{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_strategy = \"ncRNA-Seq\" and tissue_curation = \"Oocyte\"", "rows": [[25293, "SRR25764131", "SRX21486791", "SRS18719090", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points  namelyat the 256 cell 2.5 hpf  1000 cell 3 hpf  sphere 4 hpf  shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis  polysome profiling  ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT egg 0 hpf tRNA seq rep2", "GSM7734772", null, "source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT egg 0 hpf tRNA seq rep2", "Read demultiplexing and adapter trimming performed with cutadapt v3.5  where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained  and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters   species Drer   cluster id 0.93   min cov 0.001   max mismatches 0.075   control condition Egg   deconv cov ratio 0.4   remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters  and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Unfertilized egg", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4  100 mM LiCl  2 mM EDTA  5 mM DTT  pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021  2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT", "GSM7734772", "GSM7734772: WT egg 0 hpf tRNA seq rep2; Danio rerio; ncRNA Seq", "GSM7734772 r1", "GSM7734772", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4  100 mM LiCl  2 mM EDTA  5 mM DTT  pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021  2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_egg_2.fastq.gz", "fastq", 206374994.0, 3181706.0, "GSM7734772 r1", "0:64.86", "A:41195250;C:56578032;G:56479855;T:52121365;N:492", 64, null, null, null, 41195250, 56578032, 56479855, 52121365, 492, "SRX21486791", "SRS18719090", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.28659, null, 0.02017, null, 0.9207, null, 0.48536, null, 78, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [25294, "SRR25764132", "SRX21486790", "SRS18719089", "SRP457111", "PRJNA1009808", "Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq]", "GSE241754", "Transcriptome Analysis", "Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points  namelyat the 256 cell 2.5 hpf  1000 cell 3 hpf  sphere 4 hpf  shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis  polysome profiling  ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.", "parent bioproject:PRJNA1009800", "pubmed:39402326", null, "WT egg 0 hpf tRNA seq rep1", "GSM7734771", null, "source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing", "WT egg 0 hpf tRNA seq rep1", "Read demultiplexing and adapter trimming performed with cutadapt v3.5  where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained  and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5\u2019 RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters   species Drer   cluster id 0.93   min cov 0.001   max mismatches 0.075   control condition Egg   deconv cov ratio 0.4   remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters  and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts", "Unfertilized egg", "unperturbed growth conditions in E3 medium for zebrafish embryos.", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4  100 mM LiCl  2 mM EDTA  5 mM DTT  pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021  2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", "Embryos were grown in standard housing conditions namely28\u00b0C at a 14/10 hour light/dark cycle.", "strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT", "GSM7734771", "GSM7734771: WT egg 0 hpf tRNA seq rep1; Danio rerio; ncRNA Seq", "GSM7734771 r1", "GSM7734771", "1", "50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4  100 mM LiCl  2 mM EDTA  5 mM DTT  pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021  2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq", null, "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "NextSeq 500", null, "SRP457111", null, null, "WT_tRNA_egg_1.fastq.gz", "fastq", 86021968.0, 1304769.0, "GSM7734771 r1", "0:65.93", "A:17511521;C:23474625;G:23300759;T:21734864;N:199", 65, null, null, null, 17511521, 23474625, 23300759, 21734864, 199, "SRX21486790", "SRS18719089", "SRA1700461", "Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry", "Max Planck Institute of Biochemistry", 1, 0.29829, null, 0.02027, null, 0.92245, null, 0.48877, null, 74, null, "B", null, "usable mapping rate", "illumina", "nextseq", "5prime", "size_fractionation", "unknown", "bulk", "unknown", "unknown", null, "Germany", "2023-08-28", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44969, "SRR6345658", "SRX3442974", "SRS2733632", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of late oocytes from tdrd6a hett fish", "GSM2875717", null, "source name:late oocytes from tdrd6a hett fish|tissue:late oocytes|genotype:tdrd6a heterozygous", "smRNA seq library of late oocytes from tdrd6a hett fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "late oocytes from tdrd6a hett fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:late oocytes|genotype:tdrd6a heterozygous", "GSM2875717", "GSM2875717: smRNA seq library of late oocytes from tdrd6a hett fish; Danio rerio; ncRNA Seq", "GSM2875717", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875717", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-het_oocytes-late-input.fastq.gz", "fastq", 1884769630.0, 28130890.0, "GSM2875717 r1", "0:67", "A:519051884;C:437635381;G:510738306;T:417295309;N:48750", 67, null, null, null, 519051884, 437635381, 510738306, 417295309, 48750, "SRX3442974", "SRS2733632", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.17778, null, 0.06655, null, 0.95931, null, 0.91529, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44970, "SRR6345657", "SRX3442973", "SRS2733634", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of early oocytes from tdrd6a mut fish", "GSM2875716", null, "source name:early oocytes from tdrd6a mut fish|tissue:early oocytes|genotype:tdrd6a mutant", "smRNA seq library of early oocytes from tdrd6a mut fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "early oocytes from tdrd6a mut fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:early oocytes|genotype:tdrd6a mutant", "GSM2875716", "GSM2875716: smRNA seq library of early oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq", "GSM2875716", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875716", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-mut_oocytes-early-input.fastq.gz", "fastq", 2102216723.0, 31376369.0, "GSM2875716 r1", "0:67", "A:592618102;C:472348913;G:550028898;T:487165955;N:54855", 67, null, null, null, 592618102, 472348913, 550028898, 487165955, 54855, "SRX3442973", "SRS2733634", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.08293, null, 0.04595, null, 0.96193, null, 0.77321, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44971, "SRR6345656", "SRX3442972", "SRS2733635", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of late oocytes from tdrd6a mut fish", "GSM2875715", null, "source name:late oocytes from tdrd6a mut fish|tissue:late oocytes|genotype:tdrd6a mutant", "smRNA seq library of late oocytes from tdrd6a mut fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "late oocytes from tdrd6a mut fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:late oocytes|genotype:tdrd6a mutant", "GSM2875715", "GSM2875715: smRNA seq library of late oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq", "GSM2875715", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875715", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-mut_oocytes-late-input.fastq.gz", "fastq", 2110760295.0, 31503885.0, "GSM2875715 r1", "0:67", "A:582021495;C:486821539;G:582933348;T:458929133;N:54780", 67, null, null, null, 582021495, 486821539, 582933348, 458929133, 54780, "SRX3442972", "SRS2733635", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.17064, null, 0.06728, null, 0.96173, null, 0.9114, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [44972, "SRR6345655", "SRX3442971", "SRS2733633", "SRP126106", "PRJNA421016", "Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA]", "GSE107682", "Transcriptome Analysis", "Germ plasm  the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First  Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs  without xxx effects on piRNA biogenesis signatures. Second  we show that Tdrd6a is required for Balbiani body and germ plasm integrity  and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level  maternally contributed Tdrd6a strongly impacts germ cell formation  but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.", "parent bioproject:PRJNA315403", "pubmed:30086300", null, "smRNA seq library of early oocytes from tdrd6a het fish", "GSM2875714", null, "source name:early oocytes from tdrd6a het fish|tissue:Early oocytes|genotype:tdrd6a heterozygous", "smRNA seq library of early oocytes from tdrd6a het fish", "1. Adapter trimming with cutadapt  O 8  m 26  M 38  a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter   q 20  p 100  Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end  using a custom bash script. 4. UMIs were trimmed with seqtk trimfq  b 4  a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq  L 15\u00a0 6. Mapping was done to Zebrafish  Danio rerio  genome assembly Zv9 with bowtie v0.12.8   tryhard   best   strata   chunkmbs 256  v 1  M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed  bg  split  scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.\u00a0 \u00a0 8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE  SINE  LTR and DNA downloaded from the UCSC genome browser repeat masker track  Zv9 using bedtools intersect  a reads  b transposons  wa  wb  bed  f 1.0  nonamecheck to keep both the read and the transposon information. The arguments  s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re  start re  end re  repFamily  repName strand re  and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons  and readlength the length of the read that. Sample is the sample name  and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.\u00a0 Supplementary files format and content: Files ending in .bw are bigwig tracks.", "early oocytes from tdrd6a het fish", null, "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", null, "tissue:Early oocytes|genotype:tdrd6a heterozygous", "GSM2875714", "GSM2875714: smRNA seq library of early oocytes from tdrd6a het fish; Danio rerio; ncRNA Seq", "GSM2875714", null, "1", "RNA was extracted from ovary tissue  as indicated  by Trizol extraction. Standard smRNA seq library preperation", "GEO Accession:GSM2875714", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "SRP126106", null, null, "tdrd6a-het_oocytes-early-input.fastq.gz", "fastq", 2243425655.0, 33483965.0, "GSM2875714 r1", "0:67", "A:633468129;C:503239215;G:592089295;T:514571679;N:57337", 67, null, null, null, 633468129, 503239215, 592089295, 514571679, 57337, "SRX3442971", "SRS2733633", "SRA636010", "GEO", "Rene Ketting, RNA silencing, IMB", 1, 0.06641, null, 0.04254, null, 0.96806, null, 0.58509, null, 67, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "5prime", "size_fractionation", "unknown", "sc_generic", "single_cell_generic", "generic-scrnaseq-only", null, "Germany", "2017-12-04", "Zygote", "Embryo", "Oocyte", "Reproductive System"], [58547, "SRR13652350", "SRX10049113", "SRS8212340", "SRP253438", "PRJNA613601", "five prime half of specific tRNAs feeds back to promote corresponding tRNA gene transcription in vertebrate embryos [small RNA Seq  ssDRIP seq]", "GSE147253", "Other", "five primetRFls are small tRNA fragments derived from five prime half of mature tRNAs. However  it is unknown whether five primetRFls could feed back to regulate tRNA biogenesis. Here we show that five primetRFlGly/GCC and five primetRFlGlu/CTC function to promote transcription of corresponding tRNA genes and are essential for vertebrate early embryogenesis. During zebrafish embryogenesis  dynamics of five primetRFlGly/GCC and five primetRFlGlu/CTC levels correlates with that of tRNAGly/GCC and tRNAGlu/CTC levels. Morpholino mediated knockdown of five primetRFlGly/GCC or five primetRFlGlu/CTC down regulates tRNAGly/GCC or tRNAGlu/CTC levels respectively  and causes embryonic lethality that is efficiently rescued by co injection of properly refolded corresponding tRNA. In zebrafish embryos  tRNA:DNA and five primetRFl:DNA hybrids commonly exist on the template strand of tRNA genes. Mechanistically  unstable five primetRFl:DNA hybrid may prevent the formation of transcriptionally inhibitory stable tRNA:DNA hybrids on the same tRNA loci so as to facilitate tRNA genes transcription. The uncovered mechanism may be implicated in other physiological and pathological processes. Overall design: For small RNA sequencing   total RNA were extracted respectively from wildtype zebrafish embryos T\u00fcbingen Strain of 6 chosen stages  and then subjected to small RNA library preparation individually. To investigate the distribution and stability of R loop on genome  we performed ssDRIP seq with S9.6 antibody  which specifically recognize RNA:DNA hybrid.  Two replicates from wildtype embryos of 256c  sphere and shield stage were collected to perform ssDRIPseq. RNaseH pre treated genome DNA was used as negative control  which was also performed the standard ssDRIP seq procedure. Genomic DNA extracted from these samples were fragmentated by restriction enzymes  and then immunoprecipitated by S9.6 antibody.The ssDNA strands in RNA:DNA hybrids were purified and subjected to library preparation.", "parent bioproject:PRJNA753013", "pubmed:34797706", null, "Egg ncRNA seq", "GSM5069280", null, "tissue:mature oocyte|strain:Tubingen|developmental stage:Mature Oocyte|treatement:no", "Egg ncRNA seq", "For data processing  reads were quality checked by FastQCVersion 0.11.8  and adaptors were cut off by Cutadapt Version 1.16  and only reads that lay between 18 40 nt were kept. The reads of each sample were first aligned to different database by using Bowtie2  Version 2.3.4.1  count table was generated by featureCounts. Genome build: GRCz11 genome and cDNA   tRNA database GtRNAdb  GRCz11", "mature oocyte", null, "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube  and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific  15596018. The lysate was centrifuged at 12 000 rpm for 10 min  and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103  the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min  followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at  80\u2103 until all samples were collected. Two pretreatment steps were included: First  purified total RNAs were treated with T4 Polynucleotide Kinase NEB  M0201S with ATP for 30 min at 37\u2103  then purified by phenol: chloroform extraction. The aim of this step is removing the 2 3\u2019 cyclic phosphate group from the 3\u2019end of 5\u2019tRFls  and add phosphate group to the 5\u2019end of 3\u2019tRFs. In the second step  total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing:  Small RNA libraries  using 1 \u03bcg RNA each  were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research  then bands of 135 160 bp  about the length of 15 40 nt RNA ligated with both adaptors  were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc  pH 4.5  followed by precipitation by adding 2.5 volumes of ethanol.", null, "strain:Tubingen|developmental stage:Mature Oocyte|treatement:no", "GSM5069280", "GSM5069280: Egg ncRNA seq; Danio rerio; ncRNA Seq", "GSM5069280", null, "1", "For small RNA sequencing: About 50 100 zebrafish eggs or embryos at a desired stage were dechorionated by Pronase digestion and collected to extract total RNA. Embryos were then transferred to 1.5 ml eppendorf tube  and lysed in 1 ml Trizol Reagent Thermo Fisher Scientific  15596018. The lysate was centrifuged at 12 000 rpm for 10 min  and the supernatant was collected and mixed with 200 \u03bcl chloroform in a fresh tube. post centrifugation at 12 000 rpm for 10 min at 4\u2103  the supernatant was transferred to a fresh tube with addition of equal volume of isopropanol and incubated at room temperature for 15 min  followed by thorough mix and centrifugation at 12 000 rpm for 10 20 min. The RNA pellet was washed by 75% ethanol once and was stored as pellet in 75% ethanol at  80\u2103 until all samples were collected. Two pretreatment steps were included: First  purified total RNAs were treated with T4 Polynucleotide Kinase NEB  M0201S with ATP for 30 min at 37\u2103  then purified by phenol: chloroform extraction. The aim of this step is removing the 2 three prime cyclic phosphate group from the three primeend of five primetRFls  and add phosphate group to the five primeend of three primetRFs. In the second step  total RNAs were treated with ALKB protein mix as mentioned above. Purified total RNAs were then subjected to small RNA library preparation. For small RNA sequencing:  Small RNA libraries  using 1 \u03bcg RNA each  were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina NEB according to the manual. The amplified DNA from each sample was first concentrated by DNA concentrator spin column Zymo Research  then bands of 135 160 bp  about the length of 15 40 nt RNA ligated with both adaptors  were manually selected on native PAGE gel. DNAs were eluted from the gel piece with 0.3 M NaOAc  pH 4.5  followed by precipitation by adding 2.5 volumes of ethanol.", "GEO Accession:GSM5069280", "ncRNA-Seq", "TRANSCRIPTOMIC", "size fractionation", "SINGLE", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP253438", null, null, "Egg-RNA_seq.fq.gz", "fastq", 4328292000.0, 28855280.0, "GSM5069280 r1", "0:150 1:0", "A:757944111;C:789419055;G:2112325298;T:668359520;N:244016", 150, 0, null, null, 757944111, 789419055, 2112325298, 668359520, 244016, "SRX10049113", "SRS8212340", "SRA1056877", "GEO", "Anming Meng Lab, School of Life Science, Tsinghua University", 1, 0.74704, null, 0.18839, null, 0.83197, null, 0.55802, null, 150, null, "B", null, "usable mapping rate", "illumina", "novaseq_era", "5prime", "size_fractionation", "nebnext", "bulk", "unknown", "unknown", null, "China", "2021-02-08", "Zygote", "Embryo", "Oocyte", "Reproductive System"]], "truncated": false, "filtered_table_rows_count": 7, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_strategy\" = :p0 and \"tissue_curation\" = :p1 order by rowid limit 101", "params": {"p0": "ncRNA-Seq", "p1": "Oocyte"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte", "results": [{"value": "ncRNA-Seq", "label": "ncRNA-Seq", "count": 7, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?tissue_curation=Oocyte", "selected": true}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 7, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte&experiment.library_source=TRANSCRIPTOMIC", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte", "results": [{"value": "size fractionation", "label": "size fractionation", "count": 7, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte&experiment.library_selection=size+fractionation", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 7, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte&experiment.library_layout=SINGLE", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 7, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte", "results": [{"value": "Embryo", "label": "Embryo", "count": 7, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte&devstage_curation_coarse=Embryo", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte", "results": [{"value": "Zygote", "label": "Zygote", "count": 7, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte&devstage_curation=Zygote", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte", "results": [{"value": "Reproductive System", "label": "Reproductive System", "count": 7, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte&tissue_curation_coarse=Reproductive+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte", "results": [{"value": "Oocyte", "label": "Oocyte", "count": 7, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte", "results": [{"value": "generic-scrnaseq-only", "label": "generic-scrnaseq-only", "count": 4, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte&technology=generic-scrnaseq-only", "selected": false}, {"value": "unknown", "label": "unknown", "count": 3, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=ncRNA-Seq&tissue_curation=Oocyte&technology=unknown", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 86.6046620067209}