{"database": "metadata", "table": "run_metadata", "rows": [[62645, "SRR13297053", "SRX9725961", "SRS7919278", "SRP299151", "PRJNA686149", "Transcriptionally regulated energy metabolism drives early erythropoiesis tif1g RNA seq", "GSE163453", "Transcriptome Analysis", "Transcription and metabolism both influence cell function yet dedicated transcriptional control of metabolic pathways that regulate cell fate has rarely been defined. Through a chemical suppressor screen  we discovered that inhibition of the pyrimidine biosynthesis enzyme DHODH rescues erythroid differentiation in bloodless moonshine mutant embryos defective for the transcription elongation factor tif1?. This rescue depends on the functional link of DHODH to mitochondrial respiration. Low a ketoglutarate levels caused by tif1? loss lead to histone hypermethylation. TIF? directly controls coenzyme Q synthesis gene expression and coenzyme Q levels are reduced in moonshine mutants. A coenzyme Q analogue rescues moonshine's bloodless phenotype. These results demonstrate mitochondrial metabolism is a key output of a lineage transcription factor that drives cell fate decisions in the early blood lineage. Overall design: tif1? ENSDART00000020116.9/NM 001002871.2 was knocked down tif1? KD by injecting 1 ng of an ATG blocking morpholino Gene Tools  five prime?three prime morpholino sequence ATCTTGGCCTTTGTTGTCCGCCATC into zebrafish wild type TU embryos at the 1 2 cell stage. As a control Ctrl KD  1 ng of a Standard Control oligo designed by Gene Tools  five prime?three prime morpholino sequence CCTCTTACCTCAGTTACAATTTATA was injected into zebrafish embryos at the 1 2 cell stage. tif1? KD and Ctrl KD embryos from each clutch were split in half and treated with either 7 \u00b5M leflunomide or the equivalent amount of DMSO from 5.3 hpf until 10 hpf  when embryos were harvested for RNA seq by snap freezing them.", "parent bioproject:PRJNA562552", "pubmed:33986176", null, "TU + tif1\u03b3 KD + DMSO  tailbud stage  replicate #3", "GSM4979511", null, "source name:Whole zebrafish embryos at 10 hpf = tailbud stage|tissue:Whole body|genotype/variation:TU + tif1<gamma> KD|treatment:DMSO|developmental stage:10 hpf = tailbud stage", "TU + tif1\u03b3 KD + DMSO  tailbud stage  replicate #3", "Step 1: Quality control of RNA Seq datasets was performed by FastQC and Cutadapt to remove adaptor sequences and low quality regions. Step 2: The high quality reads were aligned to Ensembl genome assembly GRCz11 using Tophat 2.0.11 without xxx splicing form calls. Step 3: Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. Step 4: FPKM values were used to normalize and quantify each transcripts; the resulting list of differential expressed genes are filtered by log2 fold change > 2 and q value < 0.05. Genome build: Ensembl GRCz11 Supplementary files format and content: 170104 7001405 0663 AH722FBCXY.htseq count.out.txt: Fragments Per Kilobase of transcript per Million mapped reads FPKM files contain gene names and FPKM values.", "Whole zebrafish embryos at 10 hpf = tailbud stage", "tif1\u03b3 KD and Ctrl KD embryos were treated with 7 \u00b5M leflunomide or the equivalent amount of DMSO from 5.3 hpf until 10 hpf when embryos were harvested by snap freezing them.", "109 snap frozen embryos of each genotype and treatment group in triplicate were homogenized in 700 \u00b5l TRIzol Invitrogen/Thermo Fisher Scientific  15596026 using a tissue homogenizer with hard tissue Omni tip plastic homogenizing probes Omni International  30750H. 300 \u00b5l TRIzol was added and the samples transferred into a pre spun 16 000 x g  30 s  room temperature 2 ml 5PRIME Phase Lock Gel Heavy tube Quantabio  2302830. post addition of 200 \u00b5l chloroform Sigma Aldrich  C2432  the tube was vigorously inverted for 15 sec  incubated at room temperature for 3 min and spun at 12 000 x g for 15 min at 4\u00b0C. The supernatant was transferred into a RNase free 1.7 ml tube. 300 \u00b5l buffer saturated phenol Invitrogen/Thermo Fisher Scientific  15513039 and 300 \u00b5l chloroform were added  the samples vortexed for 15 sec  and incubated and spun as before. The supernatant was transferred into a fresh RNase free 1.7 ml tube  600 \u00b5l chloroform added  the samples were vortexed  incubated and spun as before. The supernatant was transferred into a fresh RNase free 1.7 ml tube  600 \u00b5l 2 propanol VWR  BDH1133 was added  the samples were inverted 10 times and stored at  80\u00b0C overnight. Samples were spun at 17 000 x g for 30 min at 4\u00b0C  and the supernatant was pipetted off. Samples were handled on ice from now on. Samples were washed three times with 1000 \u00b5l 75% ethanol in nuclease free water Invitrogen/Thermo Fisher Scientific  AM9937 followed by spinning at 17 000 x g for 5 min at 4\u00b0C. post the final wash  samples were air dried and resuspended in 50 \u00b5l nuclease free water. 5 \u00b5g of RNA was DNase treated with the TURBO DNA free Kit Ambion  AM1907 as per the manufacturer\u2019s protocol  in a volume of 50 \u00b5l for 30 min at 37\u00b0C. Instead of adding the DNase Inactivation Reagent  the reaction was cleaned up using RNAClean XP SPRI paramagnetic beads Beckman Coulter  A63987 following the manufacturer\u2019s instructions. The final elution volume was 48 \u00b5l. 1.5 \u00b5g DNase treated RNA samples were spiked with ERCC ExFold RNA Spike In Mixes Thermo Fisher Scientific  4456739 as per the manufacturer\u2019s protocol. Ribosomal RNAs were removed with the Ribo Zero Magnetic Gold Kit Illumina  MRZG12324  and strand specific libraries were prepared with the NEBNext Ultra Directional RNA Library Prep Kit for Illumina NEB  E7420 and NEBNext Multiplex Oligos for Illumina NEB  E7335 all according to the manufacturer\u2019s protocols. For quality control and pooling purposes  the final libraries were run on a high sensitivity DNA chip Agilent  5067 46426 on the Agilent 2100 Bioanalyzer. The average library size was 265 bp. Libraries were sequenced on the Illumina HiSeq 4000.", "Zebrafish embryos were grown in embryo medium E3 at 28.5\u00b0C water temperature as per standard protocols.", "tissue:Whole body|genotype/variation:TU + tif1<gamma> KD|treatment:DMSO|developmental stage:10 hpf = tailbud stage", "GSM4979511", "GSM4979511: TU + tif1\u03b3 KD + DMSO  tailbud stage  replicate #3; Danio rerio; RNA Seq", "GSM4979511", null, "1", "109 snap frozen embryos of each genotype and treatment group in triplicate were homogenized in 700 \u00b5l TRIzol Invitrogen/Thermo Fisher Scientific  15596026 using a tissue homogenizer with hard tissue Omni tip plastic homogenizing probes Omni International  30750H. 300 \u00b5l TRIzol was added and the samples transferred into a pre spun 16 000 x g  30 s  room temperature 2 ml 5PRIME Phase Lock Gel Heavy tube Quantabio  2302830. post addition of 200 \u00b5l chloroform Sigma Aldrich  C2432  the tube was vigorously inverted for 15 sec  incubated at room temperature for 3 min and spun at 12 000 x g for 15 min at 4\u00b0C. The supernatant was transferred into a RNase free 1.7 ml tube. 300 \u00b5l buffer saturated phenol Invitrogen/Thermo Fisher Scientific  15513039 and 300 \u00b5l chloroform were added  the samples vortexed for 15 sec  and incubated and spun as before. The supernatant was transferred into a fresh RNase free 1.7 ml tube  600 \u00b5l chloroform added  the samples were vortexed  incubated and spun as before. The supernatant was transferred into a fresh RNase free 1.7 ml tube  600 \u00b5l 2 propanol VWR  BDH1133 was added  the samples were inverted 10 times and stored at  80\u00b0C overnight. Samples were spun at 17 000 x g for 30 min at 4\u00b0C  and the supernatant was pipetted off. Samples were handled on ice from now on. Samples were washed three times with 1000 \u00b5l 75% ethanol in nuclease free water Invitrogen/Thermo Fisher Scientific  AM9937 followed by spinning at 17 000 x g for 5 min at 4\u00b0C. post the final wash  samples were air dried and resuspended in 50 \u00b5l nuclease free water. 5 \u00b5g of RNA was DNase treated with the TURBO DNA free Kit Ambion  AM1907 as per the manufacturer's protocol  in a volume of 50 \u00b5l for 30 min at 37\u00b0C. Instead of adding the DNase Inactivation Reagent  the reaction was cleaned up using RNAClean XP SPRI paramagnetic beads Beckman Coulter  A63987 following the manufacturer's instructions. The final elution volume was 48 \u00b5l. 1.5 \u00b5g DNase treated RNA samples were spiked with ERCC ExFold RNA Spike In Mixes Thermo Fisher Scientific  4456739 as per the manufacturer's protocol. Ribosomal RNAs were removed with the Ribo Zero Magnetic Gold Kit Illumina  MRZG12324  and strand specific libraries were prepared with the NEBNext Ultra Directional RNA Library Prep Kit for Illumina NEB  E7420 and NEBNext Multiplex Oligos for Illumina NEB  E7335 all according to the manufacturer's protocols. For quality control and pooling purposes  the final libraries were run on a high sensitivity DNA chip Agilent  5067 46426 on the Agilent 2100 Bioanalyzer. The average library size was 265 bp. Libraries were sequenced on the Illumina HiSeq 4000.", "GEO Accession:GSM4979511", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 4000", null, "SRP299151", null, null, "MR-11_GGCTAC_L002_R1_001.fastq.gz MR-11_GGCTAC_L002_R2_001.fastq.gz", "fastq fastq", 2771370600.0, 13856853.0, "GSM4979511 r2", "0:100 1:100", "A:735731177;C:645297619;G:655822883;T:734385900;N:133021", 100, 100, null, null, 735731177, 645297619, 655822883, 734385900, 133021, "SRX9725961", "SRS7919278", "SRA1177432", "GEO", "Oncology/Hematology, Boston Children's Hospital", 2, 0.89204, 0.89843, 0.31922, 0.3225, 0.73235, 0.7358, 0.47399, 0.46671, 100, 100, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "rrna_depletion", "nebnext", "bulk", "unknown", "unknown", null, "United States", "2020-12-17", "Gastrula", "Embryo", "Trunk", "Surface Structure"]], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": ["rowid"], "primary_key_values": ["62645"], "units": {}, "query_ms": 10.594675000902498}