run_metadata
35 rows where devstage_curation = "Adult" and tissue_curation = "BCR TCR repertoire"
This data as json, CSV (advanced)
| Link | rowid ▼ | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 68262 | 68262 | SRR099333 | SRX041597 | SRS172447 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode TAGTATCAGC | 4432 1Y D | 4432 1Y D | 1 | 4432 1Y D | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 72592827.0 | 232367.0 | 4432 1Y D | 0:4 1:308.41 | 4 | 308 | SRX041597 | SRS172447 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.13098 | 0.04666 | 0.99943 | 0.00078 | 195 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68263 | 68263 | SRR099332 | SRX041596 | SRS172446 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode TAGTATCAGC | 4432 1Y C9 | 4432 1Y C9 | 1 | 4432 1Y C9 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 78320127.0 | 261806.0 | 4432 1Y C9 | 0:4 1:295.15 | 4 | 295 | SRX041596 | SRS172446 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.20079 | 0.01319 | 0.99971 | 0.0004 | 37 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68264 | 68264 | SRR099331 | SRX041595 | SRS172445 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC | 4432 1Y B8 | 4432 1Y B8 | 1 | 4432 1Y B8 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 46900878.0 | 156154.0 | 4432 1Y B8 | 0:4 1:296.35 | 4 | 296 | SRX041595 | SRS172445 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.21827 | 0.01485 | 0.99961 | 0.00018 | 37 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68265 | 68265 | SRR099330 | SRX041594 | SRS172444 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA | 4432 1Y A7 | 4432 1Y A7 | 1 | 4432 1Y A7 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 22543768.0 | 73425.0 | 4432 1Y A7 | 0:4 1:303.03 | 4 | 303 | SRX041594 | SRS172444 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.16879 | 0.02006 | 0.99973 | 0.00063 | 89 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68266 | 68266 | SRR099325 | SRX041593 | SRS172443 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode ATATCGCGAG | 4430 1Y C6 | 4430 1Y C6 | 1 | 4430 1Y C6 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 38479526.0 | 134024.0 | 4430 1Y C6 | 0:4 1:283.11 | 4 | 283 | SRX041593 | SRS172443 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.11658 | 0.00464 | 0.99928 | 0.00323 | 37 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68267 | 68267 | SRR099324 | SRX041592 | SRS172442 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode ATCAGACACG | 4430 1Y B5 | 4430 1Y B5 | 1 | 4430 1Y B5 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 83990641.0 | 290583.0 | 4430 1Y B5 | 0:4 1:285.04 | 4 | 285 | SRX041592 | SRS172442 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.20603 | 0.01554 | 0.99967 | 0.00038 | 37 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68268 | 68268 | SRR099323 | SRX041591 | SRS172441 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode AGCACTGTAG | 4430 1Y A4 | 4430 1Y A4 | 1 | 4430 1Y A4 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 27578630.0 | 90031.0 | 4430 1Y A4 | 0:4 1:302.32 | 4 | 302 | SRX041591 | SRS172441 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.12444 | 0.0197 | 0.99975 | 0.00096 | 37 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68269 | 68269 | SRR099322 | SRX041590 | SRS172440 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode AGACGCACTC | 4428 1Y C3 | 4428 1Y C3 | 1 | 4428 1Y C3 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 62333740.0 | 194228.0 | 4428 1Y C3 | 0:4 1:316.93 | 4 | 316 | SRX041590 | SRS172440 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.1865 | 0.02265 | 0.99947 | 0.00049 | 37 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68270 | 68270 | SRR099321 | SRX041589 | SRS172439 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode ACGCTCGACA | 4428 1Y B2 | 4428 1Y B2 | 1 | 4428 1Y B2 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 104263503.0 | 333602.0 | 4428 1Y B2 | 0:4 1:308.54 | 4 | 308 | SRX041589 | SRS172439 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.15679 | 0.02871 | 0.99953 | 0.00044 | 37 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68271 | 68271 | SRR099320 | SRX041588 | SRS172438 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode ACGAGTGCGT | 4428 1Y A1 | 4428 1Y A1 | 1 | 4428 1Y A1 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 18763476.0 | 59560.0 | 4428 1Y A1 | 0:4 1:311.03 | 4 | 311 | SRX041588 | SRS172438 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.13922 | 0.01452 | 0.99971 | 0.00094 | 160 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68272 | 68272 | SRR099364 | SRX041587 | SRS172437 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TGATACGTCT | 4433 6M D | 4433 6M D | 1 | 4433 6M D | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 101345153.0 | 290438.0 | 4433 6M D | 0:4 1:344.94 | 4 | 344 | SRX041587 | SRS172437 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.14815 | 0.01925 | 0.99908 | 0.00202 | 155 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68273 | 68273 | SRR099363 | SRX041586 | SRS172436 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TCTCTATGCG | 4433 6M C | 4433 6M C | 1 | 4433 6M C | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 75770901.0 | 213529.0 | 4433 6M C | 0:4 1:350.85 | 4 | 350 | SRX041586 | SRS172436 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.14445 | 0.01047 | 0.99878 | 0.00299 | 57 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68274 | 68274 | SRR099362 | SRX041585 | SRS172435 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TAGTATCAGC | 4433 6M B | 4433 6M B | 1 | 4433 6M B | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 67192817.0 | 194503.0 | 4433 6M B | 0:4 1:341.46 | 4 | 341 | SRX041585 | SRS172435 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.13467 | 0.01249 | 0.99914 | 0.00222 | 37 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68275 | 68275 | SRR099361 | SRX041584 | SRS172434 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC | 4433 6M A | 4433 6M A | 1 | 4433 6M A | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 72299403.0 | 207618.0 | 4433 6M A | 0:4 1:344.23 | 4 | 344 | SRX041584 | SRS172434 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.1041 | 0.01046 | 0.99764 | 0.00892 | 64 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68276 | 68276 | SRR099348 | SRX041583 | SRS172433 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA | 4432 6M G | 4432 6M G | 1 | 4432 6M G | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 79715586.0 | 227631.0 | 4432 6M G | 0:4 1:346.20 | 4 | 346 | SRX041583 | SRS172433 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.11472 | 0.01795 | 0.99898 | 0.00298 | 103 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68277 | 68277 | SRR099347 | SRX041582 | SRS172432 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode ATATCGCGAG | 4432 6M F | 4432 6M F | 1 | 4432 6M F | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 72024740.0 | 203769.0 | 4432 6M F | 0:4 1:349.46 | 4 | 349 | SRX041582 | SRS172432 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.11535 | 0.01205 | 0.99855 | 0.00395 | 40 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68278 | 68278 | SRR099346 | SRX041581 | SRS172431 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode ATCAGACACG | 4432 6M E | 4432 6M E | 1 | 4432 6M E | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 65072237.0 | 190441.0 | 4432 6M E | 0:4 1:337.69 | 4 | 337 | SRX041581 | SRS172431 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.11698 | 0.01584 | 0.99823 | 0.00583 | 65 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68279 | 68279 | SRR099345 | SRX041580 | SRS172430 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode AGCACTGTAG | 4432 6M D | 4432 6M D | 1 | 4432 6M D | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 74122161.0 | 211816.0 | 4432 6M D | 0:4 1:345.94 | 4 | 345 | SRX041580 | SRS172430 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.10275 | 0.01376 | 0.99912 | 0.00377 | 57 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68280 | 68280 | SRR099344 | SRX041579 | SRS172429 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode AGACGCACTC | 4432 6M C | 4432 6M C | 1 | 4432 6M C | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 78171765.0 | 220585.0 | 4432 6M C | 0:4 1:350.38 | 4 | 350 | SRX041579 | SRS172429 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.13401 | 0.0146 | 0.99711 | 0.01012 | 222 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68281 | 68281 | SRR099343 | SRX041578 | SRS172428 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode ACGCTCGACA | 4432 6M B | 4432 6M B | 1 | 4432 6M B | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 75262808.0 | 217309.0 | 4432 6M B | 0:4 1:342.34 | 4 | 342 | SRX041578 | SRS172428 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.16193 | 0.00604 | 0.99685 | 0.00701 | 452 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68282 | 68282 | SRR099342 | SRX041577 | SRS172427 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode ACGAGTGCGT | 4432 6M A | 4432 6M A | 1 | 4432 6M A | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 66235952.0 | 184208.0 | 4432 6M A | 0:4 1:355.57 | 4 | 355 | SRX041577 | SRS172427 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.10428 | 0.01655 | 0.99661 | 0.01505 | 183 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68283 | 68283 | SRR099370 | SRX041576 | SRS172426 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TACTGAGCTA | F2 2 | F2 2 | 1 | F2 2 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 64641127.0 | 184383.0 | F2 2 | 0:4 1:346.58 | 4 | 346 | SRX041576 | SRS172426 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.23604 | 0.01003 | 0.99959 | 0.00028 | 37 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68284 | 68284 | SRR099369 | SRX041575 | SRS172425 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TGATACGTCT | E2 2 | E2 2 | 1 | E2 2 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 66206147.0 | 181029.0 | E2 2 | 0:4 1:361.72 | 4 | 361 | SRX041575 | SRS172425 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.13216 | 0.00596 | 0.99949 | 0.00054 | 101 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68285 | 68285 | SRR099368 | SRX041574 | SRS172424 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TGATACGTCT | D2 2 | D2 2 | 1 | D2 2 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 190136862.0 | 562067.0 | D2 2 | 0:4 1:334.28 | 4 | 334 | SRX041574 | SRS172424 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.25384 | 0.03443 | 0.99933 | 0.00056 | 416 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68286 | 68286 | SRR099367 | SRX041573 | SRS172423 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TAGTATCAGC | C2 2 | C2 2 | 1 | C2 2 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 118356460.0 | 367001.0 | C2 2 | 0:4 1:318.50 | 4 | 318 | SRX041573 | SRS172423 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.18882 | 0.02167 | 0.99969 | 9e-05 | 40 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68287 | 68287 | SRR099366 | SRX041572 | SRS172422 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC | B2 2 | B2 2 | 1 | B2 2 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 24757877.0 | 69408.0 | B2 2 | 0:4 1:352.70 | 4 | 352 | SRX041572 | SRS172422 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.12537 | 0.01076 | 0.99975 | 0.00029 | 37 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68288 | 68288 | SRR099365 | SRX041571 | SRS172421 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA | A2 2 | A2 2 | 1 | A2 2 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 765824405.0 | 2575264.0 | A2 2 | 0:4 1:293.38 | 4 | 293 | SRX041571 | SRS172421 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.18359 | 0.017 | 0.99892 | 0.00154 | 152 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68289 | 68289 | SRR099360 | SRX041570 | SRS172420 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC or with no barcode leading with either IgM reverse primer TGCACTGAGACAAACCGAAG or IgZ reverse primer TCAGAGGCCAGACATCCAAT | 4433 3MA DT | 4433 3MA DT | 1 | 4433 3MA DT | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 56064850.0 | 187695.0 | 4433 3MA DT | 0:4 1:294.70 | 4 | 294 | SRX041570 | SRS172420 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.3144 | 0.00306 | 0.99987 | 0.0 | 106 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68290 | 68290 | SRR099359 | SRX041569 | SRS172419 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA | 4433 3MA C7 | 4433 3MA C7 | 1 | 4433 3MA C7 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 96179902.0 | 300329.0 | 4433 3MA C7 | 0:4 1:316.25 | 4 | 316 | SRX041569 | SRS172419 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.1804 | 0.01829 | 0.99953 | 0.00028 | 468 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68291 | 68291 | SRR099358 | SRX041568 | SRS172418 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode ATATCGCGAG | 4433 3MA B6 | 4433 3MA B6 | 1 | 4433 3MA B6 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 50421822.0 | 147276.0 | 4433 3MA B6 | 0:4 1:338.36 | 4 | 338 | SRX041568 | SRS172418 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.19259 | 0.00589 | 0.99955 | 0.00065 | 99 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68292 | 68292 | SRR099357 | SRX041567 | SRS172417 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode ATCAGACACG | 4433 3MA A5 | 4433 3MA A5 | 1 | 4433 3MA A5 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 156064156.0 | 515822.0 | 4433 3MA A5 | 0:4 1:298.55 | 4 | 298 | SRX041567 | SRS172417 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.22633 | 0.01233 | 0.99971 | 0.00016 | 40 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68293 | 68293 | SRR099341 | SRX041566 | SRS172416 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode AGCACTGTAG | 4432 3MA D4 | 4432 3MA D4 | 1 | 4432 3MA D4 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 61903651.0 | 206769.0 | 4432 3MA D4 | 0:4 1:295.39 | 4 | 295 | SRX041566 | SRS172416 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.23888 | 0.01136 | 0.99953 | 0.00047 | 58 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68294 | 68294 | SRR099340 | SRX041565 | SRS172415 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode AGACGCACTC | 4432 3MA C3 | 4432 3MA C3 | 1 | 4432 3MA C3 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 37914122.0 | 116980.0 | 4432 3MA C3 | 0:4 1:320.11 | 4 | 320 | SRX041565 | SRS172415 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.19288 | 0.0142 | 0.99955 | 0.00034 | 125 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68295 | 68295 | SRR099339 | SRX041564 | SRS172414 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode ACGCTCGACA | 4432 3MA B2 | 4432 3MA B2 | 1 | 4432 3MA B2 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 89178437.0 | 298194.0 | 4432 3MA B2 | 0:4 1:295.06 | 4 | 295 | SRX041564 | SRS172414 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.21059 | 0.00985 | 0.99969 | 0.00012 | 107 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System | ||||||||||||||||||||||||||||||||
| 68296 | 68296 | SRR099338 | SRX041563 | SRS172413 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode ACGAGTGCGT | 4432 3MA A1 | 4432 3MA A1 | 1 | 4432 3MA A1 | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 59101536.0 | 194332.0 | 4432 3MA A1 | 0:4 1:300.13 | 4 | 300 | SRX041563 | SRS172413 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.26977 | 0.00958 | 0.99971 | 0.00015 | 69 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System |
Advanced export
JSON shape: default, array, newline-delimited
CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;