO Accession:GSM2536440 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 1500 | SRP101876 | C2cells_r4.R1.fastq.gz C2cells_r4.R2.fastq.gz | fastq fastq | 3300003960.0 | 32352980.0 | GSM2536440 r1 | 0:51 1:51 | A:877113073;C:776373156;G:762054929;T:884344514;N:118288 | 51 | 51 | 877113073 | 776373156 | 762054929 | 884344514 | 118288 | SRX2639444 | SRS2047346 | SRA545799 | GEO | LECO, SERIS, IRSN | 2 | 0.90196 | 0.90844 | 0.03306 | 0.0328 | 0.79764 | 0.79636 | 0.46695 | 0.48136 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | France | 2017-03-14 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||
| 41969 | 41969 | SRR5342767 | SRX2639443 | SRS2047347 | SRP101876 | PRJNA379145 | Transcriptomic analysis of depleted uranium effects on adult zebrafish and progeny | GSE96603 | Transcriptome Analysis | This dataset describe the transcriptomic profiling of adult brain gonades testis and ovaries of adult zebrafish exposed to 20µg/L of depleted uranium for 10 days. The progeny of the exposed fishes were also analysed at two cells stage and 96 hpf Overall design: Biological samples adult dissected tissues and whole embryos and larvae were tested by RNASeq in duplicates | pubmed:28531178;pubmed:28831411 | C2cells r2 | GSM2536439 | source name:2 cells embryos|developmental stage:2 cells embryos|tissue:whole embryo|genotype:wild type AB|treatment:progeny of adult exposed fish | C2cells r2 | Base call with CASAVA v1.7 Mapping with RNASTAR and the exon exon reference from ensembl v85 Quantification of reads to genes from RNASTAR output in quantMode GeneCounts Genome build: Zv10 Supplementary files format and content: Non normalized read count at the gene levels ensembl gene identifier from release 85 | 2 cells embryos | exposure of adults to 20µg/L of depleted uranium for 10 days | total RNA extracted from mouse tissu in Trizol Life Technologies TruSeq mRNA version 2 | developmental stage:2 cells embryos|tissue:whole embryo|genotype:wild type AB|treatment:progeny of adult exposed fish | GSM2536439 | GSM2536439: C2cells r2; Danio rerio; RNA Seq | GSM2536439 | 1 | total RNA extracted from mouse tissu in Trizol Life Technologies TruSeq mRNA version 2 | GEO Accession:GSM2536439 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 1500 | SRP101876 | C2cells_r2.R1.fastq.gz C2cells_r2.R2.fastq.gz | fastq fastq | 4328084094.0 | 42432197.0 | GSM2536439 r1 | 0:51 1:51 | A:1158380082;C:1008794068;G:997545913;T:1163205286;N:158745 | 51 | 51 | 1158380082 | 1008794068 | 997545913 | 1163205286 | 158745 | SRX2639443 | SRS2047347 | SRA545799 | GEO | LECO, SERIS, IRSN | 2 | 0.91032 | 0.91669 | 0.03107 | 0.03089 | 0.80665 | 0.80576 | 0.47144 | 0.4782 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | France | 2017-03-14 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||
| 41970 | 41970 | SRR5342766 | SRX2639442 | SRS2047345 | SRP101876 | PRJNA379145 | Transcriptomic analysis of depleted uranium effects on adult zebrafish and progeny | GSE96603 | Transcriptome Analysis | This dataset describe the transcriptomic profiling of adult brain gonades testis and ovaries of adult zebrafish exposed to 20µg/L of depleted uranium for 10 days. The progeny of the exposed fishes were also analysed at two cells stage and 96 hpf Overall design: Biological samples adult dissected tissues and whole embryos and larvae were tested by RNASeq in duplicates | pubmed:28531178;pubmed:28831411 | C2cells r1 | GSM2536438 | source name:2 cells embryos|developmental stage:2 cells embryos|tissue:whole embryo|genotype:wild type AB|treatment:progeny of adult exposed fish | C2cells r1 | Base call with CASAVA v1.7 Mapping with RNASTAR and the exon exon reference from ensembl v85 Quantification of reads to genes from RNASTAR output in quantMode GeneCounts Genome build: Zv10 Supplementary files format and content: Non normalized read count at the gene levels ensembl gene identifier from release 85 | 2 cells embryos | exposure of adults to 20µg/L of depleted uranium for 10 days | total RNA extracted from mouse tissu in Trizol Life Technologies TruSeq mRNA version 2 | developmental stage:2 cells embryos|tissue:whole embryo|genotype:wild type AB|treatment:progeny of adult exposed fish | GSM2536438 | GSM2536438: C2cells r1; Danio rerio; RNA Seq | GSM2536438 | 1 | total RNA extracted from mouse tissu in Trizol Life Technologies TruSeq mRNA version 2 | GEO Accession:GSM2536438 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 1500 | SRP101876 | C2cells_r1.R1.fastq.gz C2cells_r1.R2.fastq.gz | fastq fastq | 6958698162.0 | 68222531.0 | GSM2536438 r1 | 0:51 1:51 | A:1843299293;C:1637271642;G:1612150278;T:1865725254;N:251695 | 51 | 51 | 1843299293 | 1637271642 | 1612150278 | 1865725254 | 251695 | SRX2639442 | SRS2047345 | SRA545799 | GEO | LECO, SERIS, IRSN | 2 | 0.91123 | 0.91534 | 0.05094 | 0.04945 | 0.79758 | 0.79651 | 0.49208 | 0.4852 | 51 | 51 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | France | 2017-03-14 | Cleavage | Embryo | Whole Organism | All anatomical structures | |||||||||||
| 44071 | 44071 | SRR6246043 | SRX3353217 | SRS2652437 | SRP123447 | PRJNA416866 | Functional genomic and transcriptomic analysis of amphioxus and the origin of vertebrate genomic traits [RNA Seq] | GSE106430 | Other | What genomic changes led to the origin of vertebrates remains a mystery. On the one hand animal evolution is thought to be driven mostly by changes in the cis regulatory regions of a shared conserved and toolkit of developmental genes. On the other hand vertebrates experienced two rounds of whole genome duplication WGD that increased their gene repertoire particularly of regulatory genes controlling embryo development. To shed light into the origin and evolution of the vertebrate regulatory genome we have generated an unprecedented transcriptomic and epigenomic resource for the non duplicated genome of the European amphioxus a closely related invertebrate chordate. These data include RNA seq for more than 35 developmental stages and adult tissues CAGE seq ChIP seq bisulphite seq and ATAC seq for several developmental stages and adult tissues. By comparing these data sets with equivalent novel and previously available data for various vertebrate species especially zebrafish we uncovered multiple conserved and vertebrate specific regulatory landmarks. We first identify a conserved chordate phylotypic stage a developmental period in which different chordate species show the highest gene expression similarity. We also shed light on the origin of enhancer demethylation in vertebrates by identifying for the first time in an invertebrate species differentially methylated enhancers. Furthermore we show that conserved clusters of co expressed and tissue specific genes display similar enrichments for cis regulatory motifs between amphioxus and vertebrates. Finally we study the impact of vertebrate WGDs on the evolution of gene regulation providing the first genome wide quantitative assessment of sub functionalization and neo functionalization processes post the vertebrate WGDs; changing the way in which these evolutionary mechanisms have been traditionally understood. Overall design: RNA seq assays in different developmental stages of european amphioxus zebrafish and medaka | parent bioproject:PRJNA416859 | pubmed:30464347 | RNAseq zebrafish 2 hpf | GSM2837572 | tissue:whole embryo|developmental stage:2 hpf | RNAseq zebrafish 2 hpf | Reads were aligned against reference genome using Tophat2 software and gene models were built using Cufflinks. Genome build: Amphioxus Bl71nemr Genomic sequencing data was submitted to ENA under the master PRJEB13665 accession Zebrafish September 2014 GRCz10/danRer10 Medaka October 2005 oryLat2. Supplementary files format and content: Individual RPKM files reads per kilobase per million mapped reads for amphioxus and zebrafish. Complete table of TPM transcripts per million for medaka. | whole embryo | Embryos were fixed in RNAlater Thermo Fisher Scientific and RNA extracted using RNeasy Mini Kit Qiagen | Embryos were cultivated at 28°C in E3 medium until desired developmental stage | developmental stage:2 hpf | GSM2837572 | GSM2837572: RNAseq zebrafish 2 hpf; Danio rerio; RNA Seq | GSM2837572 | 1 | Embryos were fixed in RNAlater Thermo Fisher Scientific and RNA extracted using RNeasy Mini Kit Qiagen | GEO Accession:GSM2837572 | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina HiSeq 2500 | SRP123447 | RNAseq_zebra_2hpf_1.fq.gz RNAseq_zebra_2hpf_2.fq.gz | fastq fastq | 17109578000.0 | 68438312.0 | GSM2837572 r1 | 0:125 1:125 | A:4536550134;C:4009266695;G:4076560218;T:4484964079;N:2236874 | 125 | 125 | 4536550134 | 4009266695 | 4076560218 | 4484964079 | 2236874 | SRX3353217 | SRS2652437 | SRA627467 | GEO | CABD/CSIC | 2 | 0.9622 | 0.96459 | 0.02758 | 0.02719 | 0.7713 | 0.77327 | 0.48657 | 0.48547 | 125 | 125 | B | B | biological fallback assumption | illumina | hiseq_era | unknown | random_priming | unknown | bulk | unknown | unknown | Spain | 2017-11-02 | Cleavage | Embryo | Whole Organism | All anatomical structures |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;