{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.platform = \"ILLUMINA\", technology = \"smartseq\" and tissue_curation = \"Spinal Cord\"", "rows": [[24927, "SRR25557778", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L001_R1_001.fastq.gz", "fastq", 420092501.0, 5668059.0, "GSM7688794 r1", "0:74.12", "A:113006440;C:96725832;G:99320773;T:110915967;N:123489", 74, null, null, null, 113006440, 96725832, 99320773, 110915967, 123489, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94757, null, 0.06229, null, 0.72364, null, 0.46676, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24928, "SRR25557779", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L002_R1_001.fastq.gz", "fastq", 421869780.0, 5690053.0, "GSM7688794 r2", "0:74.14", "A:113530489;C:97144227;G:99697959;T:111388539;N:108566", 74, null, null, null, 113530489, 97144227, 99697959, 111388539, 108566, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94921, null, 0.06226, null, 0.72462, null, 0.4738, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24929, "SRR25557780", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L003_R1_001.fastq.gz", "fastq", 425064659.0, 5734041.0, "GSM7688794 r3", "0:74.13", "A:114342253;C:97873100;G:100532599;T:112196433;N:120274", 74, null, null, null, 114342253, 97873100, 100532599, 112196433, 120274, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94886, null, 0.06112, null, 0.72425, null, 0.47055, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24930, "SRR25557781", "SRX21286665", "SRS18536778", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant XI", "GSM7688794", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688794", "GSM7688794: Morphant XI; Danio rerio; RNA Seq", "GSM7688794 r1", "GSM7688794", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-XI_S7_L004_R1_001.fastq.gz", "fastq", 416990548.0, 5624902.0, "GSM7688794 r4", "0:74.13", "A:112153356;C:96009158;G:98613145;T:110097476;N:117413", 74, null, null, null, 112153356, 96009158, 98613145, 110097476, 117413, "SRX21286665", "SRS18536778", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94869, null, 0.06229, null, 0.72506, null, 0.47222, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24931, "SRR25557782", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L001_R1_001.fastq.gz", "fastq", 434485284.0, 5881416.0, "GSM7688793 r1", "0:73.87", "A:116640351;C:100176557;G:102659919;T:114799536;N:208921", 73, null, null, null, 116640351, 100176557, 102659919, 114799536, 208921, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94533, null, 0.07176, null, 0.72464, null, 0.47632, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24932, "SRR25557783", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L002_R1_001.fastq.gz", "fastq", 435203869.0, 5886556.0, "GSM7688793 r2", "0:73.93", "A:116869356;C:100363580;G:102830644;T:114973504;N:166785", 73, null, null, null, 116869356, 100363580, 102830644, 114973504, 166785, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94542, null, 0.07203, null, 0.72421, null, 0.47733, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24933, "SRR25557784", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L003_R1_001.fastq.gz", "fastq", 439897269.0, 5951878.0, "GSM7688793 r3", "0:73.91", "A:118101648;C:101426657;G:103990006;T:116184480;N:194478", 73, null, null, null, 118101648, 101426657, 103990006, 116184480, 194478, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94486, null, 0.07224, null, 0.72448, null, 0.47915, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24934, "SRR25557785", "SRX21286664", "SRS18536777", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant X", "GSM7688793", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688793", "GSM7688793: Morphant X; Danio rerio; RNA Seq", "GSM7688793 r1", "GSM7688793", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-X_S6_L004_R1_001.fastq.gz", "fastq", 431385256.0, 5836029.0, "GSM7688793 r4", "0:73.92", "A:115804970;C:99459059;G:101962932;T:113975935;N:182360", 73, null, null, null, 115804970, 99459059, 101962932, 113975935, 182360, "SRX21286664", "SRS18536777", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94432, null, 0.07229, null, 0.7261, null, 0.47463, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24935, "SRR25557786", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L001_R1_001.fastq.gz", "fastq", 513309395.0, 6929648.0, "GSM7688792 r1", "0:74.07", "A:137428462;C:118688804;G:122019962;T:134991729;N:180438", 74, null, null, null, 137428462, 118688804, 122019962, 134991729, 180438, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94188, null, 0.07029, null, 0.73772, null, 0.47692, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24936, "SRR25557787", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L002_R1_001.fastq.gz", "fastq", 517356735.0, 6982196.0, "GSM7688792 r2", "0:74.10", "A:138524037;C:119650852;G:122965491;T:136056171;N:160184", 74, null, null, null, 138524037, 119650852, 122965491, 136056171, 160184, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94281, null, 0.06967, null, 0.73963, null, 0.48142, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24937, "SRR25557788", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L003_R1_001.fastq.gz", "fastq", 519422328.0, 7010631.0, "GSM7688792 r3", "0:74.09", "A:139040684;C:120128748;G:123529198;T:136551898;N:171800", 74, null, null, null, 139040684, 120128748, 123529198, 136551898, 171800, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94297, null, 0.06942, null, 0.73726, null, 0.47499, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24938, "SRR25557789", "SRX21286663", "SRS18536776", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant IX", "GSM7688792", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688792", "GSM7688792: Morphant IX; Danio rerio; RNA Seq", "GSM7688792 r1", "GSM7688792", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-IX_S16_L004_R1_001.fastq.gz", "fastq", 511640294.0, 6905748.0, "GSM7688792 r4", "0:74.09", "A:136914638;C:118302866;G:121704665;T:134543505;N:174620", 74, null, null, null, 136914638, 118302866, 121704665, 134543505, 174620, "SRX21286663", "SRS18536776", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94176, null, 0.07029, null, 0.73868, null, 0.47987, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24939, "SRR25557790", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L001_R1_001.fastq.gz", "fastq", 429446821.0, 5803178.0, "GSM7688791 r1", "0:74.00", "A:114793535;C:99506379;G:102226914;T:112748761;N:171232", 74, null, null, null, 114793535, 99506379, 102226914, 112748761, 171232, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94175, null, 0.06669, null, 0.73673, null, 0.48179, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24940, "SRR25557791", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L002_R1_001.fastq.gz", "fastq", 434629893.0, 5870828.0, "GSM7688791 r2", "0:74.03", "A:116216940;C:100703527;G:103463365;T:114092681;N:153380", 74, null, null, null, 116216940, 100703527, 103463365, 114092681, 153380, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94143, null, 0.0676, null, 0.73791, null, 0.48091, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24941, "SRR25557792", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L003_R1_001.fastq.gz", "fastq", 435879881.0, 5888685.0, "GSM7688791 r3", "0:74.02", "A:116548094;C:100971153;G:103794902;T:114400770;N:164962", 74, null, null, null, 116548094, 100971153, 103794902, 114400770, 164962, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94195, null, 0.06686, null, 0.73785, null, 0.48044, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24942, "SRR25557793", "SRX21286662", "SRS18536775", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VIII", "GSM7688791", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688791", "GSM7688791: Morphant VIII; Danio rerio; RNA Seq", "GSM7688791 r1", "GSM7688791", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VIII_S14_L004_R1_001.fastq.gz", "fastq", 429478475.0, 5801978.0, "GSM7688791 r4", "0:74.02", "A:114799280;C:99474677;G:102302775;T:112737475;N:164268", 74, null, null, null, 114799280, 99474677, 102302775, 112737475, 164268, "SRX21286662", "SRS18536775", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94118, null, 0.06706, null, 0.73892, null, 0.47732, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24943, "SRR25557794", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L001_R1_001.fastq.gz", "fastq", 459545188.0, 6215897.0, "GSM7688790 r1", "0:73.93", "A:121926568;C:107379723;G:110263606;T:119766429;N:208862", 73, null, null, null, 121926568, 107379723, 110263606, 119766429, 208862, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94273, null, 0.06072, null, 0.74582, null, 0.47499, null, 73, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24944, "SRR25557795", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L002_R1_001.fastq.gz", "fastq", 463143624.0, 6261406.0, "GSM7688790 r2", "0:73.97", "A:122917997;C:108229793;G:111099867;T:120713978;N:181989", 73, null, null, null, 122917997, 108229793, 111099867, 120713978, 181989, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94387, null, 0.06093, null, 0.74341, null, 0.47351, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24945, "SRR25557796", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L003_R1_001.fastq.gz", "fastq", 465959664.0, 6300929.0, "GSM7688790 r3", "0:73.95", "A:123689364;C:108847593;G:111847868;T:121377463;N:197376", 73, null, null, null, 123689364, 108847593, 111847868, 121377463, 197376, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94322, null, 0.06219, null, 0.74357, null, 0.47977, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24946, "SRR25557797", "SRX21286661", "SRS18536774", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Morphant VII", "GSM7688790", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing", "Morphant VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant", "GSM7688790", "GSM7688790: Morphant VII; Danio rerio; RNA Seq", "GSM7688790 r1", "GSM7688790", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Morphant-VII_S15_L004_R1_001.fastq.gz", "fastq", 459075430.0, 6207363.0, "GSM7688790 r4", "0:73.96", "A:121797426;C:107221116;G:110209684;T:119657308;N:189896", 73, null, null, null, 121797426, 107221116, 110209684, 119657308, 189896, "SRX21286661", "SRS18536774", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94313, null, 0.06211, null, 0.74343, null, 0.47801, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24947, "SRR25557798", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L001_R1_001.fastq.gz", "fastq", 439719566.0, 5947052.0, "GSM7688787 r1", "0:73.94", "A:117482073;C:102083665;G:104685444;T:115272860;N:195524", 73, null, null, null, 117482073, 102083665, 104685444, 115272860, 195524, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94829, null, 0.06278, null, 0.72525, null, 0.46494, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24948, "SRR25557799", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L002_R1_001.fastq.gz", "fastq", 438533503.0, 5927990.0, "GSM7688787 r2", "0:73.98", "A:117199594;C:101810881;G:104402169;T:114946611;N:174248", 73, null, null, null, 117199594, 101810881, 104402169, 114946611, 174248, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94887, null, 0.06387, null, 0.72827, null, 0.46616, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24949, "SRR25557800", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L003_R1_001.fastq.gz", "fastq", 443995554.0, 6003540.0, "GSM7688787 r3", "0:73.96", "A:118663936;C:103031716;G:105723574;T:116387834;N:188494", 73, null, null, null, 118663936, 103031716, 105723574, 116387834, 188494, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94788, null, 0.06232, null, 0.72693, null, 0.46653, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24950, "SRR25557801", "SRX21286660", "SRS18536773", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control XI", "GSM7688787", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control XI", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688787", "GSM7688787: Control XI; Danio rerio; RNA Seq", "GSM7688787 r1", "GSM7688787", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-XI_S2_L004_R1_001.fastq.gz", "fastq", 435088869.0, 5882642.0, "GSM7688787 r4", "0:73.96", "A:116261447;C:100986653;G:103615584;T:114042354;N:182831", 73, null, null, null, 116261447, 100986653, 103615584, 114042354, 182831, "SRX21286660", "SRS18536773", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94914, null, 0.06241, null, 0.72829, null, 0.4546, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24951, "SRR25557802", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L001_R1_001.fastq.gz", "fastq", 395130702.0, 5338263.0, "GSM7688785 r1", "0:74.02", "A:107005793;C:90183031;G:92316770;T:105476481;N:148627", 74, null, null, null, 107005793, 90183031, 92316770, 105476481, 148627, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94534, null, 0.07625, null, 0.73888, null, 0.48135, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24952, "SRR25557803", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L002_R1_001.fastq.gz", "fastq", 396764458.0, 5358448.0, "GSM7688785 r2", "0:74.04", "A:107513717;C:90540282;G:92658504;T:105917444;N:134511", 74, null, null, null, 107513717, 90540282, 92658504, 105917444, 134511, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94374, null, 0.07709, null, 0.73878, null, 0.47615, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24953, "SRR25557804", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L003_R1_001.fastq.gz", "fastq", 399623551.0, 5397520.0, "GSM7688785 r3", "0:74.04", "A:108230540;C:91192011;G:93388052;T:106665106;N:147842", 74, null, null, null, 108230540, 91192011, 93388052, 106665106, 147842, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94399, null, 0.07657, null, 0.73797, null, 0.4794, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24954, "SRR25557805", "SRX21286659", "SRS18536772", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control X", "GSM7688785", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control X", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688785", "GSM7688785: Control X; Danio rerio; RNA Seq", "GSM7688785 r1", "GSM7688785", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-X_S1_L004_R1_001.fastq.gz", "fastq", 393298978.0, 5312101.0, "GSM7688785 r4", "0:74.04", "A:106518845;C:89734564;G:91901232;T:105004490;N:139847", 74, null, null, null, 106518845, 89734564, 91901232, 105004490, 139847, "SRX21286659", "SRS18536772", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94423, null, 0.07599, null, 0.73884, null, 0.47905, null, 71, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24955, "SRR25557806", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L001_R1_001.fastq.gz", "fastq", 366045799.0, 4944832.0, "GSM7688783 r1", "0:74.03", "A:98000119;C:84654222;G:86951226;T:96295351;N:144881", 74, null, null, null, 98000119, 84654222, 86951226, 96295351, 144881, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94303, null, 0.07499, null, 0.73085, null, 0.47881, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24956, "SRR25557807", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L002_R1_001.fastq.gz", "fastq", 369429068.0, 4988719.0, "GSM7688783 r2", "0:74.05", "A:98907882;C:85446993;G:87729593;T:97216477;N:128123", 74, null, null, null, 98907882, 85446993, 87729593, 97216477, 128123, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94261, null, 0.07335, null, 0.72969, null, 0.47867, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24957, "SRR25557808", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L003_R1_001.fastq.gz", "fastq", 369967330.0, 4996710.0, "GSM7688783 r3", "0:74.04", "A:99035743;C:85549878;G:87926587;T:97310812;N:144310", 74, null, null, null, 99035743, 85549878, 87926587, 97310812, 144310, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94328, null, 0.0743, null, 0.73034, null, 0.47133, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24958, "SRR25557809", "SRX21286658", "SRS18536771", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control IX", "GSM7688783", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control IX", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688783", "GSM7688783: Control IX; Danio rerio; RNA Seq", "GSM7688783 r1", "GSM7688783", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-IX_S22_L004_R1_001.fastq.gz", "fastq", 365499176.0, 4936305.0, "GSM7688783 r4", "0:74.04", "A:97825658;C:84517732;G:86863655;T:96157429;N:134702", 74, null, null, null, 97825658, 84517732, 86863655, 96157429, 134702, "SRX21286658", "SRS18536771", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94286, null, 0.07288, null, 0.72999, null, 0.4783, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24959, "SRR25557810", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L001_R1_001.fastq.gz", "fastq", 488585907.0, 6585668.0, "GSM7688782 r1", "0:74.19", "A:131727468;C:112349971;G:115189425;T:129203159;N:115884", 74, null, null, null, 131727468, 112349971, 115189425, 129203159, 115884, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93794, null, 0.07381, null, 0.7315, null, 0.47355, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24960, "SRR25557811", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L002_R1_001.fastq.gz", "fastq", 493766544.0, 6653820.0, "GSM7688782 r2", "0:74.21", "A:133135166;C:113551418;G:116398455;T:130575771;N:105734", 74, null, null, null, 133135166, 113551418, 116398455, 130575771, 105734, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93729, null, 0.07312, null, 0.7307, null, 0.47966, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24961, "SRR25557812", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L003_R1_001.fastq.gz", "fastq", 494935071.0, 6670024.0, "GSM7688782 r3", "0:74.20", "A:133406912;C:113769494;G:116771560;T:130871612;N:115493", 74, null, null, null, 133406912, 113769494, 116771560, 130871612, 115493, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93847, null, 0.07383, null, 0.73194, null, 0.47646, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24962, "SRR25557813", "SRX21286657", "SRS18536770", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VIII", "GSM7688782", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VIII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688782", "GSM7688782: Control VIII; Danio rerio; RNA Seq", "GSM7688782 r1", "GSM7688782", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VIII_S20_L004_R1_001.fastq.gz", "fastq", 487644286.0, 6572100.0, "GSM7688782 r4", "0:74.20", "A:131423055;C:112092623;G:115067911;T:128945959;N:114738", 74, null, null, null, 131423055, 112092623, 115067911, 128945959, 114738, "SRX21286657", "SRS18536770", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.93708, null, 0.0732, null, 0.73186, null, 0.4781, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24963, "SRR25557814", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L001_R1_001.fastq.gz", "fastq", 419048369.0, 5664168.0, "GSM7688781 r1", "0:73.98", "A:111569757;C:97553687;G:100228004;T:109523480;N:173441", 73, null, null, null, 111569757, 97553687, 100228004, 109523480, 173441, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94179, null, 0.06596, null, 0.74499, null, 0.46809, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24964, "SRR25557815", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L002_R1_001.fastq.gz", "fastq", 422419362.0, 5707444.0, "GSM7688781 r2", "0:74.01", "A:112476977;C:98366185;G:101046586;T:110369882;N:159732", 74, null, null, null, 112476977, 98366185, 101046586, 110369882, 159732, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94275, null, 0.06539, null, 0.74523, null, 0.47247, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24965, "SRR25557816", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L003_R1_001.fastq.gz", "fastq", 424260551.0, 5733133.0, "GSM7688781 r3", "0:74.00", "A:112957538;C:98789480;G:101496747;T:110850186;N:166600", 74, null, null, null, 112957538, 98789480, 101496747, 110850186, 166600, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94174, null, 0.06482, null, 0.74304, null, 0.46935, null, 75, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [24966, "SRR25557817", "SRX21286656", "SRS18536769", "SRP453884", "PRJNA1003026", "Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq]", "GSE240238", "Transcriptome Analysis", "Background: V0v spinal interneurons are highly conserved  glutamatergic  commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However  we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks  we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings.  Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that  by this stage of development  evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons  or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons  plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly  we show that Hmx2/3a  repress dI2 interneuronal expression of skor1a and nefma  two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons  as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2  V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then  later  start to express markers of distinct types of inhibitory spinal interneurons  or motoneurons. Taken together  our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total  all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.", "parent bioproject:PRJNA1003022", "pubmed:38017520", null, "Control VII", "GSM7688781", null, "source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing", "Control VII", "We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence \u201cCTGTCTCTTATACACATCT\u201d from the 3\u2019 end using default parameters  before trimming bases from the 5\u2019 end  selecting an end minimum quality value Phred score of 32  and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting  clustering by features  using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.", "Spinal Cord", "The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5\u2019 TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5\u2019 ACGTATCCTGTGTTGTTTCGGGCAT  plus 5 ng/nl of a control zebrafish p53 morpholino 5\u2019 GCGCCATTGCTTTGCAAGAATTG  into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools.   Morpholino injections always produce a spectrum of phenotypes  since it is hard to ensure that every cell receives the same dose. Therefore  prior to processing for FACS at 27 hpf  we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed  likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz\u2019s L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer\u2019s instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", "The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this  they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals  so this could not be used to stage injected embryos. Instead  these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle  head size and eye size as prim staged uninjected control embryos.", "tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control", "GSM7688781", "GSM7688781: Control VII; Danio rerio; RNA Seq", "GSM7688781 r1", "GSM7688781", "1", "Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf.   Embryos were deyolked  dissected and dissociated as described in GSE145916  with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord  and posteriorly  immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation  LK003150  trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 \u00b5l remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip  we passed each sample through a 40 \u00b5m Flowmi cell strainer Merck  BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation  samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific  21083027 + 0.5% FBS and stored on ice. Immediately before FACS  DAPI Merck  D9542 and Draq5 BioLegend  424101 were added at a final concentration of 5 \u00b5g/ml and 5 \u00b5M respectively.  FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al.  2008 with the following modifications. Ice cold samples were filtered through 35 \u00b5m mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon  352235. All FAC sorting and collection steps were performed at +4oC  using a 100 \u00b5m nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width  followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 \u00b5l of Buffer RLT Qiagen RNeasy Micro Kit  74004 plus 143 mM\uf020\u03b2 mercaptoethanol. Sorted cells were stored at  80oC prior to RNA extraction.  Frozen FAC sorted cell lysates were removed from storage at  80oC and thawed in a 37oC waterbath  before transferring to sterile microcentrifuge tubes. If necessary  sample volumes were completed to 250 \u00b5l with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific  10977035. 750 \u00b5l TRIzol LS Reagent ThermoFisher Scientific  10296028 was added to each 250 \u00b5l sample  before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific  A33248  before incubating for 5 minutes at room temperature. 200 \u00b5l chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC  before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly  and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit  Qiagen  74004  before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer  RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 \u00b5l RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent  5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific  Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific  Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara  634888  and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina  FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent  5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit  v2.5  75 cycles  20024906.", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP453884", null, "loader:fastq load.py", "Control-VII_S21_L004_R1_001.fastq.gz", "fastq", 417875320.0, 5646817.0, "GSM7688781 r4", "0:74.00", "A:111226895;C:97273168;G:100030641;T:109182520;N:162096", 74, null, null, null, 111226895, 97273168, 100030641, 109182520, 162096, "SRX21286656", "SRS18536769", "SRA1688461", "Lewis Lab, Biology, Syracuse University", "Lewis Lab, Biology, Syracuse University", 1, 0.94352, null, 0.06524, null, 0.74442, null, 0.47095, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "unknown", "cdna_unspecified", "nextera", "sc", "single_cell_plate", "smartseq", null, "United States", "2023-08-07", "Multi-stage", "Embryo", "Spinal Cord", "Nervous System"], [26558, "SRR26173859", "SRX21885960", "SRS18977085", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 F17 R1", "GSM7804200", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 F17 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804200", "GSM7804200: V2a sample2 354 F17 R1; Danio rerio; RNA Seq", "GSM7804200 r1", "GSM7804200", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_F17_R1.fastq.gz", "fastq", 26979490.0, 627430.0, "GSM7804200 r1", "0:43", "A:7493119;C:5872644;G:6013311;T:7600416;N:0", 43, null, null, null, 7493119, 5872644, 6013311, 7600416, 0, "SRX21885960", "SRS18977085", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.82979, null, 0.33034, null, 0.94253, null, 0.53995, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26559, "SRR26173860", "SRX21885959", "SRS18977083", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 F16 R1", "GSM7804199", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 F16 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804199", "GSM7804199: V2a sample2 354 F16 R1; Danio rerio; RNA Seq", "GSM7804199 r1", "GSM7804199", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_F16_R1.fastq.gz", "fastq", 26312130.0, 611910.0, "GSM7804199 r1", "0:43", "A:7117249;C:5957278;G:6103577;T:7134026;N:0", 43, null, null, null, 7117249, 5957278, 6103577, 7134026, 0, "SRX21885959", "SRS18977083", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.87071, null, 0.23579, null, 0.90678, null, 0.52226, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26560, "SRR26173861", "SRX21885958", "SRS18977084", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 F15 R1", "GSM7804198", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 F15 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804198", "GSM7804198: V2a sample2 354 F15 R1; Danio rerio; RNA Seq", "GSM7804198 r1", "GSM7804198", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_F15_R1.fastq.gz", "fastq", 32073872.0, 745904.0, "GSM7804198 r1", "0:43", "A:8695962;C:7255833;G:7422516;T:8699561;N:0", 43, null, null, null, 8695962, 7255833, 7422516, 8699561, 0, "SRX21885958", "SRS18977084", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.86262, null, 0.24391, null, 0.90881, null, 0.52511, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26561, "SRR26173862", "SRX21885957", "SRS18977081", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 F14 R1", "GSM7804197", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 F14 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804197", "GSM7804197: V2a sample2 354 F14 R1; Danio rerio; RNA Seq", "GSM7804197 r1", "GSM7804197", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_F14_R1.fastq.gz", "fastq", 31158875.0, 724625.0, "GSM7804197 r1", "0:43", "A:8769852;C:6707813;G:6866255;T:8814955;N:0", 43, null, null, null, 8769852, 6707813, 6866255, 8814955, 0, "SRX21885957", "SRS18977081", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.8739, null, 0.27254, null, 0.9246, null, 0.54185, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26562, "SRR26173863", "SRX21885956", "SRS18977082", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 F13 R1", "GSM7804196", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 F13 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804196", "GSM7804196: V2a sample2 354 F13 R1; Danio rerio; RNA Seq", "GSM7804196 r1", "GSM7804196", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_F13_R1.fastq.gz", "fastq", 41289804.0, 960228.0, "GSM7804196 r1", "0:43", "A:11114918;C:9358398;G:9568761;T:11247727;N:0", 43, null, null, null, 11114918, 9358398, 9568761, 11247727, 0, "SRX21885956", "SRS18977082", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.82861, null, 0.29409, null, 0.93235, null, 0.49485, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26563, "SRR26173864", "SRX21885955", "SRS18977079", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 F12 R1", "GSM7804195", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 F12 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804195", "GSM7804195: V2a sample2 354 F12 R1; Danio rerio; RNA Seq", "GSM7804195 r1", "GSM7804195", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_F12_R1.fastq.gz", "fastq", 30569259.0, 710913.0, "GSM7804195 r1", "0:43", "A:8286806;C:6854804;G:7028453;T:8399196;N:0", 43, null, null, null, 8286806, 6854804, 7028453, 8399196, 0, "SRX21885955", "SRS18977079", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.80426, null, 0.29136, null, 0.94123, null, 0.54305, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26564, "SRR26173865", "SRX21885954", "SRS18977080", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 F11 R1", "GSM7804194", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 F11 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804194", "GSM7804194: V2a sample2 354 F11 R1; Danio rerio; RNA Seq", "GSM7804194 r1", "GSM7804194", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_F11_R1.fastq.gz", "fastq", 29626097.0, 688979.0, "GSM7804194 r1", "0:43", "A:8063765;C:6645347;G:6803778;T:8113207;N:0", 43, null, null, null, 8063765, 6645347, 6803778, 8113207, 0, "SRX21885954", "SRS18977080", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.84972, null, 0.26423, null, 0.9234, null, 0.54087, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26565, "SRR26173866", "SRX21885953", "SRS18977078", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 F10 R1", "GSM7804193", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 F10 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804193", "GSM7804193: V2a sample2 354 F10 R1; Danio rerio; RNA Seq", "GSM7804193 r1", "GSM7804193", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_F10_R1.fastq.gz", "fastq", 24594409.0, 571963.0, "GSM7804193 r1", "0:43", "A:6605642;C:5535165;G:5682586;T:6771016;N:0", 43, null, null, null, 6605642, 5535165, 5682586, 6771016, 0, "SRX21885953", "SRS18977078", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.77683, null, 0.28872, null, 0.94633, null, 0.52513, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26566, "SRR26173867", "SRX21885952", "SRS18977077", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 E9 R1", "GSM7804168", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 E9 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804168", "GSM7804168: V2a sample2 354 E9 R1; Danio rerio; RNA Seq", "GSM7804168 r1", "GSM7804168", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_E9_R1.fastq.gz", "fastq", 33259941.0, 773487.0, "GSM7804168 r1", "0:43", "A:9004615;C:7506729;G:7674909;T:9073688;N:0", 43, null, null, null, 9004615, 7506729, 7674909, 9073688, 0, "SRX21885952", "SRS18977077", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.85528, null, 0.32094, null, 0.89217, null, 0.50224, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26567, "SRR26173868", "SRX21885951", "SRS18977076", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 E8 R1", "GSM7804167", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 E8 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804167", "GSM7804167: V2a sample2 354 E8 R1; Danio rerio; RNA Seq", "GSM7804167 r1", "GSM7804167", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_E8_R1.fastq.gz", "fastq", 45348316.0, 1054612.0, "GSM7804167 r1", "0:43", "A:12143243;C:10459395;G:10612458;T:12133220;N:0", 43, null, null, null, 12143243, 10459395, 10612458, 12133220, 0, "SRX21885951", "SRS18977076", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.8783, null, 0.19318, null, 0.88572, null, 0.49101, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26568, "SRR26173869", "SRX21885950", "SRS18977075", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 E7 R1", "GSM7804166", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 E7 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804166", "GSM7804166: V2a sample2 354 E7 R1; Danio rerio; RNA Seq", "GSM7804166 r1", "GSM7804166", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_E7_R1.fastq.gz", "fastq", 30522002.0, 709814.0, "GSM7804166 r1", "0:43", "A:8167984;C:7033955;G:7127866;T:8192197;N:0", 43, null, null, null, 8167984, 7033955, 7127866, 8192197, 0, "SRX21885950", "SRS18977075", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.87804, null, 0.20762, null, 0.88418, null, 0.51381, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26569, "SRR26173870", "SRX21885949", "SRS18977074", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 E6 R1", "GSM7804165", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 E6 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804165", "GSM7804165: V2a sample2 354 E6 R1; Danio rerio; RNA Seq", "GSM7804165 r1", "GSM7804165", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_E6_R1.fastq.gz", "fastq", 39095858.0, 909206.0, "GSM7804165 r1", "0:43", "A:10597068;C:8804712;G:8974908;T:10719170;N:0", 43, null, null, null, 10597068, 8804712, 8974908, 10719170, 0, "SRX21885949", "SRS18977074", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.8093, null, 0.38297, null, 0.91545, null, 0.56195, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26570, "SRR26173871", "SRX21885948", "SRS18977073", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 E5 R1", "GSM7804164", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 E5 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804164", "GSM7804164: V2a sample2 354 E5 R1; Danio rerio; RNA Seq", "GSM7804164 r1", "GSM7804164", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_E5_R1.fastq.gz", "fastq", 33632880.0, 782160.0, "GSM7804164 r1", "0:43", "A:9099447;C:7602241;G:7747634;T:9183558;N:0", 43, null, null, null, 9099447, 7602241, 7747634, 9183558, 0, "SRX21885948", "SRS18977073", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.83226, null, 0.28405, null, 0.90715, null, 0.52148, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26571, "SRR26173872", "SRX21885947", "SRS18977072", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 E4 R1", "GSM7804163", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 E4 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804163", "GSM7804163: V2a sample2 354 E4 R1; Danio rerio; RNA Seq", "GSM7804163 r1", "GSM7804163", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_E4_R1.fastq.gz", "fastq", 10823057.0, 251699.0, "GSM7804163 r1", "0:43", "A:3014035;C:2419189;G:2487845;T:2901988;N:0", 43, null, null, null, 3014035, 2419189, 2487845, 2901988, 0, "SRX21885947", "SRS18977072", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.85783, null, 0.26946, null, 0.91033, null, 0.52459, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26572, "SRR26173873", "SRX21885946", "SRS18977068", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 E3 R1", "GSM7804162", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 E3 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804162", "GSM7804162: V2a sample2 354 E3 R1; Danio rerio; RNA Seq", "GSM7804162 r1", "GSM7804162", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_E3_R1.fastq.gz", "fastq", 49775381.0, 1157567.0, "GSM7804162 r1", "0:43", "A:13325978;C:11313973;G:11568082;T:13567348;N:0", 43, null, null, null, 13325978, 11313973, 11568082, 13567348, 0, "SRX21885946", "SRS18977068", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.80873, null, 0.29504, null, 0.93791, null, 0.52789, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26573, "SRR26173874", "SRX21885945", "SRS18977070", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 E2 R1", "GSM7804161", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 E2 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804161", "GSM7804161: V2a sample2 354 E2 R1; Danio rerio; RNA Seq", "GSM7804161 r1", "GSM7804161", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_E2_R1.fastq.gz", "fastq", 44072334.0, 1024938.0, "GSM7804161 r1", "0:43", "A:11780930;C:10068667;G:10185567;T:12037170;N:0", 43, null, null, null, 11780930, 10068667, 10185567, 12037170, 0, "SRX21885945", "SRS18977070", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.78009, null, 0.2621, null, 0.943, null, 0.54719, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26574, "SRR26173875", "SRX21885944", "SRS18977071", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 D1 R1", "GSM7804136", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 D1 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804136", "GSM7804136: V2a sample2 354 D1 R1; Danio rerio; RNA Seq", "GSM7804136 r1", "GSM7804136", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_D1_R1.fastq.gz", "fastq", 49923.0, 1161.0, "GSM7804136 r1", "0:43", "A:12799;C:11604;G:11134;T:14386;N:0", 43, null, null, null, 12799, 11604, 11134, 14386, 0, "SRX21885944", "SRS18977071", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.5773, null, 0.18478, null, 0.99472, null, 0.51097, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26575, "SRR26173876", "SRX21885943", "SRS18977069", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 C24 R1", "GSM7804135", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 C24 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804135", "GSM7804135: V2a sample2 354 C24 R1; Danio rerio; RNA Seq", "GSM7804135 r1", "GSM7804135", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_C24_R1.fastq.gz", "fastq", 30735540.0, 714780.0, "GSM7804135 r1", "0:43", "A:7999390;C:7036767;G:7190113;T:8509270;N:0", 43, null, null, null, 7999390, 7036767, 7190113, 8509270, 0, "SRX21885943", "SRS18977069", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.48457, null, 0.16974, null, 0.99328, null, 0.82979, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26576, "SRR26173877", "SRX21885942", "SRS18977067", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 C23 R1", "GSM7804134", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 C23 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804134", "GSM7804134: V2a sample2 354 C23 R1; Danio rerio; RNA Seq", "GSM7804134 r1", "GSM7804134", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_C23_R1.fastq.gz", "fastq", 24386031.0, 567117.0, "GSM7804134 r1", "0:43", "A:6620599;C:5230020;G:5371347;T:7164065;N:0", 43, null, null, null, 6620599, 5230020, 5371347, 7164065, 0, "SRX21885942", "SRS18977067", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.55183, null, 0.13531, null, 0.99105, null, 0.54904, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26577, "SRR26173878", "SRX21885941", "SRS18977064", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 C22 R1", "GSM7804133", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 C22 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804133", "GSM7804133: V2a sample2 354 C22 R1; Danio rerio; RNA Seq", "GSM7804133 r1", "GSM7804133", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_C22_R1.fastq.gz", "fastq", 35984550.0, 836850.0, "GSM7804133 r1", "0:43", "A:9917644;C:7959027;G:8126203;T:9981676;N:0", 43, null, null, null, 9917644, 7959027, 8126203, 9981676, 0, "SRX21885941", "SRS18977064", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.85473, null, 0.2804, null, 0.91165, null, 0.52909, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26578, "SRR26173879", "SRX21885940", "SRS18977065", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 C21 R1", "GSM7804132", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 C21 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804132", "GSM7804132: V2a sample2 354 C21 R1; Danio rerio; RNA Seq", "GSM7804132 r1", "GSM7804132", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_C21_R1.fastq.gz", "fastq", 32265738.0, 750366.0, "GSM7804132 r1", "0:43", "A:8963112;C:7046873;G:7192067;T:9063686;N:0", 43, null, null, null, 8963112, 7046873, 7192067, 9063686, 0, "SRX21885940", "SRS18977065", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.8426, null, 0.36876, null, 0.91179, null, 0.58759, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26579, "SRR26173880", "SRX21885939", "SRS18977066", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 C20 R1", "GSM7804131", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 C20 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804131", "GSM7804131: V2a sample2 354 C20 R1; Danio rerio; RNA Seq", "GSM7804131 r1", "GSM7804131", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_C20_R1.fastq.gz", "fastq", 33471157.0, 778399.0, "GSM7804131 r1", "0:43", "A:9073629;C:7510863;G:7675381;T:9211284;N:0", 43, null, null, null, 9073629, 7510863, 7675381, 9211284, 0, "SRX21885939", "SRS18977066", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.82141, null, 0.28926, null, 0.93655, null, 0.49873, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26580, "SRR26173881", "SRX21885938", "SRS18977062", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 C19 R1", "GSM7804130", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 C19 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804130", "GSM7804130: V2a sample2 354 C19 R1; Danio rerio; RNA Seq", "GSM7804130 r1", "GSM7804130", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_C19_R1.fastq.gz", "fastq", 30131304.0, 700728.0, "GSM7804130 r1", "0:43", "A:8036932;C:6893678;G:7034855;T:8165839;N:0", 43, null, null, null, 8036932, 6893678, 7034855, 8165839, 0, "SRX21885938", "SRS18977062", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.80896, null, 0.25245, null, 0.94067, null, 0.54072, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26581, "SRR26173882", "SRX21885937", "SRS18977061", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 C18 R1", "GSM7804129", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 C18 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804129", "GSM7804129: V2a sample2 354 C18 R1; Danio rerio; RNA Seq", "GSM7804129 r1", "GSM7804129", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_C18_R1.fastq.gz", "fastq", 31050429.0, 722103.0, "GSM7804129 r1", "0:43", "A:8363024;C:7088111;G:7227301;T:8371993;N:0", 43, null, null, null, 8363024, 7088111, 7227301, 8371993, 0, "SRX21885937", "SRS18977061", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.87399, null, 0.20843, null, 0.89881, null, 0.49682, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26582, "SRR26173883", "SRX21885936", "SRS18977063", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 B17 R1", "GSM7804104", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 B17 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804104", "GSM7804104: V2a sample2 354 B17 R1; Danio rerio; RNA Seq", "GSM7804104 r1", "GSM7804104", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_B17_R1.fastq.gz", "fastq", 47093729.0, 1095203.0, "GSM7804104 r1", "0:43", "A:13057598;C:10185883;G:10457076;T:13393172;N:0", 43, null, null, null, 13057598, 10185883, 10457076, 13393172, 0, "SRX21885936", "SRS18977063", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.80343, null, 0.36098, null, 0.95059, null, 0.52562, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26583, "SRR26173884", "SRX21885935", "SRS18977060", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 B16 R1", "GSM7804103", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 B16 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804103", "GSM7804103: V2a sample2 354 B16 R1; Danio rerio; RNA Seq", "GSM7804103 r1", "GSM7804103", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_B16_R1.fastq.gz", "fastq", 34160791.0, 794437.0, "GSM7804103 r1", "0:43", "A:9178469;C:7729053;G:7901331;T:9351938;N:0", 43, null, null, null, 9178469, 7729053, 7901331, 9351938, 0, "SRX21885935", "SRS18977060", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.79028, null, 0.25695, null, 0.94627, null, 0.51668, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26584, "SRR26173885", "SRX21885934", "SRS18977059", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 B15 R1", "GSM7804102", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 B15 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804102", "GSM7804102: V2a sample2 354 B15 R1; Danio rerio; RNA Seq", "GSM7804102 r1", "GSM7804102", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_B15_R1.fastq.gz", "fastq", 29152495.0, 677965.0, "GSM7804102 r1", "0:43", "A:7966546;C:6516464;G:6675123;T:7994362;N:0", 43, null, null, null, 7966546, 6516464, 6675123, 7994362, 0, "SRX21885934", "SRS18977059", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.83832, null, 0.25969, null, 0.92673, null, 0.51661, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26585, "SRR26173886", "SRX21885933", "SRS18977057", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 B14 R1", "GSM7804101", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 B14 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804101", "GSM7804101: V2a sample2 354 B14 R1; Danio rerio; RNA Seq", "GSM7804101 r1", "GSM7804101", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_B14_R1.fastq.gz", "fastq", 23811379.0, 553753.0, "GSM7804101 r1", "0:43", "A:6532691;C:5215122;G:5353003;T:6710563;N:0", 43, null, null, null, 6532691, 5215122, 5353003, 6710563, 0, "SRX21885933", "SRS18977057", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.74067, null, 0.3282, null, 0.95272, null, 0.49582, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26586, "SRR26173887", "SRX21885932", "SRS18977058", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 B13 R1", "GSM7804100", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 B13 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804100", "GSM7804100: V2a sample2 354 B13 R1; Danio rerio; RNA Seq", "GSM7804100 r1", "GSM7804100", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_B13_R1.fastq.gz", "fastq", 18141356.0, 421892.0, "GSM7804100 r1", "0:43", "A:4926550;C:4092334;G:4186281;T:4936191;N:0", 43, null, null, null, 4926550, 4092334, 4186281, 4936191, 0, "SRX21885932", "SRS18977058", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.87463, null, 0.22642, null, 0.89826, null, 0.50541, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26587, "SRR26173888", "SRX21885931", "SRS18977056", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 B12 R1", "GSM7804099", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 B12 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804099", "GSM7804099: V2a sample2 354 B12 R1; Danio rerio; RNA Seq", "GSM7804099 r1", "GSM7804099", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_B12_R1.fastq.gz", "fastq", 34932039.0, 812373.0, "GSM7804099 r1", "0:43", "A:9555191;C:7704451;G:7897587;T:9774810;N:0", 43, null, null, null, 9555191, 7704451, 7897587, 9774810, 0, "SRX21885931", "SRS18977056", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.80402, null, 0.30224, null, 0.93592, null, 0.53659, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26588, "SRR26173889", "SRX21885930", "SRS18977055", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 B11 R1", "GSM7804098", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 B11 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804098", "GSM7804098: V2a sample2 354 B11 R1; Danio rerio; RNA Seq", "GSM7804098 r1", "GSM7804098", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_B11_R1.fastq.gz", "fastq", 35987087.0, 836909.0, "GSM7804098 r1", "0:43", "A:9801738;C:8047161;G:8248020;T:9890168;N:0", 43, null, null, null, 9801738, 8047161, 8248020, 9890168, 0, "SRX21885930", "SRS18977055", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.81805, null, 0.24526, null, 0.92092, null, 0.54523, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26589, "SRR26173890", "SRX21885929", "SRS18977054", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 B10 R1", "GSM7804097", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 B10 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804097", "GSM7804097: V2a sample2 354 B10 R1; Danio rerio; RNA Seq", "GSM7804097 r1", "GSM7804097", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_B10_R1.fastq.gz", "fastq", 33252846.0, 773322.0, "GSM7804097 r1", "0:43", "A:8996915;C:7433025;G:7633859;T:9189047;N:0", 43, null, null, null, 8996915, 7433025, 7633859, 9189047, 0, "SRX21885929", "SRS18977054", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.78892, null, 0.28622, null, 0.94237, null, 0.53023, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26590, "SRR26173891", "SRX21885928", "SRS18977053", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 A9 R1", "GSM7804072", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 A9 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804072", "GSM7804072: V2a sample2 354 A9 R1; Danio rerio; RNA Seq", "GSM7804072 r1", "GSM7804072", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_A9_R1.fastq.gz", "fastq", 23658600.0, 550200.0, "GSM7804072 r1", "0:43", "A:6447300;C:5342358;G:5472128;T:6396814;N:0", 43, null, null, null, 6447300, 5342358, 5472128, 6396814, 0, "SRX21885928", "SRS18977053", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.86727, null, 0.23136, null, 0.8996, null, 0.52692, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26591, "SRR26173892", "SRX21885927", "SRS18977051", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 A8 R1", "GSM7804071", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 A8 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804071", "GSM7804071: V2a sample2 354 A8 R1; Danio rerio; RNA Seq", "GSM7804071 r1", "GSM7804071", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_A8_R1.fastq.gz", "fastq", 18645187.0, 433609.0, "GSM7804071 r1", "0:43", "A:5151340;C:4145072;G:4243308;T:5105467;N:0", 43, null, null, null, 5151340, 4145072, 4243308, 5105467, 0, "SRX21885927", "SRS18977051", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.86561, null, 0.28633, null, 0.89438, null, 0.53463, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26592, "SRR26173893", "SRX21885926", "SRS18977052", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 A7 R1", "GSM7804070", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 A7 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804070", "GSM7804070: V2a sample2 354 A7 R1; Danio rerio; RNA Seq", "GSM7804070 r1", "GSM7804070", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_A7_R1.fastq.gz", "fastq", 42340466.0, 984662.0, "GSM7804070 r1", "0:43", "A:11373539;C:9660020;G:9840242;T:11466665;N:0", 43, null, null, null, 11373539, 9660020, 9840242, 11466665, 0, "SRX21885926", "SRS18977052", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.81646, null, 0.24599, null, 0.93833, null, 0.57817, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26593, "SRR26173894", "SRX21885925", "SRS18977050", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 A6 R1", "GSM7804069", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 A6 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804069", "GSM7804069: V2a sample2 354 A6 R1; Danio rerio; RNA Seq", "GSM7804069 r1", "GSM7804069", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_A6_R1.fastq.gz", "fastq", 23486858.0, 546206.0, "GSM7804069 r1", "0:43", "A:6654369;C:4998242;G:5115579;T:6718668;N:0", 43, null, null, null, 6654369, 4998242, 5115579, 6718668, 0, "SRX21885925", "SRS18977050", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.84122, null, 0.57245, null, 0.77794, null, 0.53266, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26594, "SRR26173895", "SRX21885924", "SRS18977048", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 A5 R1", "GSM7804068", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 A5 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804068", "GSM7804068: V2a sample2 354 A5 R1; Danio rerio; RNA Seq", "GSM7804068 r1", "GSM7804068", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_A5_R1.fastq.gz", "fastq", 46876450.0, 1090150.0, "GSM7804068 r1", "0:43", "A:12599291;C:10693086;G:10940020;T:12644053;N:0", 43, null, null, null, 12599291, 10693086, 10940020, 12644053, 0, "SRX21885924", "SRS18977048", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.86707, null, 0.22085, null, 0.89412, null, 0.51257, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26595, "SRR26173896", "SRX21885923", "SRS18977049", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 A4 R1", "GSM7804067", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 A4 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804067", "GSM7804067: V2a sample2 354 A4 R1; Danio rerio; RNA Seq", "GSM7804067 r1", "GSM7804067", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_A4_R1.fastq.gz", "fastq", 43487233.0, 1011331.0, "GSM7804067 r1", "0:43", "A:11900913;C:9677048;G:9921622;T:11987650;N:0", 43, null, null, null, 11900913, 9677048, 9921622, 11987650, 0, "SRX21885923", "SRS18977049", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.8409, null, 0.27122, null, 0.91165, null, 0.55221, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26596, "SRR26173897", "SRX21885922", "SRS18977047", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 A3 R1", "GSM7804066", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 A3 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804066", "GSM7804066: V2a sample2 354 A3 R1; Danio rerio; RNA Seq", "GSM7804066 r1", "GSM7804066", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_A3_R1.fastq.gz", "fastq", 44287248.0, 1029936.0, "GSM7804066 r1", "0:43", "A:12065729;C:9907516;G:10143806;T:12170197;N:0", 43, null, null, null, 12065729, 9907516, 10143806, 12170197, 0, "SRX21885922", "SRS18977047", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.80982, null, 0.29232, null, 0.93675, null, 0.5661, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26597, "SRR26173898", "SRX21885921", "SRS18977046", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample2 354 A2 R1", "GSM7804065", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample2 354 A2 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804065", "GSM7804065: V2a sample2 354 A2 R1; Danio rerio; RNA Seq", "GSM7804065 r1", "GSM7804065", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_354_A2_R1.fastq.gz", "fastq", 39822515.0, 926105.0, "GSM7804065 r1", "0:43", "A:10662390;C:9155016;G:9361757;T:10643352;N:0", 43, null, null, null, 10662390, 9155016, 9361757, 10643352, 0, "SRX21885921", "SRS18977046", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.88377, null, 0.19244, null, 0.88627, null, 0.52412, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26598, "SRR26173899", "SRX21885920", "SRS18977044", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 P1 R1", "GSM7804040", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 P1 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804040", "GSM7804040: V2a sample1 353 P1 R1; Danio rerio; RNA Seq", "GSM7804040 r1", "GSM7804040", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_P1_R1.fastq.gz", "fastq", 35622877.0, 828439.0, "GSM7804040 r1", "0:43", "A:10094838;C:7580955;G:7760837;T:10186247;N:0", 43, null, null, null, 10094838, 7580955, 7760837, 10186247, 0, "SRX21885920", "SRS18977044", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.82753, null, 0.38743, null, 0.94085, null, 0.70753, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26599, "SRR26173900", "SRX21885919", "SRS18977045", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 O24 R1", "GSM7804039", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 O24 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804039", "GSM7804039: V2a sample1 353 O24 R1; Danio rerio; RNA Seq", "GSM7804039 r1", "GSM7804039", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_O24_R1.fastq.gz", "fastq", 25162482.0, 585174.0, "GSM7804039 r1", "0:43", "A:6589034;C:5708817;G:5862315;T:7002316;N:0", 43, null, null, null, 6589034, 5708817, 5862315, 7002316, 0, "SRX21885919", "SRS18977045", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.50646, null, 0.15797, null, 0.99086, null, 0.48626, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26600, "SRR26173901", "SRX21885918", "SRS18977043", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 O23 R1", "GSM7804038", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 O23 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804038", "GSM7804038: V2a sample1 353 O23 R1; Danio rerio; RNA Seq", "GSM7804038 r1", "GSM7804038", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_O23_R1.fastq.gz", "fastq", 21378396.0, 497172.0, "GSM7804038 r1", "0:43", "A:5419690;C:4870276;G:5019946;T:6068484;N:0", 43, null, null, null, 5419690, 4870276, 5019946, 6068484, 0, "SRX21885918", "SRS18977043", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.4177, null, 0.18826, null, 0.99344, null, 0.78066, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26601, "SRR26173902", "SRX21885917", "SRS18977042", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 O22 R1", "GSM7804037", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 O22 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804037", "GSM7804037: V2a sample1 353 O22 R1; Danio rerio; RNA Seq", "GSM7804037 r1", "GSM7804037", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_O22_R1.fastq.gz", "fastq", 30321665.0, 705155.0, "GSM7804037 r1", "0:43", "A:8123534;C:6839326;G:6921711;T:8437094;N:0", 43, null, null, null, 8123534, 6839326, 6921711, 8437094, 0, "SRX21885917", "SRS18977042", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.76574, null, 0.24445, null, 0.94014, null, 0.51811, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26602, "SRR26173903", "SRX21885916", "SRS18977041", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 O21 R1", "GSM7804036", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 O21 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804036", "GSM7804036: V2a sample1 353 O21 R1; Danio rerio; RNA Seq", "GSM7804036 r1", "GSM7804036", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_O21_R1.fastq.gz", "fastq", 24544916.0, 570812.0, "GSM7804036 r1", "0:43", "A:6528543;C:5656479;G:5771413;T:6588481;N:0", 43, null, null, null, 6528543, 5656479, 5771413, 6588481, 0, "SRX21885916", "SRS18977041", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.87756, null, 0.17329, null, 0.88124, null, 0.51427, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26603, "SRR26173904", "SRX21885915", "SRS18977040", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 O20 R1", "GSM7804035", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 O20 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804035", "GSM7804035: V2a sample1 353 O20 R1; Danio rerio; RNA Seq", "GSM7804035 r1", "GSM7804035", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_O20_R1.fastq.gz", "fastq", 27471324.0, 638868.0, "GSM7804035 r1", "0:43", "A:7349212;C:6154048;G:6323796;T:7644268;N:0", 43, null, null, null, 7349212, 6154048, 6323796, 7644268, 0, "SRX21885915", "SRS18977040", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.7529, null, 0.26778, null, 0.94635, null, 0.5148, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26604, "SRR26173905", "SRX21885914", "SRS18977039", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 O19 R1", "GSM7804034", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 O19 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804034", "GSM7804034: V2a sample1 353 O19 R1; Danio rerio; RNA Seq", "GSM7804034 r1", "GSM7804034", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_O19_R1.fastq.gz", "fastq", 24908137.0, 579259.0, "GSM7804034 r1", "0:43", "A:6706594;C:5634956;G:5764632;T:6801955;N:0", 43, null, null, null, 6706594, 5634956, 5764632, 6801955, 0, "SRX21885914", "SRS18977039", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.8525, null, 0.23739, null, 0.90694, null, 0.5194, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26605, "SRR26173906", "SRX21885913", "SRS18977038", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 O18 R1", "GSM7804033", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 O18 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804033", "GSM7804033: V2a sample1 353 O18 R1; Danio rerio; RNA Seq", "GSM7804033 r1", "GSM7804033", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_O18_R1.fastq.gz", "fastq", 23328790.0, 542530.0, "GSM7804033 r1", "0:43", "A:6296932;C:5290824;G:5423100;T:6317934;N:0", 43, null, null, null, 6296932, 5290824, 5423100, 6317934, 0, "SRX21885913", "SRS18977038", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.87485, null, 0.19256, null, 0.88422, null, 0.46891, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26606, "SRR26173907", "SRX21885912", "SRS18977037", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 N17 R1", "GSM7804008", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 N17 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804008", "GSM7804008: V2a sample1 353 N17 R1; Danio rerio; RNA Seq", "GSM7804008 r1", "GSM7804008", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_N17_R1.fastq.gz", "fastq", 20379592.0, 473944.0, "GSM7804008 r1", "0:43", "A:5592768;C:4503044;G:4602811;T:5680969;N:0", 43, null, null, null, 5592768, 4503044, 4602811, 5680969, 0, "SRX21885912", "SRS18977037", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.84619, null, 0.24373, null, 0.94095, null, 0.4423, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26607, "SRR26173908", "SRX21885911", "SRS18977035", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 N16 R1", "GSM7804007", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 N16 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804007", "GSM7804007: V2a sample1 353 N16 R1; Danio rerio; RNA Seq", "GSM7804007 r1", "GSM7804007", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_N16_R1.fastq.gz", "fastq", 14151343.0, 329101.0, "GSM7804007 r1", "0:43", "A:3796916;C:3223155;G:3290919;T:3840353;N:0", 43, null, null, null, 3796916, 3223155, 3290919, 3840353, 0, "SRX21885911", "SRS18977035", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.85097, null, 0.21705, null, 0.93097, null, 0.52334, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26608, "SRR26173909", "SRX21885910", "SRS18977036", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 N15 R1", "GSM7804006", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 N15 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804006", "GSM7804006: V2a sample1 353 N15 R1; Danio rerio; RNA Seq", "GSM7804006 r1", "GSM7804006", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_N15_R1.fastq.gz", "fastq", 16536209.0, 384563.0, "GSM7804006 r1", "0:43", "A:4473687;C:3744698;G:3838620;T:4479204;N:0", 43, null, null, null, 4473687, 3744698, 3838620, 4479204, 0, "SRX21885910", "SRS18977036", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.88744, null, 0.19834, null, 0.89966, null, 0.5281, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26609, "SRR26173910", "SRX21885909", "SRS18977034", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 N14 R1", "GSM7804005", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 N14 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804005", "GSM7804005: V2a sample1 353 N14 R1; Danio rerio; RNA Seq", "GSM7804005 r1", "GSM7804005", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_N14_R1.fastq.gz", "fastq", 16039215.0, 373005.0, "GSM7804005 r1", "0:43", "A:4355837;C:3605999;G:3695364;T:4382015;N:0", 43, null, null, null, 4355837, 3605999, 3695364, 4382015, 0, "SRX21885909", "SRS18977034", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.86632, null, 0.22226, null, 0.90268, null, 0.5092, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26610, "SRR26173911", "SRX21885908", "SRS18977033", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 N13 R1", "GSM7804004", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 N13 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804004", "GSM7804004: V2a sample1 353 N13 R1; Danio rerio; RNA Seq", "GSM7804004 r1", "GSM7804004", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_N13_R1.fastq.gz", "fastq", 15280910.0, 355370.0, "GSM7804004 r1", "0:43", "A:4072742;C:3469231;G:3555056;T:4183881;N:0", 43, null, null, null, 4072742, 3469231, 3555056, 4183881, 0, "SRX21885908", "SRS18977033", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.73874, null, 0.31529, null, 0.95988, null, 0.5442, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26611, "SRR26173912", "SRX21885907", "SRS18977032", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 N12 R1", "GSM7804003", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 N12 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804003", "GSM7804003: V2a sample1 353 N12 R1; Danio rerio; RNA Seq", "GSM7804003 r1", "GSM7804003", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_N12_R1.fastq.gz", "fastq", 10529926.0, 244882.0, "GSM7804003 r1", "0:43", "A:2835885;C:2354590;G:2390746;T:2948705;N:0", 43, null, null, null, 2835885, 2354590, 2390746, 2948705, 0, "SRX21885907", "SRS18977032", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.74571, null, 0.36729, null, 0.9443, null, 0.77069, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26612, "SRR26173913", "SRX21885906", "SRS18977030", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 N11 R1", "GSM7804002", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 N11 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804002", "GSM7804002: V2a sample1 353 N11 R1; Danio rerio; RNA Seq", "GSM7804002 r1", "GSM7804002", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_N11_R1.fastq.gz", "fastq", 21706271.0, 504797.0, "GSM7804002 r1", "0:43", "A:5853146;C:4922477;G:5009970;T:5920678;N:0", 43, null, null, null, 5853146, 4922477, 5009970, 5920678, 0, "SRX21885906", "SRS18977030", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.8394, null, 0.23984, null, 0.93468, null, 0.51881, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26613, "SRR26173914", "SRX21885905", "SRS18977031", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 N10 R1", "GSM7804001", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 N10 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7804001", "GSM7804001: V2a sample1 353 N10 R1; Danio rerio; RNA Seq", "GSM7804001 r1", "GSM7804001", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_N10_R1.fastq.gz", "fastq", 22772585.0, 529595.0, "GSM7804001 r1", "0:43", "A:6225918;C:5071489;G:5184079;T:6291099;N:0", 43, null, null, null, 6225918, 5071489, 5184079, 6291099, 0, "SRX21885905", "SRS18977031", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.83486, null, 0.27703, null, 0.92433, null, 0.54887, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26614, "SRR26173915", "SRX21885904", "SRS18977029", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 M9 R1", "GSM7803976", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 M9 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7803976", "GSM7803976: V2a sample1 353 M9 R1; Danio rerio; RNA Seq", "GSM7803976 r1", "GSM7803976", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_M9_R1.fastq.gz", "fastq", 19698730.0, 458110.0, "GSM7803976 r1", "0:43", "A:5282525;C:4494162;G:4591316;T:5330727;N:0", 43, null, null, null, 5282525, 4494162, 4591316, 5330727, 0, "SRX21885904", "SRS18977029", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.8598, null, 0.23744, null, 0.90871, null, 0.52081, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26615, "SRR26173916", "SRX21885903", "SRS18977028", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 M8 R1", "GSM7803975", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 M8 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7803975", "GSM7803975: V2a sample1 353 M8 R1; Danio rerio; RNA Seq", "GSM7803975 r1", "GSM7803975", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_M8_R1.fastq.gz", "fastq", 19646485.0, 456895.0, "GSM7803975 r1", "0:43", "A:5214519;C:4539724;G:4616920;T:5275322;N:0", 43, null, null, null, 5214519, 4539724, 4616920, 5275322, 0, "SRX21885903", "SRS18977028", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.82407, null, 0.22367, null, 0.94298, null, 0.50209, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26616, "SRR26173917", "SRX21885902", "SRS18977025", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 M7 R1", "GSM7803974", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 M7 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7803974", "GSM7803974: V2a sample1 353 M7 R1; Danio rerio; RNA Seq", "GSM7803974 r1", "GSM7803974", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_M7_R1.fastq.gz", "fastq", 7333994.0, 170558.0, "GSM7803974 r1", "0:43", "A:1958042;C:1671444;G:1690497;T:2014011;N:0", 43, null, null, null, 1958042, 1671444, 1690497, 2014011, 0, "SRX21885902", "SRS18977025", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.77392, null, 0.29548, null, 0.95114, null, 0.51367, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"], [26617, "SRR26173918", "SRX21885901", "SRS18977027", "SRP463130", "PRJNA1020854", "Molecular blueprints for spinal circuit modules controlling locomotor speed", "GSE243993", "Transcriptome Analysis", "The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules  yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow  intermediate or fast subtypes. Furthermore  we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall  by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function  connectivity and behavior  our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct  we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.", null, "pubmed:37919423", null, "V2a sample1 353 M6 R1", "GSM7803973", null, "source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing", "V2a sample1 353 M6 R1", "The reads from each sequenced cell were mapped to the zebrafish reference genome \u201cDanio rerio  Ensembl  GRCz11\u201d using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5  R core team  2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis", "Spinal cord", null, "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons", "GSM7803973", "GSM7803973: V2a sample1 353 M6 R1; Danio rerio; RNA Seq", "GSM7803973 r1", "GSM7803973", "1", "Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl  2.9 KCl  2.1 CaCl2  1.2 MgCl2  10 HEPES and 10 glucose  with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line  and two samples were prepared from the Tgchx10:GFP line. For each sample  6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher  #11039021  osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem  #LK003178 on a heated shaker at 37\u00b0C for 15 min. DMEM/F 12 1 ml  280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4\u00b0C for 5 min  and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes  the cell suspension was filtered through a cell 16 strainer 40 \u03bcm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher  #65 0880 92. Using fluorescence activated cell sorting FACs  cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100  2 U/ml RNase inhibitor and immediately snap frozen on ice  then stored at  80\u00b0C. Smart Seq2", null, "RNA-Seq", "TRANSCRIPTOMIC SINGLE CELL", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP463130", null, null, "SS2_18_353_M6_R1.fastq.gz", "fastq", 23546413.0, 547591.0, "GSM7803973 r1", "0:43", "A:6369803;C:5317401;G:5430197;T:6429012;N:0", 43, null, null, null, 6369803, 5317401, 5430197, 6429012, 0, "SRX21885901", "SRS18977027", "SRA1719948", "Neuroscience, Karolinaska Institutet", "Neuroscience, Karolinaska Institutet", 1, 0.85602, null, 0.25223, null, 0.92654, null, 0.5306, null, 43, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "unknown", "sc", "single_cell_plate", "smartseq", null, "Sweden", "2023-09-25", "Juvenile", "Juvenile", "Spinal Cord", "Nervous System"]], "truncated": false, "filtered_table_rows_count": 2089, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.platform\" = :p0 and \"technology\" = :p1 and \"tissue_curation\" = :p2 order by rowid limit 101", "params": {"p0": "ILLUMINA", "p1": "smartseq", "p2": "Spinal Cord"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 2089, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&experiment.library_strategy=RNA-Seq", "selected": false}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "TRANSCRIPTOMIC SINGLE CELL", "label": "TRANSCRIPTOMIC SINGLE CELL", "count": 1535, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&experiment.library_source=TRANSCRIPTOMIC+SINGLE+CELL", "selected": false}, {"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 554, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "cDNA", "label": "cDNA", "count": 2089, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&experiment.library_selection=cDNA", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 2046, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&experiment.library_layout=SINGLE", "selected": false}, {"value": "PAIRED", "label": "PAIRED", "count": 43, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&experiment.library_layout=PAIRED", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 2089, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?technology=smartseq&tissue_curation=Spinal+Cord", "selected": true}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "Juvenile", "label": "Juvenile", "count": 1546, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation_coarse=Juvenile", "selected": false}, {"value": "Larval", "label": "Larval", "count": 394, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation_coarse=Larval", "selected": false}, {"value": "Adult", "label": "Adult", "count": 87, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation_coarse=Adult", "selected": false}, {"value": "Embryo", "label": "Embryo", "count": 40, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation_coarse=Embryo", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 22, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation_coarse=Undetermined", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "Juvenile", "label": "Juvenile", "count": 1546, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation=Juvenile", "selected": false}, {"value": "Larval", "label": "Larval", "count": 394, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation=Larval", "selected": false}, {"value": "Adult", "label": "Adult", "count": 87, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation=Adult", "selected": false}, {"value": "Multi-stage", "label": "Multi-stage", "count": 40, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation=Multi-stage", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 22, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&devstage_curation=Undetermined", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "Nervous System", "label": "Nervous System", "count": 2089, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&tissue_curation_coarse=Nervous+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "Spinal Cord", "label": "Spinal Cord", "count": 2089, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord", "results": [{"value": "smartseq", "label": "smartseq", "count": 2089, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&tissue_curation=Spinal+Cord", "selected": true}], "truncated": false}}, "suggested_facets": [], "next": "26617", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.platform=ILLUMINA&technology=smartseq&tissue_curation=Spinal+Cord&_next=26617", "private": false, "allow_execute_sql": true, "query_ms": 80.67066900548525}