{"database": "metadata", "table": "run_metadata", "rows": [[55265, "SRR10210691", "SRX6930432", "SRS5460727", "SRP223875", "PRJNA575225", "Biliary Atresia associated Mannosidase 1 alpha 2 gene regulates biliary and ciliary morphogenesis and laterality zebrafish", "GSE138251", "Transcriptome Analysis", "The effect of MAN1A2 on biliary morphogenesis  left right patterning  and ciliogenesis was evaluated with knockdown in zebrafish and subsequent RNAseq experiment/analysis. Overall design: Total RNA sequencing protocol was performed on pooled liver tissue from all three batches  one from controls and one from man1a2 morphant zebrafish. Each pool consisted of 100 livers from three batches of zebrafish larvae at 5 dpf", null, "pubmed:33192543", null, "Pooled control RNA seq", "GSM4103427", null, "source name:liver tissue|tissue:liver|condition:Normal|developmental stage:Larvae at 5 dpf", "Pooled control RNA seq", "The quality of the sequencing reads was verified using FastQC. Omicsoft Sequence Aligner 2 was used to align the sequencing reads to Zebrafish genome. DEseq2  R package for RNAseq data  was used for differential analysis. Genome build: GRCz10 Supplementary files format and content: For each processed data file  there are 2 columns: the first column being Ensembl gene ID  and the second column being raw read counts.", "liver tissue", "arf6 ATG MO 5\u2019 GATCTTGGAAAGCATCTTCCCCATG 3\u2019  man1a2 ATG MO 5\u2019 CCGGCGTGGTCATATTTTGATGATC 3\u2019  and man1a2 splicing MO 5\u2019 AAGAATGTAAACTCACCTCTCTGAT 3\u2019 were purchased from Gene Tools  LLC. Embryos were injected at the one cell stage with man1a2 ATG MO 1.5 or 4.5 ng  man1a2 splicing MO 5 or 7.5 ng  or arf6 ATG MO 0.5 ng.", "Total RNA was extracted from three different batches of 100 livers of uninjected control and man1a2 MO injected larvae at xxx dpf by using RNeasy Mini Kit. The pooled RNA was used to generate mRNA sequencing libraries using Illumina TruSeq Stranded mRNA sample preparation kit. Poly A containing mRNA molecules were purified using poly T oligo attached magnetic beads  mRNA fragmented into small pieces using divalent cations  and copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by using dUTP in the Second Strand Marking Mix  followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. These cDNA fragments were ligated to single 'A' base and adapter  then purified and enriched with PCR to create the final cDNA libraries.", "Embryos and adult fish were raised and maintained under standard laboratory conditions. We used the following transgenic lines: Tgdusp6:d2EGFPpt6 10 Tgkrt18:EGFPp314 11 TgEPV.Tp1 Mmu.Hbb:EGFPum14 12 TgEPV.Tp1 Mmu.Hbb:hist2h2l mCherrys939 13 and Tgfabp10a:DsRed ela3l:EGFPgz15 14 [the last three referred to here as TgTp1:GFP  TgTp1:H2B mCherry  and Tgfabp10a:DsRed  respectively].", "tissue:liver|condition:Normal|developmental stage:Larvae at 5 dpf", "GSM4103427", "GSM4103427: Pooled control RNA seq; Danio rerio; RNA Seq", "GSM4103427", null, "1", "Total RNA was extracted from three different batches of 100 livers of uninjected control and man1a2 MO injected larvae at xxx dpf by using RNeasy Mini Kit. The pooled RNA was used to generate mRNA sequencing libraries using Illumina TruSeq Stranded mRNA sample preparation kit. Poly A containing mRNA molecules were purified using poly T oligo attached magnetic beads  mRNA fragmented into small pieces using divalent cations  and copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by using dUTP in the Second Strand Marking Mix  followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. These cDNA fragments were ligated to single 'A' base and adapter  then purified and enriched with PCR to create the final cDNA libraries.", "GEO Accession:GSM4103427", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP223875", null, null, "dr_control_S15_all_R2_001.fastq.gz dr_control_S15_all_R1_001.fastq.gz", "fastq fastq", 6246641800.0, 31233209.0, "GSM4103427 r1", "0:100 1:100", "A:1630491563;C:1497737062;G:1532797800;T:1580737839;N:4877536", 100, 100, null, null, 1630491563, 1497737062, 1532797800, 1580737839, 4877536, "SRX6930432", "SRS5460727", "SRA970723", "GEO", "Systems Biology, Bioengineering, UCSD", 2, 0.96082, 0.96474, 0.05307, 0.05238, 0.80164, 0.80846, 0.50767, 0.5068, 100, 100, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2019-10-01", "Larval", "Larval", "Liver", "Liver and Biliary System"]], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": ["rowid"], "primary_key_values": ["55265"], "units": {}, "query_ms": 9.496764003415592}