{"database": "metadata", "table": "run_metadata", "rows": [[52813, "SRR9211489", "SRX5982380", "SRS4887885", "SRP200656", "PRJNA547573", "Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos", "GSE132304", "Transcriptome Analysis", "We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages  we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types  reveals gene expression dynamics in space and time  and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development  we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS  52 hpf  and 72 hpf  we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1  with two replicates for each condition. At each of 52 hpf and 72 hpf  we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2  with two replicates for each condition  except 52 hpf nonskin2 has only one replicate.", null, "pubmed:31431477", null, "52 hpf  all skin  replicate B", "GSM3855897", null, "source name:FACS isolated all skin cells from whole embryos|strain:AB+TU|developmental stage:52 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed", "52 hpf  all skin  replicate B", "Demultiplexing: single mismatch to expected 7 mers  only keeping PF=1 spots Adapter  low quality base trimming: CutAdapt 1.8.1  m 21   trim n   max n=2  q 10 10  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC  then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome  single pass mode with known junctions  retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2   numGibbsSamples=1000   thinningFactor=25   useVBOpt   libType=U   fldMean=200   fldSD=200   rangeFactorizationBins=4   minAssignedFrags=1   seqBias   noBiasLengthThreshold  with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer  but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX  and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format  with multiple worksheets  containing a comprehensive collection of analysis input data  intermediate steps  and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.", "FACS isolated all skin cells from whole embryos", "Transgenic embryos without xxx treatment", "Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer\u2019s solution for 15 min. During this incubation  yolk was removed by gently pipetting embryos through a 200 \u00b5l tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 \u00b0C and homogenized with a 200 \u00b5l tip every 10 min until most cells were dissociated 20 to 50 min. 55 \u00b5l 100 mM CaCl2 and 550 \u00b5l FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 \u00b0C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine  0.8 mM CaCl2  Pen 50U/ml  Strep 0.05 mg/ml  and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells  using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at \u201380 \u00b0C. Quality of all samples was assayed with an Agilent Bioanalyzer  and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.", "Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.", "strain:AB+TU|developmental stage:52 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed", "GSM3855897", "GSM3855897: 52 hpf  all skin  replicate B; Danio rerio; RNA Seq", "GSM3855897", null, "1", "Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation  yolk was removed by gently pipetting embryos through a 200 \u00b5l tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 \u00b0C and homogenized with a 200 \u00b5l tip every 10 min until most cells were dissociated 20 to 50 min. 55 \u00b5l 100 mM CaCl2 and 550 \u00b5l FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 \u00b0C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine  0.8 mM CaCl2  Pen 50U/ml  Strep 0.05 mg/ml  and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells  using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at \u201380 \u00b0C. Quality of all samples was assayed with an Agilent Bioanalyzer  and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.", "GEO Accession:GSM3855897", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2500", null, "SRP200656", null, null, "ZFishSkin_Reads_c08_52hpf-allSkin-_repB_i03.TTAGGCA.pf1_XB039L2.fastq.gz", "fastq", 1519404450.0, 30388089.0, "GSM3855897 r1", "0:50", "A:387412457;C:374238433;G:369512809;T:388217220;N:23531", 50, null, null, null, 387412457, 374238433, 369512809, 388217220, 23531, "SRX5982380", "SRS4887885", "SRA894819", "GEO", "UCLA", 1, 0.93866, null, 0.05037, null, 0.76437, null, 0.37263, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "United States", "2019-06-06", "Hatching", "Embryo", "Skin", "Surface Structure"]], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": ["rowid"], "primary_key_values": ["52813"], "units": {}, "query_ms": 7.730887002253439}