{"database": "metadata", "table": "run_metadata", "rows": [[61925, "SRR13074833", "SRX9521876", "SRS7729084", "SRP292929", "PRJNA678983", "Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]", "GSE161642", "Transcriptome Analysis", "Spinal cord injury SCI results in loss of neurons  oligodendrocytes and myelin sheaths  all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres  which leaves axons denuded  impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals  zebrafish can functionally regenerate the spinal cord. Yet  little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here  we report that in adult zebrafish  SCI results in axonal  oligodendrocyte and myelin sheath loss. We find that OPCs  the oligodendorocyte progenitor cells  survive the injury  enter a reactive state  proliferate and differentiate into oligodendrocytes. Concomitantly  the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly  global reduction of axonal tracts and partial re myelination  relative to pre injury levels  persist at later stages of regeneration  yet suffices for functional recovery. Taken together  these findings imply that in the zebrafish spinal cord  OPCs replace lost oligodendrocytes and  thus  re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.", "parent bioproject:PRJNA679077", "pubmed:33158923", null, "SHAM.1X 01 E05", "GSM4911672", null, "source name:OPC|age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "SHAM.1X 01 E05", "Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters:    gunzip  A sam  t 14   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  N 0  n 1  s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters:  a EnsemblGene 87.GRCz10.TR.gtf  s 0  Q 1  T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID  Chromosome  Gene Start  Gene End  Gene Length  then all sample counts; comments start with '#'", "OPC", "Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction  as previously described Becker et al.  1997 . Sham lesioned fish were treated equally  except that the spinal cord was left intact.", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks\u2019 Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", null, "age:adult|genotype:Tgolig2:eGFP|tissue:spinal cord|cell type:olig2:eGFP+ OPCs|treatment:sham control", "GSM4911672", "GSM4911672: SHAM.1X 01 E05; Danio rerio; RNA Seq", "GSM4911672", null, "1", "Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026  Carl Zeiss and starting from the lesion site  a  0.5 mm piece was cut from the rostral part with a scalpel. For sham control group  a  0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords  0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation  spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation  live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich  A. Weber  M. Brand  unpublished  available on request from M.B. and Lange et al.  2020. Briefly  excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628  Miltenyi by incubating for 15 min at 37 \u00b0C in dissociation buffer. Tissue digestion was stopped by the addition of 30 \u00b5L of Papain inhibitor  triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 \u00b0C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette  respectively  and incubation for 10 min at 37 \u00b0C  cell suspension was applied to a 20 \u00b5m cell strainer BD Biosciences  mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS  cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 \u03bcl fresh  sterile HBSS. To stain for viable cells  1 \u00b5l of 2 mM Calcein  AM  cell permeant dye C1429  Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al.  2013 Picelli et al.  2013. Briefly  either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 \u03bcl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB  spun down and frozen at \u201180 \u00b0C. post thawing the samples  2 \u03bcl of a primer mix was added. RNA was then denatured for 3 minutes at 72 \u00b0C and the reverse transcription was performed at 42 \u00b0C for 90 min post filling up to 10 \u03bcl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 \u00b0C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 \u03bcM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 \u03bcl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation  700 pg cDNA in 2 \u03bcl were mixed with 0.5 \u03bcl Tagment DNA Enzyme  2.5 \u03bcl Tagment DNA Buffer Nextera  Illumina and tagmented at 55 \u00b0C for 5 min. Subsequently  Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 \u03bcM dual indexing primers. post PCR  libraries were quantified with AccuBlue Broad range chemistry  equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.", "GEO Accession:GSM4911672", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP292929", null, null, "L31812_Track-65487_R1.fastq.gz", "fastq", 63166792.0, 831142.0, "GSM4911672 r1", "0:76 1:0", "A:17384488;C:14266583;G:14143927;T:17371042;N:752", 76, 0, null, null, 17384488, 14266583, 14143927, 17371042, 752, "SRX9521876", "SRS7729084", "SRA1160306", "GEO", "Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden", 1, 0.86701, null, 0.07159, null, 0.96749, null, 0.42215, null, 76, null, "B", null, "usable mapping rate", "illumina", "nextseq", "full_length", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "Germany", "2020-11-17", "Adult", "Adult", "Spinal Cord", "Nervous System"]], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": ["rowid"], "primary_key_values": ["61925"], "units": {}, "query_ms": 9.413062001840444}