{"database": "metadata", "table": "run_metadata", "rows": [[67640, "SRR17219921", "SRX13399928", "SRS11303048", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qm tumor 8", "GSM5732229", null, "source name:Qm tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "Qm tumor 8", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qm tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor", "GSM5732229", "GSM5732229: Qm tumor 8; Danio rerio; RNA Seq", "GSM5732229", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732229", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101269.fastq.gz", "fastq", 113227280.0, 2830682.0, "GSM5732229 r1", "0:40", "A:38328913;C:23480607;G:24489533;T:26864215;N:64012", 40, null, null, null, 38328913, 23480607, 24489533, 26864215, 64012, "SRX13399928", "SRS11303048", "SRA1343073", "GEO", "Koch Institute", 1, 0.82097, null, 0.20002, null, 0.85904, null, 0.65238, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"]], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": ["rowid"], "primary_key_values": ["67640"], "units": {}, "query_ms": 8.960926003055647}