{"database": "metadata", "table": "run_metadata", "rows": [[57149, "SRR11218069", "SRX7830300", "SRS6240979", "SRP251357", "PRJNA609915", "Small RNAs in anti tuberculosis drug induced liver injury", "GSE146260", "Transcriptome Analysis", "The antimicrobials isoniazid and pyrazinamide  used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment  resulting in incomplete cure  relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease  with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure  larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed  8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.", null, null, null, "SS 7Co", "GSM4369112", null, "tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "SS 7Co", "The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters  b \"GTTCAGAGTTCTACAGTCCGACGATC\"  b \"TGGAATTCTCGGGTGCCAAGG\"  b \"GATCGTCGGACTGTAGAACTCTGAAC\"  b \"CCTTGGCACCCGAGAATTCCA\"  O 6  m 17 \u2013format=fastq  followed by removal of the terminal 4 bases from each end. Trimmed sequences were \u201ccollapsed\u201d to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software  with parameters  o 20  l 17  r 100  c Raw \"tag counts\" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed  collapsed small RNAs  which gives quantitaive information as to the sequence levels of each sequence in each sample", "Control 5dpf larvae", "Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf  30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf  30 larvae per sample;", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently  total RNA was extracted using the miRNeasy mini kit Qiagen  Venlo  The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit  v3. Libraries were checked for size  purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "Zebrafish Danio rerio were maintained at 28.5\u2009\u00b0C", "developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA", "GSM4369112", "GSM4369112: SS 7Co; Danio rerio; ncRNA Seq", "GSM4369112", null, "1", "Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently  total RNA was extracted using the miRNeasy mini kit Qiagen  Venlo  The Netherlands eluted in 30\u2009\u00b5l RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit  v3. Libraries were checked for size  purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.", "GEO Accession:GSM4369112", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 550", null, "SRP251357", null, null, "SS.7_Control.fq.gz", "fastq", 675141111.0, 13238061.0, "GSM4369112 r1", "0:51 1:0", "A:158015253;C:144827125;G:185064213;T:187168263;N:66257", 51, 0, null, null, 158015253, 144827125, 185064213, 187168263, 66257, "SRX7830300", "SRS6240979", "SRA1050374", "GEO", "Centre for Immunity, Infection and Evolution", 1, 0.40459, null, 0.10193, null, 0.98723, null, 0.50939, null, 51, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "United States", "2020-03-03", "Larval", "Larval", "Undetermined", "Undetermined"]], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": ["rowid"], "primary_key_values": ["57149"], "units": {}, "query_ms": 8.90683601028286}