{"database": "metadata", "table": "run_metadata", "rows": [[30118, "SRR29493651", "SRX25004177", "SRS21704882", "SRP485624", "PRJNA1068513", "Time course indivudal RNA Seq of zebrafish early development", "GSE254071", "Transcriptome Analysis", "Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss  10ss  15ss  20ss  24 hpf  32 hpf  48hpf  72 hpf  96 hpf with 8 16 biological replicates.", null, "pubmed:39320016", null, "20ss 5", "GSM8339623", null, "tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing", "20ss 5", "Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: \u201c fastp   trim poly x  w 20   adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA   adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT  l 31\u201d. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018  using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using  l IU  which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample", "RNA from single embryo at mRNA", null, "Each stage of  RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer\u2019s protocol. 3\u2019 mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly  total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific  Waltham  MA  USA. Then  all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter  Brea  CA  USA according to the manufacturer\u2019s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/\u03bcL  Enzymatics  Beverly  MA  USA  and DNA polymerase I 10 U/\u03bcL  Enzymatics  Beverly  MA  USA. To avoid the carryover of large amounts of rRNAs  the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific  Waltham  MA  USA. Then  purification was conducted with a 0.8\u00d7 volume of Ampure XP beads. Fragmentation  end repair  and A tailing were conducted using 5\u00d7 WGS Fragmentation Mix Enzymatics  Beverly  MA  USA. The Adapter for Lasy Seq was ligated using 5\u00d7 Ligation Mix Enzymatics  Beverly  MA  USA  and the adapter ligated DNA was purified twice with a 0.8\u00d7 volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen  20\u00d7 in water Biotium  Fremont  CA  USA and the QuantStudio5 Real Time PCR System Applied Biosystems  Waltham  MA  USA  the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS  Wilmington  MA  USA on the ProFlex PCR System Applied Biosystems  Waltham  MA  USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies  Santa Clara  CA  USA to check for quality. Then  sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina  San Diego  CA  USA by Macrogen  Inc. Seoul  Korea.", "The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28\u00b0C \u00b1 1\u00b0C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council  2011.", "strain:RW|developmental.stage:20ss", "GSM8339623", "GSM8339623: 20ss 5; Danio rerio; RNA Seq", "GSM8339623 r1", "GSM8339623", "1", "Each stage of  RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly  total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific  Waltham  MA  USA. Then  all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter  Brea  CA  USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/\u03bcL  Enzymatics  Beverly  MA  USA  and DNA polymerase I 10 U/\u03bcL  Enzymatics  Beverly  MA  USA. To avoid the carryover of large amounts of rRNAs  the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific  Waltham  MA  USA. Then  purification was conducted with a 0.8\u00d7 volume of Ampure XP beads. Fragmentation  end repair  and A tailing were conducted using 5\u00d7 WGS Fragmentation Mix Enzymatics  Beverly  MA  USA. The Adapter for Lasy Seq was ligated using 5\u00d7 Ligation Mix Enzymatics  Beverly  MA  USA  and the adapter ligated DNA was purified twice with a 0.8\u00d7 volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen  20\u00d7 in water Biotium  Fremont  CA  USA and the QuantStudio5 Real Time PCR System Applied Biosystems  Waltham  MA  USA  the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS  Wilmington  MA  USA on the ProFlex PCR System Applied Biosystems  Waltham  MA  USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies  Santa Clara  CA  USA to check for quality. Then  sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina  San Diego  CA  USA by Macrogen  Inc. Seoul  Korea.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "HiSeq X Ten", null, "SRP485624", null, null, "DrRyu-013_1.fastq.gz", "fastq", 1162568781.0, 7699131.0, "GSM8339623 r1", "0:151", "A:400374400;C:224477850;G:233635718;T:304073841;N:6972", 151, null, null, null, 400374400, 224477850, 233635718, 304073841, 6972, "SRX25004177", "SRS21704882", "SRA1904789", "Aoyama Gakuinn University", "Aoyama Gakuinn University", 1, 0.71228, null, 0.05604, null, 0.81292, null, 0.53526, null, 151, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "unknown", "unknown", null, "Japan", "2024-06-20", "Undetermined", "Embryo", "Embryo Imprecise", "All anatomical structures"]], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": ["rowid"], "primary_key_values": ["30118"], "units": {}, "query_ms": 9.431648002646398}