{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where technology = \"bulk\" and tissue_curation = \"Cancer or Tumor\"", "rows": [[32850, "SRR29482329", "SRX24993379", "SRS21694843", "SRP515141", "PRJNA1126244", "Specific oncogene activation of the cell of origin in mucosal melanoma [RNA Seq]", "GSE270354", "Transcriptome Analysis", "Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics  we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly  melanoma only develops from melanocytes lining internal organs  analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression  consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors  allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma  our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations.  Overall design: Bulk RNA sequencing data from mucosal melanoma and cutaneous melanoma zebrafish models", null, null, null, "MM rep5 [RNA Seq]", "GSM8340235", null, "source name:mucosal melanoma|tissue:mucosal melanoma|cell type:melanoma|genotype:roy / ; mitfa /  fish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1|geo loc name:missing|collection date:missing", "MM rep5 [RNA Seq]", "Cutadpt was used to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer11 of zebrafish genome using Tophat 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. Assembly: danRer11 Supplementary files format and content: .txt file contains differential gene expression of mucosal melanoma samples vs. cutaneous melanoma", "mucosal melanoma", null, "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", "Melanomas generated from mitfa / ; tp53 / ; BRAFV600E zebrafish injected with MCR:EGFP or roy / ; mitfa /  zebrafish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1were isolated for RNA seq.", "tissue:mucosal melanoma|cell type:melanoma|genotype:roy / ; mitfa /  fish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1", "GSM8340235", "GSM8340235: MM rep5 [RNA Seq]; Danio rerio; RNA Seq", "GSM8340235 r1", "GSM8340235", "1", "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP515141", null, null, "MI-Dr-F381.R2.fastq.gz MI-Dr-F381.R1.fastq.gz", "fastq fastq", 12158543700.0, 40528479.0, "GSM8340235 r1", "0:150 1:150", "A:3249684583;C:2829283376;G:2878779006;T:3198464780;N:2331955", 150, 150, null, null, 3249684583, 2829283376, 2878779006, 3198464780, 2331955, "SRX24993379", "SRS21694843", "SRA1904140", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", 2, 0.91528, 0.91522, 0.06081, 0.06071, 0.71662, 0.72606, 0.50019, 0.49902, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "nebnext", "bulk", "bulk", "bulk", null, "United States", "2024-06-20", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [32851, "SRR29482330", "SRX24993378", "SRS21694842", "SRP515141", "PRJNA1126244", "Specific oncogene activation of the cell of origin in mucosal melanoma [RNA Seq]", "GSE270354", "Transcriptome Analysis", "Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics  we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly  melanoma only develops from melanocytes lining internal organs  analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression  consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors  allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma  our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations.  Overall design: Bulk RNA sequencing data from mucosal melanoma and cutaneous melanoma zebrafish models", null, null, null, "MM rep4 [RNA Seq]", "GSM8340234", null, "source name:mucosal melanoma|tissue:mucosal melanoma|cell type:melanoma|genotype:roy / ; mitfa /  fish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1|geo loc name:missing|collection date:missing", "MM rep4 [RNA Seq]", "Cutadpt was used to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer11 of zebrafish genome using Tophat 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. Assembly: danRer11 Supplementary files format and content: .txt file contains differential gene expression of mucosal melanoma samples vs. cutaneous melanoma", "mucosal melanoma", null, "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", "Melanomas generated from mitfa / ; tp53 / ; BRAFV600E zebrafish injected with MCR:EGFP or roy / ; mitfa /  zebrafish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1were isolated for RNA seq.", "tissue:mucosal melanoma|cell type:melanoma|genotype:roy / ; mitfa /  fish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1", "GSM8340234", "GSM8340234: MM rep4 [RNA Seq]; Danio rerio; RNA Seq", "GSM8340234 r1", "GSM8340234", "1", "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP515141", null, null, "MI-Dr-F380.R2.fastq.gz MI-Dr-F380.R1.fastq.gz", "fastq fastq", 15136959300.0, 50456531.0, "GSM8340234 r1", "0:150 1:150", "A:3999982463;C:3565423997;G:3623206178;T:3945454250;N:2892412", 150, 150, null, null, 3999982463, 3565423997, 3623206178, 3945454250, 2892412, "SRX24993378", "SRS21694842", "SRA1904140", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", 2, 0.91544, 0.91681, 0.05707, 0.05629, 0.71873, 0.7278, 0.50536, 0.50794, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "nebnext", "bulk", "bulk", "bulk", null, "United States", "2024-06-20", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [32852, "SRR29482331", "SRX24993377", "SRS21694841", "SRP515141", "PRJNA1126244", "Specific oncogene activation of the cell of origin in mucosal melanoma [RNA Seq]", "GSE270354", "Transcriptome Analysis", "Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics  we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly  melanoma only develops from melanocytes lining internal organs  analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression  consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors  allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma  our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations.  Overall design: Bulk RNA sequencing data from mucosal melanoma and cutaneous melanoma zebrafish models", null, null, null, "MM rep3 [RNA Seq]", "GSM8340233", null, "source name:mucosal melanoma|tissue:mucosal melanoma|cell type:melanoma|genotype:roy / ; mitfa /  fish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1|geo loc name:missing|collection date:missing", "MM rep3 [RNA Seq]", "Cutadpt was used to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer11 of zebrafish genome using Tophat 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. Assembly: danRer11 Supplementary files format and content: .txt file contains differential gene expression of mucosal melanoma samples vs. cutaneous melanoma", "mucosal melanoma", null, "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", "Melanomas generated from mitfa / ; tp53 / ; BRAFV600E zebrafish injected with MCR:EGFP or roy / ; mitfa /  zebrafish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1were isolated for RNA seq.", "tissue:mucosal melanoma|cell type:melanoma|genotype:roy / ; mitfa /  fish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1", "GSM8340233", "GSM8340233: MM rep3 [RNA Seq]; Danio rerio; RNA Seq", "GSM8340233 r1", "GSM8340233", "1", "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP515141", null, null, "MI-Dr-F379.R1.fastq.gz MI-Dr-F379.R2.fastq.gz", "fastq fastq", 19584405300.0, 65281351.0, "GSM8340233 r1", "0:150 1:150", "A:5193657176;C:4586793253;G:4681119346;T:5119062192;N:3773333", 150, 150, null, null, 5193657176, 4586793253, 4681119346, 5119062192, 3773333, "SRX24993377", "SRS21694841", "SRA1904140", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", 2, 0.91009, 0.91075, 0.05605, 0.05603, 0.70709, 0.71553, 0.48633, 0.5046, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "nebnext", "bulk", "bulk", "bulk", null, "United States", "2024-06-20", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [32853, "SRR29482332", "SRX24993376", "SRS21694840", "SRP515141", "PRJNA1126244", "Specific oncogene activation of the cell of origin in mucosal melanoma [RNA Seq]", "GSE270354", "Transcriptome Analysis", "Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics  we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly  melanoma only develops from melanocytes lining internal organs  analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression  consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors  allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma  our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations.  Overall design: Bulk RNA sequencing data from mucosal melanoma and cutaneous melanoma zebrafish models", null, null, null, "MM rep2 [RNA Seq]", "GSM8340232", null, "source name:mucosal melanoma|tissue:mucosal melanoma|cell type:melanoma|genotype:roy / ; mitfa /  fish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1|geo loc name:missing|collection date:missing", "MM rep2 [RNA Seq]", "Cutadpt was used to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer11 of zebrafish genome using Tophat 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. Assembly: danRer11 Supplementary files format and content: .txt file contains differential gene expression of mucosal melanoma samples vs. cutaneous melanoma", "mucosal melanoma", null, "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", "Melanomas generated from mitfa / ; tp53 / ; BRAFV600E zebrafish injected with MCR:EGFP or roy / ; mitfa /  zebrafish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1were isolated for RNA seq.", "tissue:mucosal melanoma|cell type:melanoma|genotype:roy / ; mitfa /  fish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1", "GSM8340232", "GSM8340232: MM rep2 [RNA Seq]; Danio rerio; RNA Seq", "GSM8340232 r1", "GSM8340232", "1", "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP515141", null, null, "MI-Dr-F378.R2.fastq.gz MI-Dr-F378.R1.fastq.gz", "fastq fastq", 12509804100.0, 41699347.0, "GSM8340232 r1", "0:150 1:150", "A:3348127771;C:2902757443;G:2952121486;T:3304405412;N:2391988", 150, 150, null, null, 3348127771, 2902757443, 2952121486, 3304405412, 2391988, "SRX24993376", "SRS21694840", "SRA1904140", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", 2, 0.90209, 0.903, 0.07387, 0.07393, 0.7232, 0.73083, 0.51976, 0.52071, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "nebnext", "bulk", "bulk", "bulk", null, "United States", "2024-06-20", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [32854, "SRR29482333", "SRX24993375", "SRS21694839", "SRP515141", "PRJNA1126244", "Specific oncogene activation of the cell of origin in mucosal melanoma [RNA Seq]", "GSE270354", "Transcriptome Analysis", "Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics  we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly  melanoma only develops from melanocytes lining internal organs  analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression  consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors  allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma  our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations.  Overall design: Bulk RNA sequencing data from mucosal melanoma and cutaneous melanoma zebrafish models", null, null, null, "MM rep1 [RNA Seq]", "GSM8340231", null, "source name:mucosal melanoma|tissue:mucosal melanoma|cell type:melanoma|genotype:roy / ; mitfa /  fish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1|geo loc name:missing|collection date:missing", "MM rep1 [RNA Seq]", "Cutadpt was used to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer11 of zebrafish genome using Tophat 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. Assembly: danRer11 Supplementary files format and content: .txt file contains differential gene expression of mucosal melanoma samples vs. cutaneous melanoma", "mucosal melanoma", null, "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", "Melanomas generated from mitfa / ; tp53 / ; BRAFV600E zebrafish injected with MCR:EGFP or roy / ; mitfa /  zebrafish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1were isolated for RNA seq.", "tissue:mucosal melanoma|cell type:melanoma|genotype:roy / ; mitfa /  fish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1", "GSM8340231", "GSM8340231: MM rep1 [RNA Seq]; Danio rerio; RNA Seq", "GSM8340231 r1", "GSM8340231", "1", "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP515141", null, null, "MI-Dr-F377.R2.fastq.gz MI-Dr-F377.R1.fastq.gz", "fastq fastq", 10304309400.0, 34347698.0, "GSM8340231 r1", "0:150 1:150", "A:2725877839;C:2430296510;G:2469399791;T:2676748684;N:1986576", 150, 150, null, null, 2725877839, 2430296510, 2469399791, 2676748684, 1986576, "SRX24993375", "SRS21694839", "SRA1904140", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", 2, 0.9288, 0.9297, 0.05311, 0.05279, 0.7708, 0.77918, 0.53907, 0.53683, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "nebnext", "bulk", "bulk", "bulk", null, "United States", "2024-06-20", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [32855, "SRR29482334", "SRX24993374", "SRS21694838", "SRP515141", "PRJNA1126244", "Specific oncogene activation of the cell of origin in mucosal melanoma [RNA Seq]", "GSE270354", "Transcriptome Analysis", "Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics  we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly  melanoma only develops from melanocytes lining internal organs  analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression  consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors  allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma  our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations.  Overall design: Bulk RNA sequencing data from mucosal melanoma and cutaneous melanoma zebrafish models", null, null, null, "CM rep3 [RNA Seq]", "GSM8340230", null, "source name:cutaneous melanoma|tissue:cutaneous melanoma|cell type:melanoma|genotype:mitfa / ; tp53 / ; BRAFV600E fish injected with MCR:EGFP|geo loc name:missing|collection date:missing", "CM rep3 [RNA Seq]", "Cutadpt was used to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer11 of zebrafish genome using Tophat 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. Assembly: danRer11 Supplementary files format and content: .txt file contains differential gene expression of mucosal melanoma samples vs. cutaneous melanoma", "cutaneous melanoma", null, "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", "Melanomas generated from mitfa / ; tp53 / ; BRAFV600E zebrafish injected with MCR:EGFP or roy / ; mitfa /  zebrafish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1were isolated for RNA seq.", "tissue:cutaneous melanoma|cell type:melanoma|genotype:mitfa / ; tp53 / ; BRAFV600E fish injected with MCR:EGFP", "GSM8340230", "GSM8340230: CM rep3 [RNA Seq]; Danio rerio; RNA Seq", "GSM8340230 r1", "GSM8340230", "1", "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP515141", null, null, "MI_12_USPD16098384-12_H2553BBXX_L8_2.fq.gz MI_12_USPD16098384-12_H2553BBXX_L8_1.fq.gz", "fastq fastq", 10930590300.0, 36435301.0, "GSM8340230 r1", "0:150 1:150", "A:2979658653;C:2484668914;G:2536584911;T:2928246610;N:1431212", 150, 150, null, null, 2979658653, 2484668914, 2536584911, 2928246610, 1431212, "SRX24993374", "SRS21694838", "SRA1904140", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", 2, 0.92203, 0.92273, 0.08582, 0.08561, 0.73815, 0.73868, 0.54966, 0.54645, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "nebnext", "bulk", "bulk", "bulk", null, "United States", "2024-06-20", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [32856, "SRR29482335", "SRX24993373", "SRS21694837", "SRP515141", "PRJNA1126244", "Specific oncogene activation of the cell of origin in mucosal melanoma [RNA Seq]", "GSE270354", "Transcriptome Analysis", "Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics  we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly  melanoma only develops from melanocytes lining internal organs  analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression  consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors  allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma  our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations.  Overall design: Bulk RNA sequencing data from mucosal melanoma and cutaneous melanoma zebrafish models", null, null, null, "CM rep2 [RNA Seq]", "GSM8340229", null, "source name:cutaneous melanoma|tissue:cutaneous melanoma|cell type:melanoma|genotype:mitfa / ; tp53 / ; BRAFV600E fish injected with MCR:EGFP|geo loc name:missing|collection date:missing", "CM rep2 [RNA Seq]", "Cutadpt was used to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer11 of zebrafish genome using Tophat 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. Assembly: danRer11 Supplementary files format and content: .txt file contains differential gene expression of mucosal melanoma samples vs. cutaneous melanoma", "cutaneous melanoma", null, "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", "Melanomas generated from mitfa / ; tp53 / ; BRAFV600E zebrafish injected with MCR:EGFP or roy / ; mitfa /  zebrafish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1were isolated for RNA seq.", "tissue:cutaneous melanoma|cell type:melanoma|genotype:mitfa / ; tp53 / ; BRAFV600E fish injected with MCR:EGFP", "GSM8340229", "GSM8340229: CM rep2 [RNA Seq]; Danio rerio; RNA Seq", "GSM8340229 r1", "GSM8340229", "1", "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP515141", null, null, "MI_11_USPD16098384-11_H2553BBXX_L8_2.fq.gz MI_11_USPD16098384-11_H2553BBXX_L8_1.fq.gz", "fastq fastq", 10972223700.0, 36574079.0, "GSM8340229 r1", "0:150 1:150", "A:2948309811;C:2536000818;G:2588828858;T:2897662110;N:1422103", 150, 150, null, null, 2948309811, 2536000818, 2588828858, 2897662110, 1422103, "SRX24993373", "SRS21694837", "SRA1904140", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", 2, 0.92722, 0.92814, 0.06917, 0.06867, 0.71382, 0.71575, 0.5158, 0.51662, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "nebnext", "bulk", "bulk", "bulk", null, "United States", "2024-06-20", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [32857, "SRR29482336", "SRX24993372", "SRS21694836", "SRP515141", "PRJNA1126244", "Specific oncogene activation of the cell of origin in mucosal melanoma [RNA Seq]", "GSE270354", "Transcriptome Analysis", "Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics  we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly  melanoma only develops from melanocytes lining internal organs  analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression  consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors  allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma  our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations.  Overall design: Bulk RNA sequencing data from mucosal melanoma and cutaneous melanoma zebrafish models", null, null, null, "CM rep1 [RNA Seq]", "GSM8340228", null, "source name:cutaneous melanoma|tissue:cutaneous melanoma|cell type:melanoma|genotype:mitfa / ; tp53 / ; BRAFV600E fish injected with MCR:EGFP|geo loc name:missing|collection date:missing", "CM rep1 [RNA Seq]", "Cutadpt was used to remove adaptor sequences and low quality regions. The high quality reads were aligned to UCSC build danRer11 of zebrafish genome using Tophat 2.0.11 without xxx splicing form calls. Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. Assembly: danRer11 Supplementary files format and content: .txt file contains differential gene expression of mucosal melanoma samples vs. cutaneous melanoma", "cutaneous melanoma", null, "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", "Melanomas generated from mitfa / ; tp53 / ; BRAFV600E zebrafish injected with MCR:EGFP or roy / ; mitfa /  zebrafish injected with CRISPR MCR:tp53 sgRNA; CRISPR MCR:ptena/b sgRNA; MCR:CCND1were isolated for RNA seq.", "tissue:cutaneous melanoma|cell type:melanoma|genotype:mitfa / ; tp53 / ; BRAFV600E fish injected with MCR:EGFP", "GSM8340228", "GSM8340228: CM rep1 [RNA Seq]; Danio rerio; RNA Seq", "GSM8340228 r1", "GSM8340228", "1", "Tissue was disrupted using QIAshredder columns Qiagen 79656. DNA was removed and RNA was purified using columns Qiagen 74134. RNA was polyA selected NEB E7490. NEBNext Ultra RNA Library Prep Kit for Illumina NEB E7530", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP515141", null, null, "MI_10_USPD16098384-10_H2553BBXX_L8_1.fq.gz MI_10_USPD16098384-10_H2553BBXX_L8_2.fq.gz", "fastq fastq", 11662049100.0, 38873497.0, "GSM8340228 r1", "0:150 1:150", "A:3125745391;C:2697305234;G:2752722644;T:3084760577;N:1515254", 150, 150, null, null, 3125745391, 2697305234, 2752722644, 3084760577, 1515254, "SRX24993372", "SRS21694836", "SRA1904140", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", "Insco Lab, Medical Oncology, Dana Farber Cancer Institute", 2, 0.92667, 0.92674, 0.0665, 0.06609, 0.7207, 0.72107, 0.52399, 0.5179, 150, 150, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "poly_a", "nebnext", "bulk", "bulk", "bulk", null, "United States", "2024-06-20", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45035, "SRR6494615", "SRX3583941", "SRS2852966", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "12.2B", "GSM2915057", null, "tissue:Leukemia cells|replicate number:2|self renewal capacity:low|background strain:CG1|cell type:blood", "12.2B", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:2|self renewal capacity:low|background strain:CG1|cell type:blood", "GSM2915057", "GSM2915057: 12.2B; Danio rerio; RNA Seq", "GSM2915057", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915057", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "12.2B_R1.fastq.gz 12.2B_R2.fastq.gz", "fastq fastq", 4198177098.0, 41158599.0, "GSM2915057 r1", "0:51 1:51", "A:933297427;C:1160638498;G:1167269516;T:931714756;N:5256901", 51, 51, null, null, 933297427, 1160638498, 1167269516, 931714756, 5256901, "SRX3583941", "SRS2852966", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.94442, 0.95328, 0.19284, 0.1878, 0.83668, 0.83792, 0.64423, 0.61017, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45036, "SRR6494614", "SRX3583940", "SRS2852967", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "12.2A", "GSM2915056", null, "tissue:Leukemia cells|replicate number:1|self renewal capacity:low|background strain:CG1|cell type:blood", "12.2A", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:1|self renewal capacity:low|background strain:CG1|cell type:blood", "GSM2915056", "GSM2915056: 12.2A; Danio rerio; RNA Seq", "GSM2915056", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915056", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "12.2A_R1.fastq.gz 12.2A_R2.fastq.gz", "fastq fastq", 4664784100.0, 46647841.0, "GSM2915056 r1", "0:50 1:50", "A:1104404665;C:1222868717;G:1231852847;T:1104961679;N:696192", 50, 50, null, null, 1104404665, 1222868717, 1231852847, 1104961679, 696192, "SRX3583940", "SRS2852967", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.92243, 0.93608, 0.22772, 0.22103, 0.80411, 0.80626, 0.61604, 0.59999, 50, 50, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45037, "SRR6494613", "SRX3583939", "SRS2852965", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "10.2B", "GSM2915055", null, "tissue:Leukemia cells|replicate number:2|self renewal capacity:low|background strain:CG1|cell type:blood", "10.2B", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:2|self renewal capacity:low|background strain:CG1|cell type:blood", "GSM2915055", "GSM2915055: 10.2B; Danio rerio; RNA Seq", "GSM2915055", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915055", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "10.2B_R1.fastq.gz 10.2B_R2.fastq.gz", "fastq fastq", 4065465714.0, 39857507.0, "GSM2915055 r1", "0:51 1:51", "A:1004499069;C:1015058139;G:1027707268;T:1013076822;N:5124416", 51, 51, null, null, 1004499069, 1015058139, 1027707268, 1013076822, 5124416, "SRX3583939", "SRS2852965", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.92877, 0.93609, 0.2145, 0.21044, 0.78879, 0.79034, 0.57017, 0.5699, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45038, "SRR6494612", "SRX3583938", "SRS2852964", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "10.2A", "GSM2915054", null, "tissue:Leukemia cells|replicate number:1|self renewal capacity:low|background strain:CG1|cell type:blood", "10.2A", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:1|self renewal capacity:low|background strain:CG1|cell type:blood", "GSM2915054", "GSM2915054: 10.2A; Danio rerio; RNA Seq", "GSM2915054", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915054", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "10.2A_R1.fastq.gz 10.2A_R2.fastq.gz", "fastq fastq", 5825997800.0, 58259978.0, "GSM2915054 r1", "0:50 1:50", "A:1452695020;C:1453278793;G:1458683037;T:1460466496;N:874454", 50, 50, null, null, 1452695020, 1453278793, 1458683037, 1460466496, 874454, "SRX3583938", "SRS2852964", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.92886, 0.9381, 0.21573, 0.21305, 0.78632, 0.78813, 0.55808, 0.56378, 50, 50, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45039, "SRR6494611", "SRX3583937", "SRS2852963", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "9.2B", "GSM2915053", null, "tissue:Leukemia cells|replicate number:2|self renewal capacity:low|background strain:CG1|cell type:blood", "9.2B", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:2|self renewal capacity:low|background strain:CG1|cell type:blood", "GSM2915053", "GSM2915053: 9.2B; Danio rerio; RNA Seq", "GSM2915053", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915053", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "9.2B_R1.fastq.gz 9.2B_R2.fastq.gz", "fastq fastq", 4506740256.0, 44183728.0, "GSM2915053 r1", "0:51 1:51", "A:1112271704;C:1123458923;G:1145952359;T:1119515017;N:5542253", 51, 51, null, null, 1112271704, 1123458923, 1145952359, 1119515017, 5542253, "SRX3583937", "SRS2852963", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.92746, 0.93269, 0.23417, 0.23028, 0.79904, 0.8032, 0.54807, 0.56848, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45040, "SRR6494610", "SRX3583936", "SRS2852962", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "9.2A", "GSM2915052", null, "tissue:Leukemia cells|replicate number:1|self renewal capacity:low|background strain:CG1|cell type:blood", "9.2A", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:1|self renewal capacity:low|background strain:CG1|cell type:blood", "GSM2915052", "GSM2915052: 9.2A; Danio rerio; RNA Seq", "GSM2915052", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915052", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "9.2A_R1.fastq.gz 9.2A_R2.fastq.gz", "fastq fastq", 4360921770.0, 42754135.0, "GSM2915052 r1", "0:51 1:51", "A:1079666608;C:1084041944;G:1104190687;T:1087055139;N:5967392", 51, 51, null, null, 1079666608, 1084041944, 1104190687, 1087055139, 5967392, "SRX3583936", "SRS2852962", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.93401, 0.93834, 0.24172, 0.23839, 0.79543, 0.79853, 0.54668, 0.56646, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45041, "SRR6494609", "SRX3583935", "SRS2852961", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "7.2.1B", "GSM2915051", null, "tissue:Leukemia cells|replicate number:2|self renewal capacity:high|background strain:CG1|cell type:blood", "7.2.1B", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:2|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915051", "GSM2915051: 7.2.1B; Danio rerio; RNA Seq", "GSM2915051", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915051", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "7.2.1B_R1.fastq.gz 7.2.1B_R2.fastq.gz", "fastq fastq", 4269804864.0, 41860832.0, "GSM2915051 r1", "0:51 1:51", "A:1061177239;C:1059094144;G:1073327634;T:1070820946;N:5384901", 51, 51, null, null, 1061177239, 1059094144, 1073327634, 1070820946, 5384901, "SRX3583935", "SRS2852961", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.93904, 0.94983, 0.27598, 0.27453, 0.80353, 0.80732, 0.56729, 0.5674, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45042, "SRR6494608", "SRX3583934", "SRS2852960", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "7.2.1A", "GSM2915050", null, "tissue:Leukemia cells|replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "7.2.1A", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915050", "GSM2915050: 7.2.1A; Danio rerio; RNA Seq", "GSM2915050", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915050", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "7.2.1A_R1.fastq.gz 7.2.1A_R2.fastq.gz", "fastq fastq", 4365552700.0, 43655527.0, "GSM2915050 r1", "0:50 1:50", "A:1081366107;C:1100458538;G:1102308246;T:1080751188;N:668621", 50, 50, null, null, 1081366107, 1100458538, 1102308246, 1080751188, 668621, "SRX3583934", "SRS2852960", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.95152, 0.95745, 0.25194, 0.2485, 0.80436, 0.80377, 0.48817, 0.50698, 50, 50, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45043, "SRR6494607", "SRX3583933", "SRS2852959", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "13.1.1B", "GSM2915049", null, "tissue:Leukemia cells|replicate number:2|self renewal capacity:high|background strain:CG1|cell type:blood", "13.1.1B", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:2|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915049", "GSM2915049: 13.1.1B; Danio rerio; RNA Seq", "GSM2915049", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915049", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "13.1.1B_R1.fastq.gz 13.1.1B_R2.fastq.gz", "fastq fastq", 4354271166.0, 42688933.0, "GSM2915049 r1", "0:51 1:51", "A:1064019486;C:1100195568;G:1114361396;T:1070229465;N:5465251", 51, 51, null, null, 1064019486, 1100195568, 1114361396, 1070229465, 5465251, "SRX3583933", "SRS2852959", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.93925, 0.94875, 0.25209, 0.24836, 0.80837, 0.80996, 0.47839, 0.58777, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45044, "SRR6494606", "SRX3583932", "SRS2853049", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "13.1.1A", "GSM2915048", null, "tissue:Leukemia cells|replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "13.1.1A", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915048", "GSM2915048: 13.1.1A; Danio rerio; RNA Seq", "GSM2915048", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915048", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "13.1.1A_R1.fastq.gz 13.1.1A_R2.fastq.gz", "fastq fastq", 4640640100.0, 46406401.0, "GSM2915048 r1", "0:50 1:50", "A:1200822095;C:1111931040;G:1117066830;T:1210105773;N:714362", 50, 50, null, null, 1200822095, 1111931040, 1117066830, 1210105773, 714362, "SRX3583932", "SRS2853049", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.91613, 0.92428, 0.32822, 0.32518, 0.79101, 0.79243, 0.56679, 0.56385, 50, 50, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45045, "SRR6494605", "SRX3583931", "SRS2852958", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "15.2B", "GSM2915047", null, "tissue:Leukemia cells|replicate number:2|self renewal capacity:high|background strain:CG1|cell type:blood", "15.2B", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:2|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915047", "GSM2915047: 15.2B; Danio rerio; RNA Seq", "GSM2915047", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915047", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "15.2B_R1.fastq.gz 15.2B_R2.fastq.gz", "fastq fastq", 4734832758.0, 46419929.0, "GSM2915047 r1", "0:51 1:51", "A:1173476233;C:1180848673;G:1186821491;T:1187703528;N:5982833", 51, 51, null, null, 1173476233, 1180848673, 1186821491, 1187703528, 5982833, "SRX3583931", "SRS2852958", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.93596, 0.94402, 0.29428, 0.29343, 0.81174, 0.81292, 0.59979, 0.57701, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45046, "SRR6494604", "SRX3583930", "SRS2852957", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "15.2A", "GSM2915046", null, "tissue:Leukemia cells|replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "15.2A", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915046", "GSM2915046: 15.2A; Danio rerio; RNA Seq", "GSM2915046", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915046", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "15.2A_R1.fastq.gz 15.2A_R2.fastq.gz", "fastq fastq", 4146122700.0, 41461227.0, "GSM2915046 r1", "0:50 1:50", "A:1018153184;C:1052958176;G:1054611038;T:1019770342;N:629960", 50, 50, null, null, 1018153184, 1052958176, 1054611038, 1019770342, 629960, "SRX3583930", "SRS2852957", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.95101, 0.95735, 0.2546, 0.25126, 0.81497, 0.81497, 0.51581, 0.58721, 50, 50, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45047, "SRR6494603", "SRX3583929", "SRS2852956", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "2.1B", "GSM2915045", null, "tissue:Leukemia cells|replicate number:2|self renewal capacity:high|background strain:CG1|cell type:blood", "2.1B", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:2|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915045", "GSM2915045: 2.1B; Danio rerio; RNA Seq", "GSM2915045", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915045", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "2.1B_R1.fastq.gz 2.1B_R2.fastq.gz", "fastq fastq", 4485073008.0, 43971304.0, "GSM2915045 r1", "0:51 1:51", "A:1077166487;C:1155027635;G:1165169697;T:1082191047;N:5518142", 51, 51, null, null, 1077166487, 1155027635, 1165169697, 1082191047, 5518142, "SRX3583929", "SRS2852956", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.94959, 0.95559, 0.25458, 0.25289, 0.8238, 0.82475, 0.55503, 0.59704, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45048, "SRR6494602", "SRX3583928", "SRS2852955", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "2.1A", "GSM2915044", null, "tissue:Leukemia cells|replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "2.1A", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915044", "GSM2915044: 2.1A; Danio rerio; RNA Seq", "GSM2915044", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915044", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "2.1A_R1.fastq.gz 2.1A_R2.fastq.gz", "fastq fastq", 4648689474.0, 45575387.0, "GSM2915044 r1", "0:51 1:51", "A:1150739906;C:1156762106;G:1174418869;T:1160455829;N:6312764", 51, 51, null, null, 1150739906, 1156762106, 1174418869, 1160455829, 6312764, "SRX3583928", "SRS2852955", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.93443, 0.9425, 0.3037, 0.30192, 0.81675, 0.82035, 0.5641, 0.55492, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45049, "SRR6494601", "SRX3583927", "SRS2852953", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "8.3B", "GSM2915043", null, "tissue:Leukemia cells|replicate number:2|self renewal capacity:high|background strain:CG1|cell type:blood", "8.3B", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:2|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915043", "GSM2915043: 8.3B; Danio rerio; RNA Seq", "GSM2915043", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915043", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "8.3B_R1.fastq.gz 8.3B_R2.fastq.gz", "fastq fastq", 4463531424.0, 43760112.0, "GSM2915043 r1", "0:51 1:51", "A:1113035544;C:1103847188;G:1123396000;T:1117789326;N:5463366", 51, 51, null, null, 1113035544, 1103847188, 1123396000, 1117789326, 5463366, "SRX3583927", "SRS2852953", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.94125, 0.95133, 0.17024, 0.16786, 0.78924, 0.79255, 0.54779, 0.54529, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45050, "SRR6494600", "SRX3583926", "SRS2852954", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "8.3A", "GSM2915042", null, "tissue:Leukemia cells|replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "8.3A", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915042", "GSM2915042: 8.3A; Danio rerio; RNA Seq", "GSM2915042", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915042", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "8.3A_R1.fastq.gz 8.3A_R2.fastq.gz", "fastq fastq", 4393347876.0, 43072038.0, "GSM2915042 r1", "0:51 1:51", "A:1076247371;C:1106828053;G:1120376486;T:1083936462;N:5959504", 51, 51, null, null, 1076247371, 1106828053, 1120376486, 1083936462, 5959504, "SRX3583926", "SRS2852954", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.94915, 0.95442, 0.17122, 0.16696, 0.79732, 0.79744, 0.56274, 0.56769, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45051, "SRR6494599", "SRX3583925", "SRS2852951", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "4.3.1B", "GSM2915041", null, "tissue:Leukemia cells|replicate number:2|self renewal capacity:high|background strain:CG1|cell type:blood", "4.3.1B", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:2|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915041", "GSM2915041: 4.3.1B; Danio rerio; RNA Seq", "GSM2915041", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915041", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "4.3.1B_R1.fastq.gz 4.3.1B_R2.fastq.gz", "fastq fastq", 4233856698.0, 41508399.0, "GSM2915041 r1", "0:51 1:51", "A:970446998;C:1135557372;G:1151321697;T:971335057;N:5195574", 51, 51, null, null, 970446998, 1135557372, 1151321697, 971335057, 5195574, "SRX3583925", "SRS2852951", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.95681, 0.961, 0.26557, 0.26012, 0.83114, 0.83201, 0.65416, 0.67322, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45052, "SRR6494598", "SRX3583924", "SRS2852952", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "4.3.1A", "GSM2915040", null, "tissue:Leukemia cells|replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "4.3.1A", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915040", "GSM2915040: 4.3.1A; Danio rerio; RNA Seq", "GSM2915040", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915040", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "4.3.1A_R1.fastq.gz 4.3.1A_R2.fastq.gz", "fastq fastq", 4108362222.0, 40278061.0, "GSM2915040 r1", "0:51 1:51", "A:1008174247;C:1035055287;G:1046840431;T:1012717124;N:5575133", 51, 51, null, null, 1008174247, 1035055287, 1046840431, 1012717124, 5575133, "SRX3583924", "SRS2852952", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.9417, 0.94731, 0.22098, 0.21709, 0.7949, 0.79395, 0.54887, 0.56412, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45053, "SRR6494597", "SRX3583923", "SRS2852950", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "14.1.1.1", "GSM2915039", null, "tissue:Leukemia cells|replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "14.1.1.1", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915039", "GSM2915039: 14.1.1.1; Danio rerio; RNA Seq", "GSM2915039", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915039", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "14.1.1.1_R1.fastq.gz 14.1.1.1_R2.fastq.gz", "fastq fastq", 4028614440.0, 39496220.0, "GSM2915039 r1", "0:51 1:51", "A:992630443;C:1013600907;G:1022333543;T:994338823;N:5710724", 51, 51, null, null, 992630443, 1013600907, 1022333543, 994338823, 5710724, "SRX3583923", "SRS2852950", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.93918, 0.94567, 0.25463, 0.2502, 0.8045, 0.80764, 0.56238, 0.57046, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [45054, "SRR6494596", "SRX3583922", "SRS2853033", "SRP130950", "PRJNA428951", "Cell of origin dictates aggression and stem cell activity in acute lymphoblastic leukemia", "GSE108855", "Transcriptome Analysis", "Subclassification of lymphoid neoplasms is often based on the presumed cell of origin based on T and B progenitor gene expression and the effect of cell lineage on influencing functional characteristics such as aggression and self renewal capacity is largely unknown  accounted for in part  by lack of experimental models to address these questions. Here  we have used transgenic zebrafish to create the first models of Myc induced B ALL and mixed phenotypic B/T ALL  opening new avenues for studying the these leukemias in the zebrafish. Our work has utilized syngeneic strain zebrafish  limiting dilution cell transplantation  and the widely reported rag2 Myc transgenic model to provide new understanding of how strain differences can underlie leukemia onset in the zebrafish model. Even more importantly  our work now for the first time  has allowed assessment of cell lineage on dictating aggression and leukemia stem cell frequency independent of the underlying oncogenic driver. In total  our work uncoveres that T ALLs are more aggressive and have higher numbers of leukemia stem cells when compared with B ALL and mixed phenotypic ALL. Furthermore  analysis of our biphenotypic B/T ALL suggests that B cell pathways lock cells in less aggressive and lower stem cell fates and are dominant in regulating these processes when T cell pathways are co regulated within ALL cells. Overall design: The goal of our study is to determine the transcriptional profiles of high and low self renewing capacity tumors. 20 samples total: 11 unique samples 9 samples with biological replicates  6 high self renewing tumors >1% cells could initiate leukemia and 5 low self renewing tumors <1% of cells could initiate leukemia.", null, "pubmed:29749398", null, "8.4.1.1.1", "GSM2915038", null, "tissue:Leukemia cells|replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "8.4.1.1.1", "Demultiplexed reads were aligned using STARDobin et al.  2013 to GRCz10. We used picard to filter out PCR duplicates and also removed reads aligning to rRNA intervals. We then assigned counts to each gene using featureCountsLiao Y  Smyth GK and Shi W 2014. Genome build: GRCz10 Supplementary files format and content: count matrix provided as supplementary file", "Leukemia cells", null, "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", null, "replicate number:1|self renewal capacity:high|background strain:CG1|cell type:blood", "GSM2915038", "GSM2915038: 8.4.1.1.1; Danio rerio; RNA Seq", "GSM2915038", null, "1", "Leukemia cell pellets were mixed 350ul of QIAGEN RLT buffer containing 1% 2 mercaptoethanol  followed by RNA isolation using the RNAeasy Mini kit QIAGEN. RNA samples were prepped and sequenced on the Illumina HiSeq 2000 platform as previously described in Tang et al. PMID 28878000. RNA from bulk tumors were reverse transcribed and sequenced on the Illumina HiSeq 2000 platform.", "GEO Accession:GSM2915038", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP130950", null, null, "8.4.1.1.1_R1.fastq.gz 8.4.1.1.1_R2.fastq.gz", "fastq fastq", 4383721014.0, 42977657.0, "GSM2915038 r1", "0:51 1:51", "A:1049228460;C:1129994718;G:1142953291;T:1055736129;N:5808416", 51, 51, null, null, 1049228460, 1129994718, 1142953291, 1055736129, 5808416, "SRX3583922", "SRS2853033", "SRA649887", "GEO", "Pathology, Massachusetts General Hospital", 2, 0.95266, 0.95783, 0.21527, 0.20965, 0.81357, 0.81481, 0.5049, 0.56239, 51, 51, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "bulk", "bulk", "bulk", null, "United States", "2018-01-08", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52063, "SRR8928785", "SRX5709787", "SRS4648958", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel6", "GSM3730553", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel6", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730553", "GSM3730553: Amel6; Danio rerio; RNA Seq", "GSM3730553", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730553", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel6_S5_L001_R1_001.fastq.gz Amel6_S5_L001_R2_001.fastq.gz", "fastq fastq", 3089102352.0, 20462890.0, "GSM3730553 r1", "0:75.52 1:75.44", "A:810444223;C:731946093;G:730453586;T:815227720;N:1030730", 75, 75, null, null, 810444223, 731946093, 730453586, 815227720, 1030730, "SRX5709787", "SRS4648958", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94677, 0.95042, 0.09901, 0.09821, 0.72699, 0.73083, 0.51751, 0.51563, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52064, "SRR8928786", "SRX5709787", "SRS4648958", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel6", "GSM3730553", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel6", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730553", "GSM3730553: Amel6; Danio rerio; RNA Seq", "GSM3730553", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730553", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel6_S5_L002_R2_001.fastq.gz Amel6_S5_L002_R1_001.fastq.gz", "fastq fastq", 3058617314.0, 20261075.0, "GSM3730553 r2", "0:75.52 1:75.44", "A:802441933;C:724939014;G:723280124;T:806898227;N:1058016", 75, 75, null, null, 802441933, 724939014, 723280124, 806898227, 1058016, "SRX5709787", "SRS4648958", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94649, 0.95045, 0.09951, 0.09827, 0.72559, 0.73079, 0.50642, 0.50758, 75, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52065, "SRR8928787", "SRX5709787", "SRS4648958", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel6", "GSM3730553", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel6", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730553", "GSM3730553: Amel6; Danio rerio; RNA Seq", "GSM3730553", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730553", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel6_S5_L003_R2_001.fastq.gz Amel6_S5_L003_R1_001.fastq.gz", "fastq fastq", 3128611212.0, 20723400.0, "GSM3730553 r3", "0:75.52 1:75.45", "A:820044038;C:741998456;G:740859695;T:825277240;N:431783", 75, 75, null, null, 820044038, 741998456, 740859695, 825277240, 431783, "SRX5709787", "SRS4648958", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94639, 0.95081, 0.09981, 0.09721, 0.72476, 0.72951, 0.50658, 0.51736, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52066, "SRR8928788", "SRX5709787", "SRS4648958", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel6", "GSM3730553", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel6", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730553", "GSM3730553: Amel6; Danio rerio; RNA Seq", "GSM3730553", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730553", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel6_S5_L004_R1_001.fastq.gz Amel6_S5_L004_R2_001.fastq.gz", "fastq fastq", 3109418349.0, 20595817.0, "GSM3730553 r4", "0:75.52 1:75.46", "A:814804919;C:737475396;G:736560293;T:820184885;N:392856", 75, 75, null, null, 814804919, 737475396, 736560293, 820184885, 392856, "SRX5709787", "SRS4648958", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94717, 0.95026, 0.09942, 0.09882, 0.72756, 0.73249, 0.50663, 0.51076, 75, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52067, "SRR8928781", "SRX5709786", "SRS4648957", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel5", "GSM3730552", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel5", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730552", "GSM3730552: Amel5; Danio rerio; RNA Seq", "GSM3730552", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730552", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel5_S3_L001_R1_001.fastq.gz Amel5_S3_L001_R2_001.fastq.gz", "fastq fastq", 3845899663.0, 25480471.0, "GSM3730552 r1", "0:75.51 1:75.43", "A:1007902985;C:913342506;G:905547259;T:1017763788;N:1343125", 75, 75, null, null, 1007902985, 913342506, 905547259, 1017763788, 1343125, "SRX5709786", "SRS4648957", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.9477, 0.95307, 0.08215, 0.08043, 0.71954, 0.72192, 0.53777, 0.54099, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52068, "SRR8928782", "SRX5709786", "SRS4648957", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel5", "GSM3730552", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel5", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730552", "GSM3730552: Amel5; Danio rerio; RNA Seq", "GSM3730552", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730552", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel5_S3_L002_R1_001.fastq.gz Amel5_S3_L002_R2_001.fastq.gz", "fastq fastq", 3830792175.0, 25380028.0, "GSM3730552 r2", "0:75.51 1:75.43", "A:1003723604;C:910154247;G:902293861;T:1013260225;N:1360238", 75, 75, null, null, 1003723604, 910154247, 902293861, 1013260225, 1360238, "SRX5709786", "SRS4648957", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94717, 0.9517, 0.08224, 0.08041, 0.7217, 0.72421, 0.54535, 0.54734, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52069, "SRR8928783", "SRX5709786", "SRS4648957", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel5", "GSM3730552", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel5", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730552", "GSM3730552: Amel5; Danio rerio; RNA Seq", "GSM3730552", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730552", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel5_S3_L003_R1_001.fastq.gz Amel5_S3_L003_R2_001.fastq.gz", "fastq fastq", 3963440466.0, 26257278.0, "GSM3730552 r3", "0:75.51 1:75.44", "A:1037776754;C:942337464;G:934574614;T:1048175193;N:576441", 75, 75, null, null, 1037776754, 942337464, 934574614, 1048175193, 576441, "SRX5709786", "SRS4648957", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.9469, 0.95278, 0.08101, 0.07978, 0.72062, 0.72239, 0.54393, 0.5432, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52070, "SRR8928784", "SRX5709786", "SRS4648957", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel5", "GSM3730552", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel5", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730552", "GSM3730552: Amel5; Danio rerio; RNA Seq", "GSM3730552", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730552", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel5_S3_L004_R1_001.fastq.gz Amel5_S3_L004_R2_001.fastq.gz", "fastq fastq", 3952929871.0, 26186694.0, "GSM3730552 r4", "0:75.51 1:75.44", "A:1034783783;C:939888544;G:932238100;T:1045509532;N:509912", 75, 75, null, null, 1034783783, 939888544, 932238100, 1045509532, 509912, "SRX5709786", "SRS4648957", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94735, 0.95351, 0.08091, 0.07998, 0.71942, 0.72291, 0.54023, 0.53162, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52071, "SRR8928777", "SRX5709785", "SRS4648956", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel4", "GSM3730551", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel4", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730551", "GSM3730551: Amel4; Danio rerio; RNA Seq", "GSM3730551", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730551", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel4_S8_L001_R2_001.fastq.gz Amel4_S8_L001_R1_001.fastq.gz", "fastq fastq", 2886041762.0, 19117135.0, "GSM3730551 r1", "0:75.53 1:75.44", "A:745714560;C:696972305;G:692640016;T:749769771;N:945110", 75, 75, null, null, 745714560, 696972305, 692640016, 749769771, 945110, "SRX5709785", "SRS4648956", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95613, 0.95926, 0.06761, 0.06618, 0.72021, 0.72281, 0.49938, 0.50266, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52072, "SRR8928778", "SRX5709785", "SRS4648956", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel4", "GSM3730551", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel4", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730551", "GSM3730551: Amel4; Danio rerio; RNA Seq", "GSM3730551", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730551", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel4_S8_L002_R2_001.fastq.gz Amel4_S8_L002_R1_001.fastq.gz", "fastq fastq", 2880979562.0, 19083533.0, "GSM3730551 r2", "0:75.53 1:75.44", "A:744297020;C:695983725;G:691508620;T:748225575;N:964622", 75, 75, null, null, 744297020, 695983725, 691508620, 748225575, 964622, "SRX5709785", "SRS4648956", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95533, 0.95849, 0.0652, 0.06427, 0.71928, 0.7206, 0.51249, 0.50459, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52073, "SRR8928779", "SRX5709785", "SRS4648956", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel4", "GSM3730551", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel4", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730551", "GSM3730551: Amel4; Danio rerio; RNA Seq", "GSM3730551", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730551", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel4_S8_L003_R2_001.fastq.gz Amel4_S8_L003_R1_001.fastq.gz", "fastq fastq", 2981526762.0, 19748083.0, "GSM3730551 r3", "0:75.53 1:75.45", "A:769497490;C:720863624;G:716669114;T:774130691;N:365843", 75, 75, null, null, 769497490, 720863624, 716669114, 774130691, 365843, "SRX5709785", "SRS4648956", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95712, 0.9597, 0.06752, 0.06501, 0.71959, 0.72216, 0.50735, 0.50447, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52074, "SRR8928780", "SRX5709785", "SRS4648956", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel4", "GSM3730551", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel4", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730551", "GSM3730551: Amel4; Danio rerio; RNA Seq", "GSM3730551", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730551", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel4_S8_L004_R2_001.fastq.gz Amel4_S8_L004_R1_001.fastq.gz", "fastq fastq", 2974901538.0, 19703855.0, "GSM3730551 r4", "0:75.53 1:75.45", "A:767738770;C:719269216;G:715088651;T:772459769;N:345132", 75, 75, null, null, 767738770, 719269216, 715088651, 772459769, 345132, "SRX5709785", "SRS4648956", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95598, 0.95932, 0.06682, 0.0653, 0.71997, 0.72279, 0.50468, 0.50201, 74, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52075, "SRR8928773", "SRX5709784", "SRS4648955", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel3", "GSM3730550", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel3", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730550", "GSM3730550: Amel3; Danio rerio; RNA Seq", "GSM3730550", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730550", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel3_S9_L001_R1_001.fastq.gz Amel3_S9_L001_R2_001.fastq.gz", "fastq fastq", 2930679204.0, 19435805.0, "GSM3730550 r1", "0:75.44 1:75.35", "A:756063662;C:705514256;G:706625785;T:761431362;N:1044139", 75, 75, null, null, 756063662, 705514256, 706625785, 761431362, 1044139, "SRX5709784", "SRS4648955", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95508, 0.9572, 0.08859, 0.08788, 0.71455, 0.71965, 0.50692, 0.50576, 74, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52076, "SRR8928774", "SRX5709784", "SRS4648955", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel3", "GSM3730550", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel3", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730550", "GSM3730550: Amel3; Danio rerio; RNA Seq", "GSM3730550", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730550", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel3_S9_L002_R1_001.fastq.gz Amel3_S9_L002_R2_001.fastq.gz", "fastq fastq", 2912583958.0, 19315710.0, "GSM3730550 r2", "0:75.44 1:75.35", "A:751808617;C:701641892;G:701461745;T:756626864;N:1044840", 75, 75, null, null, 751808617, 701641892, 701461745, 756626864, 1044840, "SRX5709784", "SRS4648955", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95433, 0.95596, 0.08715, 0.08536, 0.71814, 0.72176, 0.49647, 0.50537, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52077, "SRR8928775", "SRX5709784", "SRS4648955", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel3", "GSM3730550", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel3", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730550", "GSM3730550: Amel3; Danio rerio; RNA Seq", "GSM3730550", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730550", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel3_S9_L003_R1_001.fastq.gz Amel3_S9_L003_R2_001.fastq.gz", "fastq fastq", 3022355365.0, 20042789.0, "GSM3730550 r3", "0:75.43 1:75.36", "A:778676024;C:728323552;G:730523545;T:784384197;N:448047", 75, 75, null, null, 778676024, 728323552, 730523545, 784384197, 448047, "SRX5709784", "SRS4648955", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95387, 0.95675, 0.08889, 0.08724, 0.71666, 0.71987, 0.49682, 0.50605, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52078, "SRR8928776", "SRX5709784", "SRS4648955", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel3", "GSM3730550", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel3", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730550", "GSM3730550: Amel3; Danio rerio; RNA Seq", "GSM3730550", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730550", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel3_S9_L004_R1_001.fastq.gz Amel3_S9_L004_R2_001.fastq.gz", "fastq fastq", 3004151850.0, 19921730.0, "GSM3730550 r4", "0:75.44 1:75.36", "A:774180434;C:724048692;G:725612847;T:779881530;N:428347", 75, 75, null, null, 774180434, 724048692, 725612847, 779881530, 428347, "SRX5709784", "SRS4648955", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95376, 0.95663, 0.08759, 0.08656, 0.71467, 0.72044, 0.49542, 0.50324, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52079, "SRR8928769", "SRX5709783", "SRS4648954", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel2", "GSM3730549", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel2", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730549", "GSM3730549: Amel2; Danio rerio; RNA Seq", "GSM3730549", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730549", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel2_S4_L001_R1_001.fastq.gz Amel2_S4_L001_R2_001.fastq.gz", "fastq fastq", 3268935613.0, 21656809.0, "GSM3730549 r1", "0:75.52 1:75.43", "A:846907306;C:788197780;G:780394168;T:852345163;N:1091196", 75, 75, null, null, 846907306, 788197780, 780394168, 852345163, 1091196, "SRX5709783", "SRS4648954", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95537, 0.95799, 0.09056, 0.08917, 0.72239, 0.72539, 0.51729, 0.52202, 74, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52080, "SRR8928770", "SRX5709783", "SRS4648954", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel2", "GSM3730549", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel2", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730549", "GSM3730549: Amel2; Danio rerio; RNA Seq", "GSM3730549", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730549", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel2_S4_L002_R1_001.fastq.gz Amel2_S4_L002_R2_001.fastq.gz", "fastq fastq", 3226588390.0, 21376493.0, "GSM3730549 r2", "0:75.52 1:75.43", "A:835755184;C:778366780;G:770463573;T:840865108;N:1137745", 75, 75, null, null, 835755184, 778366780, 770463573, 840865108, 1137745, "SRX5709783", "SRS4648954", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95559, 0.95813, 0.08976, 0.08792, 0.72135, 0.72391, 0.51541, 0.51295, 76, 74, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52081, "SRR8928771", "SRX5709783", "SRS4648954", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel2", "GSM3730549", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel2", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730549", "GSM3730549: Amel2; Danio rerio; RNA Seq", "GSM3730549", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730549", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel2_S4_L003_R1_001.fastq.gz Amel2_S4_L003_R2_001.fastq.gz", "fastq fastq", 3292047316.0, 21808866.0, "GSM3730549 r3", "0:75.51 1:75.44", "A:851989684;C:794623343;G:787094540;T:857865610;N:474139", 75, 75, null, null, 851989684, 794623343, 787094540, 857865610, 474139, "SRX5709783", "SRS4648954", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95538, 0.95823, 0.08941, 0.08839, 0.72529, 0.72715, 0.51447, 0.5172, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52082, "SRR8928772", "SRX5709783", "SRS4648954", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel2", "GSM3730549", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel2", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730549", "GSM3730549: Amel2; Danio rerio; RNA Seq", "GSM3730549", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730549", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel2_S4_L004_R1_001.fastq.gz Amel2_S4_L004_R2_001.fastq.gz", "fastq fastq", 3275717166.0, 21700295.0, "GSM3730549 r4", "0:75.51 1:75.44", "A:847612305;C:790751502;G:783402353;T:853510433;N:440573", 75, 75, null, null, 847612305, 790751502, 783402353, 853510433, 440573, "SRX5709783", "SRS4648954", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95687, 0.95909, 0.09079, 0.0887, 0.72366, 0.72583, 0.51237, 0.51025, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52083, "SRR8928765", "SRX5709782", "SRS4648953", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel1", "GSM3730548", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel1", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730548", "GSM3730548: Amel1; Danio rerio; RNA Seq", "GSM3730548", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730548", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel1_S10_L001_R1_001.fastq.gz Amel1_S10_L001_R2_001.fastq.gz", "fastq fastq", 1296757981.0, 8593293.0, "GSM3730548 r1", "0:75.49 1:75.41", "A:339674471;C:304818903;G:310872709;T:340924894;N:467004", 75, 75, null, null, 339674471, 304818903, 310872709, 340924894, 467004, "SRX5709782", "SRS4648953", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.93919, 0.9453, 0.08676, 0.0855, 0.70301, 0.70843, 0.54058, 0.54118, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52084, "SRR8928766", "SRX5709782", "SRS4648953", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel1", "GSM3730548", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel1", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730548", "GSM3730548: Amel1; Danio rerio; RNA Seq", "GSM3730548", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730548", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel1_S10_L002_R1_001.fastq.gz Amel1_S10_L002_R2_001.fastq.gz", "fastq fastq", 1293766222.0, 8573312.0, "GSM3730548 r2", "0:75.49 1:75.41", "A:339076063;C:304246264;G:309878807;T:340079482;N:485606", 75, 75, null, null, 339076063, 304246264, 309878807, 340079482, 485606, "SRX5709782", "SRS4648953", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.93959, 0.94514, 0.08855, 0.08665, 0.70299, 0.7078, 0.53612, 0.52536, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52085, "SRR8928767", "SRX5709782", "SRS4648953", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel1", "GSM3730548", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel1", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730548", "GSM3730548: Amel1; Danio rerio; RNA Seq", "GSM3730548", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730548", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel1_S10_L003_R1_001.fastq.gz Amel1_S10_L003_R2_001.fastq.gz", "fastq fastq", 1333975905.0, 8839271.0, "GSM3730548 r3", "0:75.49 1:75.43", "A:349054400;C:313917488;G:320242811;T:350549227;N:211979", 75, 75, null, null, 349054400, 313917488, 320242811, 350549227, 211979, "SRX5709782", "SRS4648953", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94043, 0.94573, 0.08907, 0.08771, 0.70587, 0.71009, 0.53623, 0.53984, 74, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52086, "SRR8928768", "SRX5709782", "SRS4648953", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "Amel1", "GSM3730548", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "Amel1", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular amelanotic", "GSM3730548", "GSM3730548: Amel1; Danio rerio; RNA Seq", "GSM3730548", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730548", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "Amel1_S10_L004_R1_001.fastq.gz Amel1_S10_L004_R2_001.fastq.gz", "fastq fastq", 1332440984.0, 8828672.0, "GSM3730548 r4", "0:75.49 1:75.43", "A:348678792;C:313541031;G:319896373;T:350138792;N:185996", 75, 75, null, null, 348678792, 313541031, 319896373, 350138792, 185996, "SRX5709782", "SRS4648953", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.93859, 0.94539, 0.08889, 0.08676, 0.70343, 0.70871, 0.53313, 0.53681, 75, 74, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52087, "SRR8928761", "SRX5709781", "SRS4648952", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 6", "GSM3730547", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "triple 6", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "GSM3730547", "GSM3730547: triple 6; Danio rerio; RNA Seq", "GSM3730547", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730547", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-6_S1_L001_R1_001.fastq.gz JT-Triple-6_S1_L001_R2_001.fastq.gz", "fastq fastq", 1951008261.0, 12922500.0, "GSM3730547 r1", "0:75.53 1:75.45", "A:508040283;C:464499582;G:463120326;T:514989455;N:358615", 75, 75, null, null, 508040283, 464499582, 463120326, 514989455, 358615, "SRX5709781", "SRS4648952", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94493, 0.94905, 0.08076, 0.07961, 0.7024, 0.70447, 0.51843, 0.51943, 76, 74, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52088, "SRR8928762", "SRX5709781", "SRS4648952", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 6", "GSM3730547", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "triple 6", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "GSM3730547", "GSM3730547: triple 6; Danio rerio; RNA Seq", "GSM3730547", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730547", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-6_S1_L002_R1_001.fastq.gz JT-Triple-6_S1_L002_R2_001.fastq.gz", "fastq fastq", 1949536672.0, 12912498.0, "GSM3730547 r2", "0:75.53 1:75.45", "A:507859940;C:464055368;G:462767126;T:514504857;N:349381", 75, 75, null, null, 507859940, 464055368, 462767126, 514504857, 349381, "SRX5709781", "SRS4648952", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94526, 0.95014, 0.08134, 0.08075, 0.70256, 0.70538, 0.5167, 0.5279, 75, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52089, "SRR8928763", "SRX5709781", "SRS4648952", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 6", "GSM3730547", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "triple 6", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "GSM3730547", "GSM3730547: triple 6; Danio rerio; RNA Seq", "GSM3730547", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730547", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-6_S1_L003_R1_001.fastq.gz JT-Triple-6_S1_L003_R2_001.fastq.gz", "fastq fastq", 1977609165.0, 13098209.0, "GSM3730547 r3", "0:75.53 1:75.46", "A:514797892;C:471111083;G:469700893;T:521854222;N:145075", 75, 75, null, null, 514797892, 471111083, 469700893, 521854222, 145075, "SRX5709781", "SRS4648952", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94591, 0.94984, 0.08121, 0.07963, 0.70191, 0.7051, 0.52527, 0.51644, 74, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52090, "SRR8928764", "SRX5709781", "SRS4648952", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 6", "GSM3730547", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "triple 6", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "GSM3730547", "GSM3730547: triple 6; Danio rerio; RNA Seq", "GSM3730547", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730547", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-6_S1_L004_R1_001.fastq.gz JT-Triple-6_S1_L004_R2_001.fastq.gz", "fastq fastq", 1961044963.0, 12988233.0, "GSM3730547 r4", "0:75.53 1:75.46", "A:510685372;C:467019990;G:465736019;T:517486349;N:117233", 75, 75, null, null, 510685372, 467019990, 465736019, 517486349, 117233, "SRX5709781", "SRS4648952", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94647, 0.9505, 0.08116, 0.07982, 0.70179, 0.70396, 0.5241, 0.51644, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52091, "SRR8928757", "SRX5709780", "SRS4648951", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 5", "GSM3730546", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 5", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730546", "GSM3730546: triple 5; Danio rerio; RNA Seq", "GSM3730546", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730546", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-5_S10_L001_R1_001.fastq.gz JT-Triple-5_S10_L001_R2_001.fastq.gz", "fastq fastq", 1917441842.0, 12701148.0, "GSM3730546 r1", "0:75.52 1:75.44", "A:491019662;C:465129001;G:463723827;T:497237119;N:332233", 75, 75, null, null, 491019662, 465129001, 463723827, 497237119, 332233, "SRX5709780", "SRS4648951", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95388, 0.95528, 0.06661, 0.06614, 0.70544, 0.70672, 0.46952, 0.46537, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52092, "SRR8928758", "SRX5709780", "SRS4648951", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 5", "GSM3730546", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 5", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730546", "GSM3730546: triple 5; Danio rerio; RNA Seq", "GSM3730546", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730546", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-5_S10_L002_R1_001.fastq.gz JT-Triple-5_S10_L002_R2_001.fastq.gz", "fastq fastq", 1908862684.0, 12644091.0, "GSM3730546 r2", "0:75.53 1:75.44", "A:488973159;C:463033148;G:461592881;T:494936254;N:327242", 75, 75, null, null, 488973159, 463033148, 461592881, 494936254, 327242, "SRX5709780", "SRS4648951", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95399, 0.95731, 0.0663, 0.06566, 0.70571, 0.70741, 0.46984, 0.48255, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52093, "SRR8928759", "SRX5709780", "SRS4648951", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 5", "GSM3730546", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 5", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730546", "GSM3730546: triple 5; Danio rerio; RNA Seq", "GSM3730546", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730546", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-5_S10_L003_R1_001.fastq.gz JT-Triple-5_S10_L003_R2_001.fastq.gz", "fastq fastq", 1949859134.0, 12915424.0, "GSM3730546 r3", "0:75.52 1:75.45", "A:499121799;C:473285270;G:471895018;T:505435459;N:121588", 75, 75, null, null, 499121799, 473285270, 471895018, 505435459, 121588, "SRX5709780", "SRS4648951", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.9539, 0.95724, 0.06598, 0.06471, 0.70587, 0.70729, 0.47658, 0.47671, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52094, "SRR8928760", "SRX5709780", "SRS4648951", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 5", "GSM3730546", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 5", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730546", "GSM3730546: triple 5; Danio rerio; RNA Seq", "GSM3730546", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730546", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-5_S10_L004_R1_001.fastq.gz JT-Triple-5_S10_L004_R2_001.fastq.gz", "fastq fastq", 1927453733.0, 12766766.0, "GSM3730546 r4", "0:75.52 1:75.45", "A:493524703;C:467676894;G:466473003;T:499678816;N:100317", 75, 75, null, null, 493524703, 467676894, 466473003, 499678816, 100317, "SRX5709780", "SRS4648951", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95377, 0.9562, 0.06658, 0.06533, 0.7049, 0.7067, 0.48141, 0.48141, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52095, "SRR8928753", "SRX5709779", "SRS4648950", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 4", "GSM3730545", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 4", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730545", "GSM3730545: triple 4; Danio rerio; RNA Seq", "GSM3730545", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730545", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-4_S11_L001_R1_001.fastq.gz JT-Triple-4_S11_L001_R2_001.fastq.gz", "fastq fastq", 1770692769.0, 11736310.0, "GSM3730545 r1", "0:75.47 1:75.40", "A:463337938;C:420564259;G:416124212;T:470306424;N:359936", 75, 75, null, null, 463337938, 420564259, 416124212, 470306424, 359936, "SRX5709779", "SRS4648950", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.93769, 0.94108, 0.08292, 0.08129, 0.67805, 0.68034, 0.49546, 0.49366, 73, 73, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52096, "SRR8928754", "SRX5709779", "SRS4648950", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 4", "GSM3730545", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 4", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730545", "GSM3730545: triple 4; Danio rerio; RNA Seq", "GSM3730545", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730545", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-4_S11_L002_R2_001.fastq.gz JT-Triple-4_S11_L002_R1_001.fastq.gz", "fastq fastq", 1763548145.0, 11688670.0, "GSM3730545 r2", "0:75.48 1:75.40", "A:461640137;C:418852823;G:414406338;T:468293440;N:355407", 75, 75, null, null, 461640137, 418852823, 414406338, 468293440, 355407, "SRX5709779", "SRS4648950", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.93908, 0.94119, 0.08405, 0.0826, 0.67827, 0.6815, 0.48726, 0.49455, 76, 74, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52097, "SRR8928755", "SRX5709779", "SRS4648950", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 4", "GSM3730545", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 4", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730545", "GSM3730545: triple 4; Danio rerio; RNA Seq", "GSM3730545", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730545", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-4_S11_L003_R1_001.fastq.gz JT-Triple-4_S11_L003_R2_001.fastq.gz", "fastq fastq", 1780346538.0, 11800161.0, "GSM3730545 r3", "0:75.47 1:75.40", "A:465808207;C:423035041;G:418581871;T:472745538;N:175881", 75, 75, null, null, 465808207, 423035041, 418581871, 472745538, 175881, "SRX5709779", "SRS4648950", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.93861, 0.9419, 0.08251, 0.08125, 0.67777, 0.68142, 0.49816, 0.48234, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52098, "SRR8928756", "SRX5709779", "SRS4648950", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 4", "GSM3730545", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 4", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730545", "GSM3730545: triple 4; Danio rerio; RNA Seq", "GSM3730545", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730545", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-4_S11_L004_R1_001.fastq.gz JT-Triple-4_S11_L004_R2_001.fastq.gz", "fastq fastq", 1757841582.0, 11650697.0, "GSM3730545 r4", "0:75.47 1:75.40", "A:460002616;C:417615089;G:413357265;T:466722157;N:144455", 75, 75, null, null, 460002616, 417615089, 413357265, 466722157, 144455, "SRX5709779", "SRS4648950", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.9382, 0.94089, 0.08252, 0.08139, 0.6774, 0.68051, 0.49503, 0.49642, 74, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52099, "SRR8928749", "SRX5709778", "SRS4648949", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 3", "GSM3730544", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 3", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730544", "GSM3730544: triple 3; Danio rerio; RNA Seq", "GSM3730544", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730544", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-3_S3_L001_R2_001.fastq.gz JT-Triple-3_S3_L001_R1_001.fastq.gz", "fastq fastq", 1909876540.0, 12649255.0, "GSM3730544 r1", "0:75.54 1:75.45", "A:486658097;C:466237753;G:462102054;T:494578688;N:299948", 75, 75, null, null, 486658097, 466237753, 462102054, 494578688, 299948, "SRX5709778", "SRS4648949", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94862, 0.95262, 0.05671, 0.05624, 0.69712, 0.6982, 0.50036, 0.49901, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52100, "SRR8928750", "SRX5709778", "SRS4648949", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 3", "GSM3730544", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 3", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730544", "GSM3730544: triple 3; Danio rerio; RNA Seq", "GSM3730544", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730544", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-3_S3_L002_R1_001.fastq.gz JT-Triple-3_S3_L002_R2_001.fastq.gz", "fastq fastq", 1904633930.0, 12614384.0, "GSM3730544 r2", "0:75.54 1:75.45", "A:485597417;C:464824372;G:460686630;T:493223916;N:301595", 75, 75, null, null, 485597417, 464824372, 460686630, 493223916, 301595, "SRX5709778", "SRS4648949", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94863, 0.95248, 0.05743, 0.05666, 0.6983, 0.70076, 0.49982, 0.50159, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52101, "SRR8928751", "SRX5709778", "SRS4648949", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 3", "GSM3730544", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 3", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730544", "GSM3730544: triple 3; Danio rerio; RNA Seq", "GSM3730544", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730544", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-3_S3_L003_R1_001.fastq.gz JT-Triple-3_S3_L003_R2_001.fastq.gz", "fastq fastq", 1947408108.0, 12897369.0, "GSM3730544 r3", "0:75.54 1:75.46", "A:496173657;C:475558325;G:471420009;T:504165219;N:90898", 75, 75, null, null, 496173657, 475558325, 471420009, 504165219, 90898, "SRX5709778", "SRS4648949", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94968, 0.95322, 0.057, 0.05543, 0.69731, 0.69877, 0.50204, 0.5021, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52102, "SRR8928752", "SRX5709778", "SRS4648949", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 3", "GSM3730544", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 3", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730544", "GSM3730544: triple 3; Danio rerio; RNA Seq", "GSM3730544", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730544", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-3_S3_L004_R1_001.fastq.gz JT-Triple-3_S3_L004_R2_001.fastq.gz", "fastq fastq", 1928250745.0, 12770314.0, "GSM3730544 r4", "0:75.54 1:75.46", "A:491443196;C:470720306;G:466724894;T:499293191;N:69158", 75, 75, null, null, 491443196, 470720306, 466724894, 499293191, 69158, "SRX5709778", "SRS4648949", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94809, 0.9524, 0.05704, 0.0564, 0.69844, 0.70157, 0.49991, 0.49201, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52103, "SRR8928745", "SRX5709777", "SRS4648948", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 2", "GSM3730543", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 2", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730543", "GSM3730543: triple 2; Danio rerio; RNA Seq", "GSM3730543", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730543", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-2_S9_L001_R1_001.fastq.gz JT-Triple-2_S9_L001_R2_001.fastq.gz", "fastq fastq", 1864011583.0, 12345651.0, "GSM3730543 r1", "0:75.54 1:75.45", "A:480016310;C:450107080;G:445391016;T:488175881;N:321296", 75, 75, null, null, 480016310, 450107080, 445391016, 488175881, 321296, "SRX5709777", "SRS4648948", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94224, 0.94547, 0.08093, 0.08029, 0.67665, 0.67929, 0.49884, 0.49994, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52104, "SRR8928746", "SRX5709777", "SRS4648948", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 2", "GSM3730543", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 2", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730543", "GSM3730543: triple 2; Danio rerio; RNA Seq", "GSM3730543", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730543", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-2_S9_L002_R1_001.fastq.gz JT-Triple-2_S9_L002_R2_001.fastq.gz", "fastq fastq", 1858876690.0, 12311375.0, "GSM3730543 r2", "0:75.54 1:75.45", "A:478783792;C:448814298;G:444208711;T:486743915;N:325974", 75, 75, null, null, 478783792, 448814298, 444208711, 486743915, 325974, "SRX5709777", "SRS4648948", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94193, 0.94595, 0.08124, 0.08038, 0.67886, 0.68112, 0.49879, 0.50151, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52105, "SRR8928747", "SRX5709777", "SRS4648948", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 2", "GSM3730543", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 2", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730543", "GSM3730543: triple 2; Danio rerio; RNA Seq", "GSM3730543", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730543", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-2_S9_L003_R1_001.fastq.gz JT-Triple-2_S9_L003_R2_001.fastq.gz", "fastq fastq", 1889532315.0, 12514300.0, "GSM3730543 r3", "0:75.53 1:75.46", "A:486411817;C:456522904;G:451804723;T:494664928;N:127943", 75, 75, null, null, 486411817, 456522904, 451804723, 494664928, 127943, "SRX5709777", "SRS4648948", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94303, 0.9467, 0.08177, 0.08078, 0.67706, 0.67945, 0.49043, 0.49897, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52106, "SRR8928748", "SRX5709777", "SRS4648948", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 2", "GSM3730543", null, "source name:Triple Superficial Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "triple 2", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma  triple superficial", "GSM3730543", "GSM3730543: triple 2; Danio rerio; RNA Seq", "GSM3730543", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730543", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-2_S9_L004_R1_001.fastq.gz JT-Triple-2_S9_L004_R2_001.fastq.gz", "fastq fastq", 1868007570.0, 12371409.0, "GSM3730543 r4", "0:75.54 1:75.46", "A:480952781;C:451206311;G:446738085;T:489011386;N:99007", 75, 75, null, null, 480952781, 451206311, 446738085, 489011386, 99007, "SRX5709777", "SRS4648948", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94249, 0.94546, 0.08154, 0.0808, 0.67923, 0.68152, 0.49927, 0.50129, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52107, "SRR8928741", "SRX5709776", "SRS4648947", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 1", "GSM3730542", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "triple 1", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "GSM3730542", "GSM3730542: triple 1; Danio rerio; RNA Seq", "GSM3730542", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730542", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-1_S4_L001_R2_001.fastq.gz JT-Triple-1_S4_L001_R1_001.fastq.gz", "fastq fastq", 1785362696.0, 11825211.0, "GSM3730542 r1", "0:75.53 1:75.45", "A:449916495;C:438573292;G:441487672;T:455091018;N:294219", 75, 75, null, null, 449916495, 438573292, 441487672, 455091018, 294219, "SRX5709776", "SRS4648947", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94975, 0.95259, 0.09314, 0.0919, 0.69524, 0.6984, 0.49235, 0.50671, 74, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52108, "SRR8928742", "SRX5709776", "SRS4648947", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 1", "GSM3730542", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "triple 1", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "GSM3730542", "GSM3730542: triple 1; Danio rerio; RNA Seq", "GSM3730542", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730542", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-1_S4_L002_R1_001.fastq.gz JT-Triple-1_S4_L002_R2_001.fastq.gz", "fastq fastq", 1779424378.0, 11785743.0, "GSM3730542 r2", "0:75.53 1:75.45", "A:448641795;C:437083219;G:439852814;T:453551229;N:295321", 75, 75, null, null, 448641795, 437083219, 439852814, 453551229, 295321, "SRX5709776", "SRS4648947", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94931, 0.95223, 0.09263, 0.09097, 0.69733, 0.70051, 0.50261, 0.50255, 76, 73, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52109, "SRR8928743", "SRX5709776", "SRS4648947", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 1", "GSM3730542", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "triple 1", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "GSM3730542", "GSM3730542: triple 1; Danio rerio; RNA Seq", "GSM3730542", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730542", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-1_S4_L003_R1_001.fastq.gz JT-Triple-1_S4_L003_R2_001.fastq.gz", "fastq fastq", 1813179265.0, 12008911.0, "GSM3730542 r3", "0:75.53 1:75.46", "A:456802061;C:445761479;G:448556501;T:461961561;N:97663", 75, 75, null, null, 456802061, 445761479, 448556501, 461961561, 97663, "SRX5709776", "SRS4648947", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94938, 0.95273, 0.09278, 0.09173, 0.69585, 0.69818, 0.49175, 0.50574, 76, 73, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52110, "SRR8928744", "SRX5709776", "SRS4648947", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "triple 1", "GSM3730542", null, "source name:Triple Nodular Melanoma|genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "triple 1", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Triple Nodular Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfa:BRAFV600E;mitfavc7;p53M214K|tissue:Primary melanoma   triple nodular pigmented", "GSM3730542", "GSM3730542: triple 1; Danio rerio; RNA Seq", "GSM3730542", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730542", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-Triple-1_S4_L004_R1_001.fastq.gz JT-Triple-1_S4_L004_R2_001.fastq.gz", "fastq fastq", 1795763933.0, 11893506.0, "GSM3730542 r4", "0:75.53 1:75.46", "A:452564216;C:441332366;G:444124339;T:457661786;N:81226", 75, 75, null, null, 452564216, 441332366, 444124339, 457661786, 81226, "SRX5709776", "SRS4648947", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.94952, 0.9536, 0.09141, 0.09034, 0.69593, 0.69869, 0.49402, 0.49874, 76, 74, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52111, "SRR8928737", "SRX5709775", "SRS4648946", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 5", "GSM3730541", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 5", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730541", "GSM3730541: p53 5; Danio rerio; RNA Seq", "GSM3730541", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730541", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-5_S8_L001_R1_001.fastq.gz JT-p53-5_S8_L001_R2_001.fastq.gz", "fastq fastq", 1639929033.0, 10861431.0, "GSM3730541 r1", "0:75.53 1:75.46", "A:427510821;C:390060172;G:387266066;T:434839976;N:251998", 75, 75, null, null, 427510821, 390060172, 387266066, 434839976, 251998, "SRX5709775", "SRS4648946", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95193, 0.95579, 0.0778, 0.07695, 0.70141, 0.70299, 0.47152, 0.48208, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52112, "SRR8928738", "SRX5709775", "SRS4648946", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 5", "GSM3730541", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 5", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730541", "GSM3730541: p53 5; Danio rerio; RNA Seq", "GSM3730541", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730541", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-5_S8_L002_R1_001.fastq.gz JT-p53-5_S8_L002_R2_001.fastq.gz", "fastq fastq", 1634698143.0, 10826650.0, "GSM3730541 r2", "0:75.53 1:75.46", "A:426281730;C:388867426;G:385916774;T:433380433;N:251780", 75, 75, null, null, 426281730, 388867426, 385916774, 433380433, 251780, "SRX5709775", "SRS4648946", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95164, 0.95607, 0.07752, 0.07645, 0.70049, 0.70408, 0.46719, 0.48148, 75, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52113, "SRR8928739", "SRX5709775", "SRS4648946", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 5", "GSM3730541", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 5", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730541", "GSM3730541: p53 5; Danio rerio; RNA Seq", "GSM3730541", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730541", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-5_S8_L003_R1_001.fastq.gz JT-p53-5_S8_L003_R2_001.fastq.gz", "fastq fastq", 1657107445.0, 10974822.0, "GSM3730541 r3", "0:75.53 1:75.46", "A:431960689;C:394310152;G:391478941;T:439279258;N:78405", 75, 75, null, null, 431960689, 394310152, 391478941, 439279258, 78405, "SRX5709775", "SRS4648946", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95248, 0.95631, 0.07829, 0.07687, 0.70272, 0.70589, 0.47406, 0.48188, 74, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52114, "SRR8928740", "SRX5709775", "SRS4648946", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 5", "GSM3730541", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 5", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730541", "GSM3730541: p53 5; Danio rerio; RNA Seq", "GSM3730541", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730541", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-5_S8_L004_R1_001.fastq.gz JT-p53-5_S8_L004_R2_001.fastq.gz", "fastq fastq", 1638166307.0, 10849268.0, "GSM3730541 r4", "0:75.53 1:75.46", "A:427117402;C:389754846;G:386927070;T:434309808;N:57181", 75, 75, null, null, 427117402, 389754846, 386927070, 434309808, 57181, "SRX5709775", "SRS4648946", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95231, 0.95628, 0.07928, 0.07811, 0.70191, 0.70471, 0.46985, 0.47901, 76, 73, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52115, "SRR8928733", "SRX5709774", "SRS4648945", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 4", "GSM3730540", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 4", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730540", "GSM3730540: p53 4; Danio rerio; RNA Seq", "GSM3730540", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730540", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-4_S5_L001_R1_001.fastq.gz JT-p53-4_S5_L001_R2_001.fastq.gz", "fastq fastq", 1633988336.0, 10821770.0, "GSM3730540 r1", "0:75.53 1:75.46", "A:415616894;C:398033273;G:400102186;T:419985440;N:250543", 75, 75, null, null, 415616894, 398033273, 400102186, 419985440, 250543, "SRX5709774", "SRS4648945", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.96011, 0.96191, 0.06669, 0.06564, 0.69631, 0.69881, 0.49786, 0.49859, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52116, "SRR8928734", "SRX5709774", "SRS4648945", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 4", "GSM3730540", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 4", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730540", "GSM3730540: p53 4; Danio rerio; RNA Seq", "GSM3730540", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730540", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-4_S5_L002_R1_001.fastq.gz JT-p53-4_S5_L002_R2_001.fastq.gz", "fastq fastq", 1635464778.0, 10831458.0, "GSM3730540 r2", "0:75.53 1:75.46", "A:416154277;C:398415719;G:400427870;T:420210788;N:256124", 75, 75, null, null, 416154277, 398415719, 400427870, 420210788, 256124, "SRX5709774", "SRS4648945", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.96015, 0.96227, 0.06698, 0.06593, 0.69893, 0.70256, 0.49732, 0.49463, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52117, "SRR8928735", "SRX5709774", "SRS4648945", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 4", "GSM3730540", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 4", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730540", "GSM3730540: p53 4; Danio rerio; RNA Seq", "GSM3730540", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730540", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-4_S5_L003_R1_001.fastq.gz JT-p53-4_S5_L003_R2_001.fastq.gz", "fastq fastq", 1658659674.0, 10984697.0, "GSM3730540 r3", "0:75.53 1:75.47", "A:421738912;C:404354401;G:406372811;T:426121561;N:71989", 75, 75, null, null, 421738912, 404354401, 406372811, 426121561, 71989, "SRX5709774", "SRS4648945", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.96, 0.96191, 0.067, 0.06626, 0.69794, 0.69962, 0.49987, 0.49916, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52118, "SRR8928736", "SRX5709774", "SRS4648945", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 4", "GSM3730540", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 4", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730540", "GSM3730540: p53 4; Danio rerio; RNA Seq", "GSM3730540", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730540", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-4_S5_L004_R1_001.fastq.gz JT-p53-4_S5_L004_R2_001.fastq.gz", "fastq fastq", 1647310939.0, 10909440.0, "GSM3730540 r4", "0:75.53 1:75.47", "A:419056685;C:401442501;G:403519144;T:423238385;N:54224", 75, 75, null, null, 419056685, 401442501, 403519144, 423238385, 54224, "SRX5709774", "SRS4648945", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95995, 0.96241, 0.06673, 0.06659, 0.69645, 0.70059, 0.49798, 0.50057, 75, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52119, "SRR8928729", "SRX5709773", "SRS4648944", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 3", "GSM3730539", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 3", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730539", "GSM3730539: p53 3; Danio rerio; RNA Seq", "GSM3730539", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730539", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-3_S6_L001_R1_001.fastq.gz JT-p53-3_S6_L001_R2_001.fastq.gz", "fastq fastq", 1640641941.0, 10876125.0, "GSM3730539 r1", "0:75.47 1:75.38", "A:419188394;C:399271767;G:396351394;T:425557583;N:272803", 75, 75, null, null, 419188394, 399271767, 396351394, 425557583, 272803, "SRX5709773", "SRS4648944", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95572, 0.95862, 0.06705, 0.06646, 0.71177, 0.7133, 0.49405, 0.49349, 75, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52120, "SRR8928730", "SRX5709773", "SRS4648944", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 3", "GSM3730539", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 3", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730539", "GSM3730539: p53 3; Danio rerio; RNA Seq", "GSM3730539", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730539", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-3_S6_L002_R1_001.fastq.gz JT-p53-3_S6_L002_R2_001.fastq.gz", "fastq fastq", 1632379688.0, 10821144.0, "GSM3730539 r2", "0:75.47 1:75.38", "A:417284017;C:397156689;G:394268475;T:423405879;N:264628", 75, 75, null, null, 417284017, 397156689, 394268475, 423405879, 264628, "SRX5709773", "SRS4648944", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95644, 0.95899, 0.06725, 0.06672, 0.71143, 0.71388, 0.48338, 0.49296, 74, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52121, "SRR8928731", "SRX5709773", "SRS4648944", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 3", "GSM3730539", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 3", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730539", "GSM3730539: p53 3; Danio rerio; RNA Seq", "GSM3730539", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730539", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-3_S6_L003_R1_001.fastq.gz JT-p53-3_S6_L003_R2_001.fastq.gz", "fastq fastq", 1676573342.0, 11113904.0, "GSM3730539 r3", "0:75.47 1:75.39", "A:428207296;C:408217692;G:405266465;T:434795110;N:86779", 75, 75, null, null, 428207296, 408217692, 405266465, 434795110, 86779, "SRX5709773", "SRS4648944", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95648, 0.95954, 0.06711, 0.06666, 0.71161, 0.7149, 0.49407, 0.49269, 75, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52122, "SRR8928732", "SRX5709773", "SRS4648944", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 3", "GSM3730539", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 3", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730539", "GSM3730539: p53 3; Danio rerio; RNA Seq", "GSM3730539", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730539", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-3_S6_L004_R1_001.fastq.gz JT-p53-3_S6_L004_R2_001.fastq.gz", "fastq fastq", 1657381131.0, 10986573.0, "GSM3730539 r4", "0:75.47 1:75.39", "A:423383570;C:403413528;G:400625092;T:429887191;N:71750", 75, 75, null, null, 423383570, 403413528, 400625092, 429887191, 71750, "SRX5709773", "SRS4648944", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95621, 0.95936, 0.06778, 0.06668, 0.71376, 0.71595, 0.48845, 0.48009, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52123, "SRR8928725", "SRX5709772", "SRS4648943", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 2", "GSM3730538", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 2", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730538", "GSM3730538: p53 2; Danio rerio; RNA Seq", "GSM3730538", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730538", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-2_S2_L001_R2_001.fastq.gz JT-p53-2_S2_L001_R1_001.fastq.gz", "fastq fastq", 1845065449.0, 12220322.0, "GSM3730538 r1", "0:75.53 1:75.45", "A:472622029;C:447974057;G:442675936;T:481473990;N:319437", 75, 75, null, null, 472622029, 447974057, 442675936, 481473990, 319437, "SRX5709772", "SRS4648943", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95839, 0.96198, 0.06839, 0.06778, 0.72127, 0.72358, 0.47986, 0.48988, 74, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52124, "SRR8928726", "SRX5709772", "SRS4648943", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 2", "GSM3730538", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 2", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730538", "GSM3730538: p53 2; Danio rerio; RNA Seq", "GSM3730538", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730538", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-2_S2_L002_R2_001.fastq.gz JT-p53-2_S2_L002_R1_001.fastq.gz", "fastq fastq", 1847890322.0, 12238779.0, "GSM3730538 r2", "0:75.53 1:75.45", "A:473521122;C:448617797;G:443249234;T:482185853;N:316316", 75, 75, null, null, 473521122, 448617797, 443249234, 482185853, 316316, "SRX5709772", "SRS4648943", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95839, 0.96132, 0.0675, 0.06668, 0.72247, 0.72535, 0.48704, 0.49144, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52125, "SRR8928727", "SRX5709772", "SRS4648943", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 2", "GSM3730538", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 2", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730538", "GSM3730538: p53 2; Danio rerio; RNA Seq", "GSM3730538", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730538", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-2_S2_L003_R1_001.fastq.gz JT-p53-2_S2_L003_R2_001.fastq.gz", "fastq fastq", 1872259004.0, 12399849.0, "GSM3730538 r3", "0:75.53 1:75.46", "A:479441144;C:454810218;G:449443146;T:488450131;N:114365", 75, 75, null, null, 479441144, 454810218, 449443146, 488450131, 114365, "SRX5709772", "SRS4648943", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95821, 0.96216, 0.06819, 0.06692, 0.72159, 0.72395, 0.48336, 0.49107, 74, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52126, "SRR8928728", "SRX5709772", "SRS4648943", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 2", "GSM3730538", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 2", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730538", "GSM3730538: p53 2; Danio rerio; RNA Seq", "GSM3730538", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730538", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-2_S2_L004_R1_001.fastq.gz JT-p53-2_S2_L004_R2_001.fastq.gz", "fastq fastq", 1860401397.0, 12321184.0, "GSM3730538 r4", "0:75.54 1:75.46", "A:476527164;C:451818790;G:446646079;T:485317129;N:92235", 75, 75, null, null, 476527164, 451818790, 446646079, 485317129, 92235, "SRX5709772", "SRS4648943", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95862, 0.96179, 0.06751, 0.06605, 0.72151, 0.72354, 0.47467, 0.49084, 76, 75, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52127, "SRR8928721", "SRX5709771", "SRS4648942", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 1", "GSM3730537", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 1", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730537", "GSM3730537: p53 1; Danio rerio; RNA Seq", "GSM3730537", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730537", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-1_S7_L001_R1_001.fastq.gz JT-p53-1_S7_L001_R2_001.fastq.gz", "fastq fastq", 1907493966.0, 12633219.0, "GSM3730537 r1", "0:75.54 1:75.45", "A:487074677;C:464064819;G:462367218;T:493654840;N:332412", 75, 75, null, null, 487074677, 464064819, 462367218, 493654840, 332412, "SRX5709771", "SRS4648942", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95044, 0.95306, 0.05894, 0.05792, 0.70556, 0.70883, 0.47742, 0.47607, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52128, "SRR8928722", "SRX5709771", "SRS4648942", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 1", "GSM3730537", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 1", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730537", "GSM3730537: p53 1; Danio rerio; RNA Seq", "GSM3730537", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730537", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-1_S7_L002_R1_001.fastq.gz JT-p53-1_S7_L002_R2_001.fastq.gz", "fastq fastq", 1898531924.0, 12573618.0, "GSM3730537 r2", "0:75.54 1:75.45", "A:485070075;C:461892345;G:460052118;T:491190570;N:326816", 75, 75, null, null, 485070075, 461892345, 460052118, 491190570, 326816, "SRX5709771", "SRS4648942", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95066, 0.95388, 0.05864, 0.05811, 0.7037, 0.70713, 0.47169, 0.47733, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52129, "SRR8928723", "SRX5709771", "SRS4648942", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 1", "GSM3730537", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 1", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730537", "GSM3730537: p53 1; Danio rerio; RNA Seq", "GSM3730537", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730537", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-1_S7_L003_R1_001.fastq.gz JT-p53-1_S7_L003_R2_001.fastq.gz", "fastq fastq", 1924911032.0, 12747987.0, "GSM3730537 r3", "0:75.54 1:75.46", "A:491307844;C:468573966;G:466898555;T:498008528;N:122139", 75, 75, null, null, 491307844, 468573966, 466898555, 498008528, 122139, "SRX5709771", "SRS4648942", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95001, 0.95288, 0.05866, 0.05813, 0.70528, 0.70735, 0.46904, 0.4757, 76, 76, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [52130, "SRR8928724", "SRX5709771", "SRS4648942", "SRP193005", "PRJNA533623", "MITF low zebrafish melanomas reveal cells with no MITF activity at the site of residual disease", "GSE130037", "Transcriptome Analysis", "The MITF low melanoma transcriptional signature is predictive of poor outcome for patients but little is known about its biological signature. We used genetic models of zebrafish with low expression of mitfa MITF low to study this biological subtype. We performed whole bulk RNA seq to classify zebrafish MITF low melanoma that cluster mainly by their directionality of growth and assess their resemblance to patients' MITF low subgroups. Furthermore  using genetic inhibition of MITF activity we discover minimal residual disease at the site of regression and using single cell and low input RNA seq we characterise these MITF independent cells and show that they pre exist in the primary tumour. Overall design: We performed bulk RNAseq experiment of zebrafish primary melanomas to compare different phenotypes based on directionality of growth or original mutations. Further we performed single cell RNAseq of primary and regressed melanoma.", null, "pubmed:31582381", null, "p53 1", "GSM3730537", null, "source name:Double Superficial Melanoma|genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "p53 1", "Sequence quality was checked using FastQC version 0.11.3  Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters  Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 Illumina  software used for basecalling. Sequence quality was checked using FastQC version 0.11.3 Reads were aligned to the zebrafish genome GRCz11 using STAR STAR 2.5.1b with the default parameters or using Salmon in the alignment based mode The quality of the resulting alignment to the transcriptome Ensembl annotation version GRCz11 has been checked using RNASeqQC v1.1.8.1 Raw counts of reads covering the transcriptome Ensembl annotation version GRCz11 was obtained using htseq count 0.6.1 with the \u201c s reverse\u201d option. Genome build: Zebrafish GRCz11 Supplementary files format and content: tab delimited filed of raw counts at gene level for each sample", "Double Superficial Melanoma", null, "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", null, "genotype:mitfavc7;p53M214K|tissue:Primary melanoma   double", "GSM3730537", "GSM3730537: p53 1; Danio rerio; RNA Seq", "GSM3730537", null, "1", "Whole tumour was dissected  dissociated and RNA extracted using Trizol with column cleanup polyA selection cDNA   TruSeq or Nextera XT RNA Seq  Paired end reads", "GEO Accession:GSM3730537", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "NextSeq 500", null, "SRP193005", null, null, "JT-p53-1_S7_L004_R1_001.fastq.gz JT-p53-1_S7_L004_R2_001.fastq.gz", "fastq fastq", 1902837505.0, 12601681.0, "GSM3730537 r4", "0:75.54 1:75.46", "A:485804655;C:463091945;G:461519676;T:492322793;N:98436", 75, 75, null, null, 485804655, 463091945, 461519676, 492322793, 98436, "SRX5709771", "SRS4648942", "SRA876955", "GEO", "Prof. Patton lab, MRC Institute of Genetics and Molecular Medicine, MRC Human Genetics Unit & Cancer Research UK EC", 2, 0.95035, 0.95289, 0.05932, 0.05837, 0.70636, 0.70893, 0.47664, 0.47848, 76, 74, "B", "B", "biological fallback assumption", "illumina", "nextseq", "unknown", "poly_a", "nextera", "bulk", "bulk", "bulk", null, "United Kingdom", "2019-04-18", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67620, "SRR17219949", "SRX13399948", "SRS11303068", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp skin tumor 4", "GSM5732243", null, "source name:Qp skin tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "Qp skin tumor 4", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp skin tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "GSM5732243", "GSM5732243: Qp skin tumor 4; Danio rerio; RNA Seq", "GSM5732243", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732243", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101283.fastq.gz", "fastq", 122886760.0, 3072169.0, "GSM5732243 r1", "0:40", "A:41729821;C:25705614;G:27345231;T:28036062;N:70032", 40, null, null, null, 41729821, 25705614, 27345231, 28036062, 70032, "SRX13399948", "SRS11303068", "SRA1343073", "GEO", "Koch Institute", 1, 0.82784, null, 0.32837, null, 0.87756, null, 0.66545, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67621, "SRR17219947", "SRX13399947", "SRS11303067", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp skin tumor 3", "GSM5732242", null, "source name:Qp skin tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "Qp skin tumor 3", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp skin tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "GSM5732242", "GSM5732242: Qp skin tumor 3; Danio rerio; RNA Seq", "GSM5732242", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732242", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101282.fastq.gz", "fastq", 283770840.0, 7094271.0, "GSM5732242 r1", "0:40", "A:98647149;C:57235772;G:60084594;T:67639169;N:164156", 40, null, null, null, 98647149, 57235772, 60084594, 67639169, 164156, "SRX13399947", "SRS11303067", "SRA1343073", "GEO", "Koch Institute", 1, 0.82456, null, 0.20326, null, 0.87194, null, 0.65575, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67622, "SRR17219945", "SRX13399946", "SRS11303065", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp skin tumor 2", "GSM5732241", null, "source name:Qp skin tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "Qp skin tumor 2", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp skin tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "GSM5732241", "GSM5732241: Qp skin tumor 2; Danio rerio; RNA Seq", "GSM5732241", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732241", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101281.fastq.gz", "fastq", 187440520.0, 4686013.0, "GSM5732241 r1", "0:40", "A:64031749;C:38508754;G:39411330;T:45381562;N:107125", 40, null, null, null, 64031749, 38508754, 39411330, 45381562, 107125, "SRX13399946", "SRS11303065", "SRA1343073", "GEO", "Koch Institute", 1, 0.8171, null, 0.15628, null, 0.85593, null, 0.5865, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"], [67623, "SRR17219943", "SRX13399945", "SRS11303066", "SRP350562", "PRJNA788496", "MITF deficiency accelerates GNAQ driven uveal melanoma", "GSE190802", "Transcriptome Analysis", "Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLC\u00df ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLC\u00df signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;", null, null, null, "Qp skin tumor 1", "GSM5732240", null, "source name:Qp skin tumor|genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "Qp skin tumor 1", "NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3\u2019 digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset", "Qp skin tumor", "Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen", "Trizol extraction Invitrogen 3\u2019 Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3\u2019DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5\u2019  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer\u2019s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5\u2019 iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3\u2019  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90\u2019 and inactivation at 80C for 10\u2019. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5\u2019 /5Biosg/ACACTCTTTCCCTACACGACGC 3\u2019 directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  5\u2019 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3\u2019  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", null, "genetic background:AB/T\u00fcbingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor", "GSM5732240", "GSM5732240: Qp skin tumor 1; Danio rerio; RNA Seq", "GSM5732240", null, "1", "Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25\u03bcM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR", "GEO Accession:GSM5732240", "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP350562", null, null, "D16-101280.fastq.gz", "fastq", 118902800.0, 2972570.0, "GSM5732240 r1", "0:40", "A:41431989;C:24163332;G:24495495;T:28744442;N:67542", 40, null, null, null, 41431989, 24163332, 24495495, 28744442, 67542, "SRX13399945", "SRS11303066", "SRA1343073", "GEO", "Koch Institute", 1, 0.82006, null, 0.15984, null, 0.8604, null, 0.56292, null, 40, null, "B", null, "usable mapping rate", "illumina", "nextseq", "3prime", "cdna_unspecified", "nextera", "bulk", "bulk", "bulk", null, "Unknown", "2021-12-13", "Undetermined", "Undetermined", "Cancer or Tumor", "Cancer or Tumor"]], "truncated": false, "filtered_table_rows_count": 145, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"technology\" = :p0 and \"tissue_curation\" = :p1 order by rowid limit 101", "params": {"p0": "bulk", "p1": "Cancer or Tumor"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 145, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor&experiment.library_strategy=RNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 145, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor", "results": [{"value": "cDNA", "label": "cDNA", "count": 145, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor&experiment.library_selection=cDNA", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor", "results": [{"value": "PAIRED", "label": "PAIRED", "count": 96, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor&experiment.library_layout=PAIRED", "selected": false}, {"value": "SINGLE", "label": "SINGLE", "count": 49, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor&experiment.library_layout=SINGLE", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 145, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 142, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor&devstage_curation_coarse=Undetermined", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor&devstage_curation_coarse=Multi-stage", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor", "results": [{"value": "Undetermined", "label": "Undetermined", "count": 142, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor&devstage_curation=Undetermined", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor&devstage_curation=Multi-stage", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor", "results": [{"value": "Cancer or Tumor", "label": "Cancer or Tumor", "count": 145, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor&tissue_curation_coarse=Cancer+or+Tumor", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor", "results": [{"value": "Cancer or Tumor", "label": "Cancer or Tumor", "count": 145, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor", "results": [{"value": "bulk", "label": "bulk", "count": 145, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?tissue_curation=Cancer+or+Tumor", "selected": true}], "truncated": false}}, "suggested_facets": [], "next": "67623", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=bulk&tissue_curation=Cancer+or+Tumor&_next=67623", "private": false, "allow_execute_sql": true, "query_ms": 99.92010198766366}