metadata: run_metadata: 42 rows where devstage_curation = "Adult" and experiment.platform = "LS454"

42 rows where devstage_curation = "Adult" and experiment.platform = "LS454"

descending

Link	rowid ▼	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.PMIDs	sample.description	sample.title	sample.alias	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.nofeature_rate.mate1	seqdetective.sparsity.mate1	seqdetective.pos_strand_rate.mate1	seqdetective.readlen.mate1	seqdetective.judgement.mate1	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
39609	39609	SRR1873571	SRX915251	SRS870223	SRP056014	PRJNA277780	Identification of small non coding RNAs in zebrafish	GSE66718	Transcriptome Analysis	MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes namely developmental timing cell differentiation cell proliferation immune response and infection. For this reason their identification is essential to understand eukaryotic biology. Their small size low abundance and high instability complicated early identification; however cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages namely 24 hpf 72 hpf 96 hpf 5 dpf dpf 45 dpf young adult and from adult brain eyes gills heart skin and fins.	pubmed:26694924		fins	GSM1630515	source name:adult fins 1 year old\|strain/background:AB\|genotype/variation:wild type\|tissue:fins\|developmental stage:adult\|age:1 year	fins	Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12 the traditional blast output and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept and using the remaining alignments as guidelines the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation using miRDeep. To overcome the inherent lack of sensitivity of miRDeep novel transcripts encoding miRNAs…	adult fins 1 year old	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	Wild type AB zebrafish strain was maintained at 28ºC on a 14 h light/10 h dark cycle.	strain/background:AB\|genotype/variation:wild type\|tissue:fins\|developmental stage:adult\|age:1 year	GSM1630515	GSM1630515: fins; Danio rerio; miRNA Seq	GSM1630515		1	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	GEO Accession:GSM1630515	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	LS454	454 GS FLX		SRP056014	113161.0	2108.0	GSM1630515 r1	0:4 1:49.68	A:30303;C:30710;G:27210;T:24785;N:153	4	49	30303	30710	27210	24785	153	SRX915251	SRS870223	SRA246117	GEO	University of Aveiro	1	0.0	0.0	1.0		50	T	under 1.2% mapping rate	legacy	early	3prime	size_fractionation	unknown	bulk	other_seq	454	Portugal	2015-03-09	Adult	Adult	Fin	Surface Structure
39610	39610	SRR1873570	SRX915250	SRS870224	SRP056014	PRJNA277780	Identification of small non coding RNAs in zebrafish	GSE66718	Transcriptome Analysis	MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes namely developmental timing cell differentiation cell proliferation immune response and infection. For this reason their identification is essential to understand eukaryotic biology. Their small size low abundance and high instability complicated early identification; however cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages namely 24 hpf 72 hpf 96 hpf 5 dpf dpf 45 dpf young adult and from adult brain eyes gills heart skin and fins.	pubmed:26694924		skin	GSM1630514	source name:adult skin 1 year old\|strain/background:AB\|genotype/variation:wild type\|tissue:skin\|developmental stage:adult\|age:1 year	skin	Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12 the traditional blast output and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept and using the remaining alignments as guidelines the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation using miRDeep. To overcome the inherent lack of sensitivity of miRDeep novel transcripts encoding miRNAs…	adult skin 1 year old	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	Wild type AB zebrafish strain was maintained at 28ºC on a 14 h light/10 h dark cycle.	strain/background:AB\|genotype/variation:wild type\|tissue:skin\|developmental stage:adult\|age:1 year	GSM1630514	GSM1630514: skin; Danio rerio; miRNA Seq	GSM1630514		1	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	GEO Accession:GSM1630514	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	LS454	454 GS FLX		SRP056014	79232.0	1527.0	GSM1630514 r1	0:4 1:47.89	A:20622;C:23508;G:19017;T:15967;N:118	4	47	20622	23508	19017	15967	118	SRX915250	SRS870224	SRA246117	GEO	University of Aveiro	1	0.0	0.0	1.0		53	T	under 1.2% mapping rate	legacy	early	3prime	size_fractionation	unknown	bulk	other_seq	454	Portugal	2015-03-09	Adult	Adult	Skin	Surface Structure
39611	39611	SRR1873569	SRX915249	SRS870225	SRP056014	PRJNA277780	Identification of small non coding RNAs in zebrafish	GSE66718	Transcriptome Analysis	MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes namely developmental timing cell differentiation cell proliferation immune response and infection. For this reason their identification is essential to understand eukaryotic biology. Their small size low abundance and high instability complicated early identification; however cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages namely 24 hpf 72 hpf 96 hpf 5 dpf dpf 45 dpf young adult and from adult brain eyes gills heart skin and fins.	pubmed:26694924		heart	GSM1630513	source name:adult heart 1 year old\|strain/background:AB\|genotype/variation:wild type\|tissue:heart\|developmental stage:adult\|age:1 year	heart	Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12 the traditional blast output and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept and using the remaining alignments as guidelines the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation using miRDeep. To overcome the inherent lack of sensitivity of miRDeep novel transcripts encoding miRNAs…	adult heart 1 year old	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	Wild type AB zebrafish strain was maintained at 28ºC on a 14 h light/10 h dark cycle.	strain/background:AB\|genotype/variation:wild type\|tissue:heart\|developmental stage:adult\|age:1 year	GSM1630513	GSM1630513: heart; Danio rerio; miRNA Seq	GSM1630513		1	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	GEO Accession:GSM1630513	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	LS454	454 GS FLX		SRP056014	39500.0	711.0	GSM1630513 r1	0:4 1:51.56	A:11300;C:9125;G:9195;T:9835;N:45	4	51	11300	9125	9195	9835	45	SRX915249	SRS870225	SRA246117	GEO	University of Aveiro	1	0.0	0.0	1.0		53	T	under 1.2% mapping rate	legacy	early	3prime	size_fractionation	unknown	bulk	other_seq	454	Portugal	2015-03-09	Adult	Adult	Heart	Cardiovascular System
39612	39612	SRR1873568	SRX915248	SRS870226	SRP056014	PRJNA277780	Identification of small non coding RNAs in zebrafish	GSE66718	Transcriptome Analysis	MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes namely developmental timing cell differentiation cell proliferation immune response and infection. For this reason their identification is essential to understand eukaryotic biology. Their small size low abundance and high instability complicated early identification; however cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages namely 24 hpf 72 hpf 96 hpf 5 dpf dpf 45 dpf young adult and from adult brain eyes gills heart skin and fins.	pubmed:26694924		gills	GSM1630512	source name:adult gills 1 year old\|strain/background:AB\|genotype/variation:wild type\|tissue:gills\|developmental stage:adult\|age:1 year	gills	Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12 the traditional blast output and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept and using the remaining alignments as guidelines the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation using miRDeep. To overcome the inherent lack of sensitivity of miRDeep novel transcripts encoding miRNAs…	adult gills 1 year old	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	Wild type AB zebrafish strain was maintained at 28ºC on a 14 h light/10 h dark cycle.	strain/background:AB\|genotype/variation:wild type\|tissue:gills\|developmental stage:adult\|age:1 year	GSM1630512	GSM1630512: gills; Danio rerio; miRNA Seq	GSM1630512		1	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	GEO Accession:GSM1630512	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	LS454	454 GS FLX		SRP056014	189248.0	3563.0	GSM1630512 r1	0:4 1:49.11	A:48212;C:55198;G:44765;T:40711;N:362	4	49	48212	55198	44765	40711	362	SRX915248	SRS870226	SRA246117	GEO	University of Aveiro	1	0.0	0.0	1.0		44	T	under 1.2% mapping rate	legacy	early	3prime	size_fractionation	unknown	bulk	other_seq	454	Portugal	2015-03-09	Adult	Adult	Gill	Respiratory System
39613	39613	SRR1873567	SRX915247	SRS870227	SRP056014	PRJNA277780	Identification of small non coding RNAs in zebrafish	GSE66718	Transcriptome Analysis	MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes namely developmental timing cell differentiation cell proliferation immune response and infection. For this reason their identification is essential to understand eukaryotic biology. Their small size low abundance and high instability complicated early identification; however cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages namely 24 hpf 72 hpf 96 hpf 5 dpf dpf 45 dpf young adult and from adult brain eyes gills heart skin and fins.	pubmed:26694924		eyes	GSM1630511	source name:adult eyes 1 year old\|strain/background:AB\|genotype/variation:wild type\|tissue:eyes\|developmental stage:adult\|age:1 year	eyes	Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12 the traditional blast output and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept and using the remaining alignments as guidelines the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation using miRDeep. To overcome the inherent lack of sensitivity of miRDeep novel transcripts encoding miRNAs…	adult eyes 1 year old	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	Wild type AB zebrafish strain was maintained at 28ºC on a 14 h light/10 h dark cycle.	strain/background:AB\|genotype/variation:wild type\|tissue:eyes\|developmental stage:adult\|age:1 year	GSM1630511	GSM1630511: eyes; Danio rerio; miRNA Seq	GSM1630511		1	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	GEO Accession:GSM1630511	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	LS454	454 GS FLX		SRP056014	173069.0	3135.0	GSM1630511 r1	0:4 1:51.21	A:50732;C:44705;G:40960;T:36324;N:348	4	51	50732	44705	40960	36324	348	SRX915247	SRS870227	SRA246117	GEO	University of Aveiro	1	0.0	0.0	1.0		52	T	under 1.2% mapping rate	legacy	early	3prime	size_fractionation	unknown	bulk	other_seq	454	Portugal	2015-03-09	Adult	Adult	Eye	Sensory System
39614	39614	SRR1873566	SRX915246	SRS870228	SRP056014	PRJNA277780	Identification of small non coding RNAs in zebrafish	GSE66718	Transcriptome Analysis	MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes namely developmental timing cell differentiation cell proliferation immune response and infection. For this reason their identification is essential to understand eukaryotic biology. Their small size low abundance and high instability complicated early identification; however cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages namely 24 hpf 72 hpf 96 hpf 5 dpf dpf 45 dpf young adult and from adult brain eyes gills heart skin and fins.	pubmed:26694924		brain	GSM1630510	source name:adult brain 1 year old\|strain/background:AB\|genotype/variation:wild type\|tissue:brain\|developmental stage:adult\|age:1 year	brain	Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12 the traditional blast output and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept and using the remaining alignments as guidelines the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation using miRDeep. To overcome the inherent lack of sensitivity of miRDeep novel transcripts encoding miRNAs…	adult brain 1 year old	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	Wild type AB zebrafish strain was maintained at 28ºC on a 14 h light/10 h dark cycle.	strain/background:AB\|genotype/variation:wild type\|tissue:brain\|developmental stage:adult\|age:1 year	GSM1630510	GSM1630510: brain; Danio rerio; miRNA Seq	GSM1630510		1	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	GEO Accession:GSM1630510	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	LS454	454 GS FLX		SRP056014	688279.0	12620.0	GSM1630510 r1	0:4 1:50.54	A:205782;C:180028;G:171745;T:129693;N:1031	4	50	205782	180028	171745	129693	1031	SRX915246	SRS870228	SRA246117	GEO	University of Aveiro	1	0.0	0.0	1.0		48	T	under 1.2% mapping rate	legacy	early	3prime	size_fractionation	unknown	bulk	other_seq	454	Portugal	2015-03-09	Adult	Adult	Brain	Nervous System
39615	39615	SRR1873565	SRX915245	SRS870229	SRP056014	PRJNA277780	Identification of small non coding RNAs in zebrafish	GSE66718	Transcriptome Analysis	MicroRNAs miRNAs are a new class of small RNAs of approximately 22 nucleotides in length that control eukaryotic gene expression by fine tuning mRNA translation. They regulate a wide variety of biological processes namely developmental timing cell differentiation cell proliferation immune response and infection. For this reason their identification is essential to understand eukaryotic biology. Their small size low abundance and high instability complicated early identification; however cloning/Sanger sequencing and new generation genome sequencing approaches overcame most technical hurdles and are being used for rapid miRNA identification in many eukaryotes. We have applied 454 DNA pyrosequencing technology to miRNA discovery in zebrafish Danio rerio. For this a series of cDNA libraries were prepared from small non coding RNAs isolated at different embryonic time points and from fully developed organs. Each cDNA library was tagged with specific sequences and was sequenced using the Roche FLX genome sequencer. This approach retrieved 90% of the 192 miRNAs previously identified by cloning/Sanger sequencing and bioinformatics and 25 novel miRNAs were predicted. Overall design: Small RNA libraries were prepared from different zebrafish developmental stages namely 24 hpf 72 hpf 96 hpf 5 dpf dpf 45 dpf young adult and from adult brain eyes gills heart skin and fins.	pubmed:26694924		adult	GSM1630509	source name:entire adult\|strain/background:AB\|genotype/variation:wild type\|tissue:whole body\|developmental stage:adult\|age:1 year	adult	Base calling and quality trimming of sequence reads was carried out using the Genome Sequencer FLX software. Raw images were processed to remove background noise and the data was normalized. TAGs and adapter sequences of zebrafish developmental and adult tissues samples were then identified and trimmed and those reads with correct TAGs and adapters > 15 nt were retrieved for downstream analysis using the miRDeep software https://www.mdc berlin.de/8551903/en/. miRDeep aligned the sequences against the zebrafish genome using megaBlast with seed length set at 12 the traditional blast output and minimum local identity set at 100. The blast output was then parsed for miRDeep uploading and aligned sequences with a maximum of 2 mismatches in the three prime end were retrieved. Reads that matched more than 10 different genome loci were discarded and only those with one or more alignments were kept and using the remaining alignments as guidelines the potential precursors were excised from the genome. The secondary structure of putative precursors was predicted using RNAfold and signatures were created by retaining reads that aligned perfectly with those putative precursors to generate the signature format. Finally miRDeep predicted miRNAs by discarding non plausible Dicer products and scoring plausible ones. To assess seed conservation plausible Dicer processing sequences were blasted against a local version of mature miRNAs from miRBase 12.0 that lacked zebrafish miRNA sequences. Borderline miRNA candidates were also resolved by determining their relative stability using Randfold. To distinguish between novel and known miRNAs selected pre miRNAs were blasted against Danio rerio stem loop sequences miRBase and those that did not produce any or produced imperfect alignments were scored as novel miRNAs. Pairs of signatures and structures were used to estimate the number of false positives by randomly permutation using miRDeep. To overcome the inherent lack of sensitivity of miRDeep novel transcripts encoding miRNAs…	entire adult	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	Wild type AB zebrafish strain was maintained at 28ºC on a 14 h light/10 h dark cycle.	strain/background:AB\|genotype/variation:wild type\|tissue:whole body\|developmental stage:adult\|age:1 year	GSM1630509	GSM1630509: adult; Danio rerio; miRNA Seq	GSM1630509		1	100 μg of total RNA from each sample was isolated using TRIzol® and small RNAs were enriched by differential precipitation using polyethylene glycol. Total RNAs were fractioned using 12% denaturing PAGE and small RNAs of 15 30 nt were gel isolated using Gel Filtration cartridges from Edge Biosystems. For cDNA synthesis the small RNA molecules previously isolated were first ligated to a three prime adapter AMP five primep five primep/CTGTAGGCACCATCAATdi deoxyC three prime in absence of ATP and gel excised in the range of 35 and 50 nt. A second ligation was performed with the five prime adapter "Nelson's linker" five primeATCGTrArGrGrCrArCrCrUrGrArArA three prime for 1 hour at 37°C followed by phenol extraction. First strand cDNA synthesis was then performed using a specific three prime primer and Superscript™ III reverse transcriptase Invitrogen. RNase H treated cDNA was PCR amplified with adapter specific primers. Each sample contained a specific TAG constituted by 3 nucleotides as detailed next. 24hpf ATC; 72hpf ACT; 96hpf CAG; 5dpf ATG; 45dpf CCG; entire adult GTA; brain CGG; Heart CTG; Eyes GCT; fins GTT; skin TAC; gills TCC. PCR products were then run on 10% denaturing PAGE containing 7 M urea and the corresponding band 100 nt was eluted from the gel with Probe Elution Buffer from Ambion at 37°C overnight. These products were used for the emulsion PCR. Parallel DNA pyrosequencing was performed using the Genome Sequencer FLX Roche following established protocols for DNA library sequencing.	GEO Accession:GSM1630509	miRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	LS454	454 GS FLX		SRP056014	361024.0	6498.0	GSM1630509 r1	0:4 1:51.56	A:104704;C:84406;G:83224;T:87843;N:847	4	51	104704	84406	83224	87843	847	SRX915245	SRS870229	SRA246117	GEO	University of Aveiro	1	0.0	0.0	1.0		51	T	under 1.2% mapping rate	legacy	early	3prime	size_fractionation	unknown	bulk	other_seq	454	Portugal	2015-03-09	Adult	Adult	Trunk	Surface Structure
68262	68262	SRR099333	SRX041597	SRS172447	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode TAGTATCAGC	4432 1Y D	4432 1Y D									1	4432 1Y D	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	72592827.0	232367.0	4432 1Y D	0:4 1:308.41		4	308						SRX041597	SRS172447	SRA029829	Stanford University\|Quake	Stanford University	1	0.13098	0.04666	0.99943	0.00078	195	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68263	68263	SRR099332	SRX041596	SRS172446	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode TAGTATCAGC	4432 1Y C9	4432 1Y C9									1	4432 1Y C9	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	78320127.0	261806.0	4432 1Y C9	0:4 1:295.15		4	295						SRX041596	SRS172446	SRA029829	Stanford University\|Quake	Stanford University	1	0.20079	0.01319	0.99971	0.0004	37	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68264	68264	SRR099331	SRX041595	SRS172445	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC	4432 1Y B8	4432 1Y B8									1	4432 1Y B8	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	46900878.0	156154.0	4432 1Y B8	0:4 1:296.35		4	296						SRX041595	SRS172445	SRA029829	Stanford University\|Quake	Stanford University	1	0.21827	0.01485	0.99961	0.00018	37	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68265	68265	SRR099330	SRX041594	SRS172444	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA	4432 1Y A7	4432 1Y A7									1	4432 1Y A7	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	22543768.0	73425.0	4432 1Y A7	0:4 1:303.03		4	303						SRX041594	SRS172444	SRA029829	Stanford University\|Quake	Stanford University	1	0.16879	0.02006	0.99973	0.00063	89	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68266	68266	SRR099325	SRX041593	SRS172443	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode ATATCGCGAG	4430 1Y C6	4430 1Y C6									1	4430 1Y C6	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	38479526.0	134024.0	4430 1Y C6	0:4 1:283.11		4	283						SRX041593	SRS172443	SRA029829	Stanford University\|Quake	Stanford University	1	0.11658	0.00464	0.99928	0.00323	37	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68267	68267	SRR099324	SRX041592	SRS172442	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode ATCAGACACG	4430 1Y B5	4430 1Y B5									1	4430 1Y B5	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	83990641.0	290583.0	4430 1Y B5	0:4 1:285.04		4	285						SRX041592	SRS172442	SRA029829	Stanford University\|Quake	Stanford University	1	0.20603	0.01554	0.99967	0.00038	37	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68268	68268	SRR099323	SRX041591	SRS172441	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode AGCACTGTAG	4430 1Y A4	4430 1Y A4									1	4430 1Y A4	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	27578630.0	90031.0	4430 1Y A4	0:4 1:302.32		4	302						SRX041591	SRS172441	SRA029829	Stanford University\|Quake	Stanford University	1	0.12444	0.0197	0.99975	0.00096	37	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68269	68269	SRR099322	SRX041590	SRS172440	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode AGACGCACTC	4428 1Y C3	4428 1Y C3									1	4428 1Y C3	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	62333740.0	194228.0	4428 1Y C3	0:4 1:316.93		4	316						SRX041590	SRS172440	SRA029829	Stanford University\|Quake	Stanford University	1	0.1865	0.02265	0.99947	0.00049	37	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68270	68270	SRR099321	SRX041589	SRS172439	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode ACGCTCGACA	4428 1Y B2	4428 1Y B2									1	4428 1Y B2	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	104263503.0	333602.0	4428 1Y B2	0:4 1:308.54		4	308						SRX041589	SRS172439	SRA029829	Stanford University\|Quake	Stanford University	1	0.15679	0.02871	0.99953	0.00044	37	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68271	68271	SRR099320	SRX041588	SRS172438	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 1 year old WIK zebrafish Danio rerio leading with MID barcode ACGAGTGCGT	4428 1Y A1	4428 1Y A1									1	4428 1Y A1	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	18763476.0	59560.0	4428 1Y A1	0:4 1:311.03		4	311						SRX041588	SRS172438	SRA029829	Stanford University\|Quake	Stanford University	1	0.13922	0.01452	0.99971	0.00094	160	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68272	68272	SRR099364	SRX041587	SRS172437	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TGATACGTCT	4433 6M D	4433 6M D									1	4433 6M D	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	101345153.0	290438.0	4433 6M D	0:4 1:344.94		4	344						SRX041587	SRS172437	SRA029829	Stanford University\|Quake	Stanford University	1	0.14815	0.01925	0.99908	0.00202	155	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68273	68273	SRR099363	SRX041586	SRS172436	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TCTCTATGCG	4433 6M C	4433 6M C									1	4433 6M C	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	75770901.0	213529.0	4433 6M C	0:4 1:350.85		4	350						SRX041586	SRS172436	SRA029829	Stanford University\|Quake	Stanford University	1	0.14445	0.01047	0.99878	0.00299	57	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68274	68274	SRR099362	SRX041585	SRS172435	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TAGTATCAGC	4433 6M B	4433 6M B									1	4433 6M B	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	67192817.0	194503.0	4433 6M B	0:4 1:341.46		4	341						SRX041585	SRS172435	SRA029829	Stanford University\|Quake	Stanford University	1	0.13467	0.01249	0.99914	0.00222	37	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68275	68275	SRR099361	SRX041584	SRS172434	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC	4433 6M A	4433 6M A									1	4433 6M A	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	72299403.0	207618.0	4433 6M A	0:4 1:344.23		4	344						SRX041584	SRS172434	SRA029829	Stanford University\|Quake	Stanford University	1	0.1041	0.01046	0.99764	0.00892	64	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68276	68276	SRR099348	SRX041583	SRS172433	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA	4432 6M G	4432 6M G									1	4432 6M G	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	79715586.0	227631.0	4432 6M G	0:4 1:346.20		4	346						SRX041583	SRS172433	SRA029829	Stanford University\|Quake	Stanford University	1	0.11472	0.01795	0.99898	0.00298	103	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68277	68277	SRR099347	SRX041582	SRS172432	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode ATATCGCGAG	4432 6M F	4432 6M F									1	4432 6M F	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	72024740.0	203769.0	4432 6M F	0:4 1:349.46		4	349						SRX041582	SRS172432	SRA029829	Stanford University\|Quake	Stanford University	1	0.11535	0.01205	0.99855	0.00395	40	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68278	68278	SRR099346	SRX041581	SRS172431	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode ATCAGACACG	4432 6M E	4432 6M E									1	4432 6M E	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	65072237.0	190441.0	4432 6M E	0:4 1:337.69		4	337						SRX041581	SRS172431	SRA029829	Stanford University\|Quake	Stanford University	1	0.11698	0.01584	0.99823	0.00583	65	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68279	68279	SRR099345	SRX041580	SRS172430	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode AGCACTGTAG	4432 6M D	4432 6M D									1	4432 6M D	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	74122161.0	211816.0	4432 6M D	0:4 1:345.94		4	345						SRX041580	SRS172430	SRA029829	Stanford University\|Quake	Stanford University	1	0.10275	0.01376	0.99912	0.00377	57	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68280	68280	SRR099344	SRX041579	SRS172429	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode AGACGCACTC	4432 6M C	4432 6M C									1	4432 6M C	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	78171765.0	220585.0	4432 6M C	0:4 1:350.38		4	350						SRX041579	SRS172429	SRA029829	Stanford University\|Quake	Stanford University	1	0.13401	0.0146	0.99711	0.01012	222	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68281	68281	SRR099343	SRX041578	SRS172428	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode ACGCTCGACA	4432 6M B	4432 6M B									1	4432 6M B	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	75262808.0	217309.0	4432 6M B	0:4 1:342.34		4	342						SRX041578	SRS172428	SRA029829	Stanford University\|Quake	Stanford University	1	0.16193	0.00604	0.99685	0.00701	452	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68282	68282	SRR099342	SRX041577	SRS172427	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode ACGAGTGCGT	4432 6M A	4432 6M A									1	4432 6M A	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	66235952.0	184208.0	4432 6M A	0:4 1:355.57		4	355						SRX041577	SRS172427	SRA029829	Stanford University\|Quake	Stanford University	1	0.10428	0.01655	0.99661	0.01505	183	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68283	68283	SRR099370	SRX041576	SRS172426	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TACTGAGCTA	F2 2	F2 2									1	F2 2	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	64641127.0	184383.0	F2 2	0:4 1:346.58		4	346						SRX041576	SRS172426	SRA029829	Stanford University\|Quake	Stanford University	1	0.23604	0.01003	0.99959	0.00028	37	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68284	68284	SRR099369	SRX041575	SRS172425	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TGATACGTCT	E2 2	E2 2									1	E2 2	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	66206147.0	181029.0	E2 2	0:4 1:361.72		4	361						SRX041575	SRS172425	SRA029829	Stanford University\|Quake	Stanford University	1	0.13216	0.00596	0.99949	0.00054	101	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68285	68285	SRR099368	SRX041574	SRS172424	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TGATACGTCT	D2 2	D2 2									1	D2 2	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	190136862.0	562067.0	D2 2	0:4 1:334.28		4	334						SRX041574	SRS172424	SRA029829	Stanford University\|Quake	Stanford University	1	0.25384	0.03443	0.99933	0.00056	416	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68286	68286	SRR099367	SRX041573	SRS172423	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode TAGTATCAGC	C2 2	C2 2									1	C2 2	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	118356460.0	367001.0	C2 2	0:4 1:318.50		4	318						SRX041573	SRS172423	SRA029829	Stanford University\|Quake	Stanford University	1	0.18882	0.02167	0.99969	9e-05	40	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68287	68287	SRR099366	SRX041572	SRS172422	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC	B2 2	B2 2									1	B2 2	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	24757877.0	69408.0	B2 2	0:4 1:352.70		4	352						SRX041572	SRS172422	SRA029829	Stanford University\|Quake	Stanford University	1	0.12537	0.01076	0.99975	0.00029	37	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68288	68288	SRR099365	SRX041571	SRS172421	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 6 mpf WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA	A2 2	A2 2									1	A2 2	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	765824405.0	2575264.0	A2 2	0:4 1:293.38		4	293						SRX041571	SRS172421	SRA029829	Stanford University\|Quake	Stanford University	1	0.18359	0.017	0.99892	0.00154	152	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68289	68289	SRR099360	SRX041570	SRS172420	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC or with no barcode leading with either IgM reverse primer TGCACTGAGACAAACCGAAG or IgZ reverse primer TCAGAGGCCAGACATCCAAT	4433 3MA DT	4433 3MA DT									1	4433 3MA DT	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	56064850.0	187695.0	4433 3MA DT	0:4 1:294.70		4	294						SRX041570	SRS172420	SRA029829	Stanford University\|Quake	Stanford University	1	0.3144	0.00306	0.99987	0.0	106	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68290	68290	SRR099359	SRX041569	SRS172419	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode CGTGTCTCTA	4433 3MA C7	4433 3MA C7									1	4433 3MA C7	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	96179902.0	300329.0	4433 3MA C7	0:4 1:316.25		4	316						SRX041569	SRS172419	SRA029829	Stanford University\|Quake	Stanford University	1	0.1804	0.01829	0.99953	0.00028	468	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68291	68291	SRR099358	SRX041568	SRS172418	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode ATATCGCGAG	4433 3MA B6	4433 3MA B6									1	4433 3MA B6	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	50421822.0	147276.0	4433 3MA B6	0:4 1:338.36		4	338						SRX041568	SRS172418	SRA029829	Stanford University\|Quake	Stanford University	1	0.19259	0.00589	0.99955	0.00065	99	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68292	68292	SRR099357	SRX041567	SRS172417	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode ATCAGACACG	4433 3MA A5	4433 3MA A5									1	4433 3MA A5	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	156064156.0	515822.0	4433 3MA A5	0:4 1:298.55		4	298						SRX041567	SRS172417	SRA029829	Stanford University\|Quake	Stanford University	1	0.22633	0.01233	0.99971	0.00016	40	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68293	68293	SRR099341	SRX041566	SRS172416	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode AGCACTGTAG	4432 3MA D4	4432 3MA D4									1	4432 3MA D4	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	61903651.0	206769.0	4432 3MA D4	0:4 1:295.39		4	295						SRX041566	SRS172416	SRA029829	Stanford University\|Quake	Stanford University	1	0.23888	0.01136	0.99953	0.00047	58	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68294	68294	SRR099340	SRX041565	SRS172415	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode AGACGCACTC	4432 3MA C3	4432 3MA C3									1	4432 3MA C3	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	37914122.0	116980.0	4432 3MA C3	0:4 1:320.11		4	320						SRX041565	SRS172415	SRA029829	Stanford University\|Quake	Stanford University	1	0.19288	0.0142	0.99955	0.00034	125	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68295	68295	SRR099339	SRX041564	SRS172414	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode ACGCTCGACA	4432 3MA B2	4432 3MA B2									1	4432 3MA B2	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	89178437.0	298194.0	4432 3MA B2	0:4 1:295.06		4	295						SRX041564	SRS172414	SRA029829	Stanford University\|Quake	Stanford University	1	0.21059	0.00985	0.99969	0.00012	107	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System
68296	68296	SRR099338	SRX041563	SRS172413	SRP005640	PRJNA79973	Zebrafish Development	4432-2WA	Other	Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake.	pubmed:21393572	Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode ACGAGTGCGT	4432 3MA A1	4432 3MA A1									1	4432 3MA A1	Zebrafish WIK	Standard Roche 454 GS Titanium shotgun library protocol was followed.			AMPLICON	TRANSCRIPTOMIC	PCR	SINGLE	LS454	454 GS FLX Titanium	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP005640	59101536.0	194332.0	4432 3MA A1	0:4 1:300.13		4	300						SRX041563	SRS172413	SRA029829	Stanford University\|Quake	Stanford University	1	0.26977	0.00958	0.99971	0.00015	69	B	usable mapping rate	legacy	early	unknown	random_priming	unknown	bulk	other_seq	454	United States	2011-04-07	Adult	Adult	BCR TCR repertoire	Hematopoietic System

Advanced export

JSON shape: default, array, newline-delimited

CREATE TABLE run_metadata("run.accession" VARCHAR, "experiment.accession" VARCHAR, "sample.accession" VARCHAR, "study.accession" VARCHAR, bioproject VARCHAR, "study.title" VARCHAR, "study.alias" VARCHAR, "study.type" VARCHAR, "study.abstract" VARCHAR, "study.attributes" VARCHAR, "study.PMIDs" VARCHAR, "sample.description" VARCHAR, "sample.title" VARCHAR, "sample.alias" VARCHAR, "sample.centername" VARCHAR, "sample.attributes" VARCHAR, "GEOsample.title" VARCHAR, "GEOsample.dataprocessing" VARCHAR, "GEOsample.source" VARCHAR, "GEOsample.treatmentprotocol" VARCHAR, "GEOsample.extractprotocol" VARCHAR, "GEOsample.growthprotocol" VARCHAR, "GEOsample.characteristics" VARCHAR, "GEOsample.accession" VARCHAR, "experiment.title" VARCHAR, "experiment.alias" VARCHAR, "experiment.library_name" VARCHAR, "experiment.design_description" VARCHAR, "experiment.library_construction_protocol" VARCHAR, "experiment.attributes" VARCHAR, "experiment.library_strategy" VARCHAR, "experiment.library_source" VARCHAR, "experiment.library_selection" VARCHAR, "experiment.library_layout" VARCHAR, "experiment.platform" VARCHAR, "experiment.instrument_model" VARCHAR, "experiment.spot_descriptor" VARCHAR, "experiment.study_ref" VARCHAR, "run.title" VARCHAR, "run.attributes" VARCHAR, "run.filename" VARCHAR, "run.semantic_name" VARCHAR, "run.total_bases" DOUBLE, "run.total_spots" DOUBLE, "run.alias" VARCHAR, "run.read_lengths" VARCHAR, "run.base_counts" VARCHAR, "run.r1_length" BIGINT, "run.r2_length" BIGINT, "run.r3_length" BIGINT, "run.r4_length" BIGINT, "run.Acount" BIGINT, "run.Ccount" BIGINT, "run.Gcount" BIGINT, "run.Tcount" BIGINT, "run.Ncount" BIGINT, "run.experiment" VARCHAR, "run.pool_member" VARCHAR, "submission.accession" VARCHAR, "submission.srasource" VARCHAR, "submission.bioprojectsource" VARCHAR, "seqdetective.n_mates" BIGINT, "seqdetective.mapping_rate.mate1" DOUBLE, "seqdetective.mapping_rate.mate2" DOUBLE, "seqdetective.nofeature_rate.mate1" DOUBLE, "seqdetective.nofeature_rate.mate2" DOUBLE, "seqdetective.sparsity.mate1" DOUBLE, "seqdetective.sparsity.mate2" DOUBLE, "seqdetective.pos_strand_rate.mate1" DOUBLE, "seqdetective.pos_strand_rate.mate2" DOUBLE, "seqdetective.readlen.mate1" BIGINT, "seqdetective.readlen.mate2" BIGINT, "seqdetective.judgement.mate1" VARCHAR, "seqdetective.judgement.mate2" VARCHAR, "seqdetective.judgement.reason" VARCHAR, platform_family VARCHAR, instrument_generation VARCHAR, read_bias VARCHAR, selection_class VARCHAR, prep_kit VARCHAR, sc_or_bulk VARCHAR, tech_class VARCHAR, technology VARCHAR, tech_variant VARCHAR, "submission.bioprojectsource.country" VARCHAR, earliest_date DATE, devstage_curation VARCHAR, devstage_curation_coarse VARCHAR, tissue_curation VARCHAR, tissue_curation_coarse VARCHAR);;
CREATE INDEX idx_run_bioproject ON run_metadata(bioproject);;
CREATE INDEX idx_run_run_accession ON run_metadata("run.accession");;