{"database": "metadata", "table": "run_metadata", "rows": [[24941, "SRR25557792", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L003_R1_001.fastq.gz", "fastq", 435879881.0, 5888685.0, "GSM7688791 r3", "0:74.02", "A:116548094;C:100971153;G:103794902;T:114400770;N:164962", 74, null, null, null, 116548094, 100971153, 103794902, 114400770, 164962, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94195, null, 0.06686, null, 0.73785, null, 0.48044, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"]], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": ["rowid"], "primary_key_values": ["24941"], "units": {}, "query_ms": 10.082758000862668}