{"database": "metadata", "table": "run_metadata", "rows": [[44968, "SRR6345659", "SRX3442975", "SRS2733637", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of ovary from tdrd6a het fish", "GSM2875718", null, "source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous", "smRNA seq library of ovary from tdrd6a het fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "Ovary from tdrd6a het fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:whole ovary|genotype:tdrd6a heterozygous", "GSM2875718", "GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq", "GSM2875718", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875718", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "Tdrd6a-het-ovary-input-Adult.fastq.gz", "fastq", 1452353571.0, 28477521.0, "GSM2875718 r1", "0:51", "A:397993735;C:284194126;G:396142390;T:373939235;N:84085", 51, null, null, null, 397993735, 284194126, 396142390, 373939235, 84085, "SRX3442975", "SRS2733637", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.3869, null, 0.1369, null, 0.86397, null, 0.77165, null, 51, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Undetermined", "Undetermined", "Gonad", "Reproductive System"]], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": ["rowid"], "primary_key_values": ["44968"], "units": {}, "query_ms": 7.646840000234079}