{"database": "metadata", "table": "run_metadata", "is_view": false, "human_description_en": "where experiment.library_strategy = \"RNA-Seq\" and tissue_curation = \"Pancreas\"", "rows": [[321, "ERR977589", "ERX1054572", "ERS805778", "ERP011346", "PRJEB10140", "RNAseq from the pancreatic acinar  alpha  beta and delta cells from zebrafish", "ena-STUDY-GIGA-R, University of Liege-05-08-2015-10:47:24:447-55", "Other", "We took advantage of zebrafish transgenic tools to isolate by FACS the major pancreatic cell types and obtain pure preparations of endocrine a   \u00df  and d cells as well as exocrine acinar and ductal cells.", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2017 01 31", null, "Beta cells from adults purified by FACS", "Delta cells R3", "SAMEA3498629", "GIGA-R, University of Liege", "ENA first public:2017 01 31|ENA last update:2015 08 05|External Id:SAMEA3498629|INSDC center alias:GIGA R  University of Liege|INSDC center name:GIGA R  University of Liege|INSDC first public:2017 01 31T17:01:11Z|INSDC last update:2015 08 05T16:56:59Z|INSDC status:public|Submitter Id:34|cell type:Pancreatic Delta cells|collected by:Estefania Tarife\u00f1o Saldivia|common name:zebrafish|dev stage:Adult|isolate:Tgsst2:GFP|lab host:ZDDM|sample name:34", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "ena EXPERIMENT GIGA R  University of Liege 05 08 2015 16:56:42:489 14", "Delta R3", "1", "Truseq DNA Sample prep", null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP011346", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2018 11 16", "NGS14-B176_SSTcells-03122013_CAGATC_L001_R1_001.fastq.gz NGS14-B176_SSTcells-03122013_CAGATC_L001_R2_001.fastq.gz", "fastq fastq", 17691597128.0, 87582164.0, "ena RUN GIGA R  University of Liege 05 08 2015 16:56:42:489 14", "0:101 1:101", "A:4843643109;C:3683816237;G:3736882877;T:5332210638;N:95044267", 101, 101, null, null, 4843643109, 3683816237, 3736882877, 5332210638, 95044267, "ERX1054572", "ERS805778", "ERA463595", "GIGA-R, University of Liege|European Nucleotide Archive", "GIGA-R, University of Liege", 2, 0.92685, 0.84146, 0.10249, 0.11723, 0.76532, 0.78309, 0.39721, 0.43714, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2015-08-05", "Adult", "Adult", "Pancreas", "Endocrine System"], [330, "ERR977580", "ERX1054563", "ERS805769", "ERP011346", "PRJEB10140", "RNAseq from the pancreatic acinar  alpha  beta and delta cells from zebrafish", "ena-STUDY-GIGA-R, University of Liege-05-08-2015-10:47:24:447-55", "Other", "We took advantage of zebrafish transgenic tools to isolate by FACS the major pancreatic cell types and obtain pure preparations of endocrine a   \u00df  and d cells as well as exocrine acinar and ductal cells.", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2017 01 31", null, "Beta cells from adults purified by FACS", "Beta cells R3", "SAMEA3498620", "GIGA-R, University of Liege", "ENA first public:2017 01 31|ENA last update:2015 08 05|External Id:SAMEA3498620|INSDC center alias:GIGA R  University of Liege|INSDC center name:GIGA R  University of Liege|INSDC first public:2017 01 31T17:01:11Z|INSDC last update:2015 08 05T16:56:59Z|INSDC status:public|Submitter Id:25|cell type:Pancreatic Beta cells|collected by:Estefania Tarife\u00f1o Saldivia|common name:zebrafish|dev stage:Adult|isolate:Tgins:GFP|lab host:ZDDM|sample name:25", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "ena EXPERIMENT GIGA R  University of Liege 05 08 2015 16:56:42:487 5", "Beta R3", "1", "Truseq DNA Sample prep", null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP011346", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2018 11 16", "NGS14-B174_Betacells-03122013_GCCAAT_L002_R1_001.fastq.gz NGS14-B174_Betacells-03122013_GCCAAT_L002_R2_001.fastq.gz", "fastq fastq", 17625660086.0, 87255743.0, "ena RUN GIGA R  University of Liege 05 08 2015 16:56:42:487 5", "0:101 1:101", "A:4840276660;C:3724973884;G:3755195525;T:5214977933;N:90236084", 101, 101, null, null, 4840276660, 3724973884, 3755195525, 5214977933, 90236084, "ERX1054563", "ERS805769", "ERA463595", "GIGA-R, University of Liege|European Nucleotide Archive", "GIGA-R, University of Liege", 2, 0.90631, 0.8718, 0.11791, 0.11942, 0.76203, 0.77638, 0.53654, 0.49457, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2015-08-05", "Adult", "Adult", "Pancreas", "Endocrine System"], [331, "ERR977579", "ERX1054562", "ERS805768", "ERP011346", "PRJEB10140", "RNAseq from the pancreatic acinar  alpha  beta and delta cells from zebrafish", "ena-STUDY-GIGA-R, University of Liege-05-08-2015-10:47:24:447-55", "Other", "We took advantage of zebrafish transgenic tools to isolate by FACS the major pancreatic cell types and obtain pure preparations of endocrine a   \u00df  and d cells as well as exocrine acinar and ductal cells.", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2017 01 31", null, "Beta cells from adults purified by FACS", "Beta cells R2 2", "SAMEA3498619", "GIGA-R, University of Liege", "ENA first public:2017 01 31|ENA last update:2015 08 05|External Id:SAMEA3498619|INSDC center alias:GIGA R  University of Liege|INSDC center name:GIGA R  University of Liege|INSDC first public:2017 01 31T17:01:11Z|INSDC last update:2015 08 05T16:56:59Z|INSDC status:public|Submitter Id:24|cell type:Pancreatic Beta cells|collected by:Estefania Tarife\u00f1o Saldivia|common name:zebrafish|dev stage:Adult|isolate:Tgins:GFP|lab host:ZDDM|sample name:24", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "ena EXPERIMENT GIGA R  University of Liege 05 08 2015 16:56:42:487 4", "Beta R2 2", "1", "Truseq DNA Sample prep", null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP011346", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2018 11 16", "BetaCell2_A026_ATGTCA_L004_R1_001.fastq.gz BetaCell2_A026_ATGTCA_L004_R2_001.fastq.gz", "fastq fastq", 8532015198.0, 42237699.0, "ena RUN GIGA R  University of Liege 05 08 2015 16:56:42:487 4", "0:101 1:101", "A:2314776471;C:1823939144;G:1839244845;T:2552984556;N:1070182", 101, 101, null, null, 2314776471, 1823939144, 1839244845, 2552984556, 1070182, "ERX1054562", "ERS805768", "ERA463595", "GIGA-R, University of Liege|European Nucleotide Archive", "GIGA-R, University of Liege", 2, 0.69844, 0.57999, 0.09124, 0.07501, 0.80876, 0.82964, 0.56023, 0.5159, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2015-08-05", "Adult", "Adult", "Pancreas", "Endocrine System"], [332, "ERR977578", "ERX1054561", "ERS805767", "ERP011346", "PRJEB10140", "RNAseq from the pancreatic acinar  alpha  beta and delta cells from zebrafish", "ena-STUDY-GIGA-R, University of Liege-05-08-2015-10:47:24:447-55", "Other", "We took advantage of zebrafish transgenic tools to isolate by FACS the major pancreatic cell types and obtain pure preparations of endocrine a   \u00df  and d cells as well as exocrine acinar and ductal cells.", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2017 01 31", null, "Beta cells from adults purified by FACS", "Beta cells R2 1", "SAMEA3498618", "GIGA-R, University of Liege", "ENA first public:2017 01 31|ENA last update:2015 08 05|External Id:SAMEA3498618|INSDC center alias:GIGA R  University of Liege|INSDC center name:GIGA R  University of Liege|INSDC first public:2017 01 31T17:01:11Z|INSDC last update:2015 08 05T16:56:59Z|INSDC status:public|Submitter Id:23|cell type:Pancreatic Beta cells|collected by:Estefania Tarife\u00f1o Saldivia|common name:zebrafish|dev stage:Adult|isolate:Tgins:GFP|lab host:ZDDM|sample name:23", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "ena EXPERIMENT GIGA R  University of Liege 05 08 2015 16:56:42:487 3", "Beta R2 1", "1", "Truseq DNA Sample prep", null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP011346", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2018 11 16", "BetaCell_ATGTCA_L005_R1_001.fastq.gz BetaCell_ATGTCA_L005_R2_001.fastq.gz", "fastq fastq", 3250611068.0, 16092134.0, "ena RUN GIGA R  University of Liege 05 08 2015 16:56:42:487 3", "0:101 1:101", "A:854826460;C:691024995;G:695294721;T:954934438;N:54530454", 101, 101, null, null, 854826460, 691024995, 695294721, 954934438, 54530454, "ERX1054561", "ERS805767", "ERA463595", "GIGA-R, University of Liege|European Nucleotide Archive", "GIGA-R, University of Liege", 2, 0.67496, 0.53873, 0.08771, 0.06606, 0.80969, 0.83433, 0.56231, 0.51717, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2015-08-05", "Adult", "Adult", "Pancreas", "Endocrine System"], [333, "ERR977577", "ERX1054560", "ERS805766", "ERP011346", "PRJEB10140", "RNAseq from the pancreatic acinar  alpha  beta and delta cells from zebrafish", "ena-STUDY-GIGA-R, University of Liege-05-08-2015-10:47:24:447-55", "Other", "We took advantage of zebrafish transgenic tools to isolate by FACS the major pancreatic cell types and obtain pure preparations of endocrine a   \u00df  and d cells as well as exocrine acinar and ductal cells.", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2017 01 31", null, "Beta cells from adults purified by FACS", "Beta cells R1 2", "SAMEA3498617", "GIGA-R, University of Liege", "ENA first public:2017 01 31|ENA last update:2015 08 05|External Id:SAMEA3498617|INSDC center alias:GIGA R  University of Liege|INSDC center name:GIGA R  University of Liege|INSDC first public:2017 01 31T17:01:11Z|INSDC last update:2015 08 05T16:56:59Z|INSDC status:public|Submitter Id:22|cell type:Pancreatic Beta cells|collected by:Estefania Tarife\u00f1o Saldivia|common name:zebrafish|dev stage:Adult|isolate:Tgins:GFP|lab host:ZDDM|sample name:22", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "ena EXPERIMENT GIGA R  University of Liege 05 08 2015 16:56:42:487 2", "Beta R1 2", "1", "Truseq DNA Sample prep", null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP011346", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2018 11 16", "BetaCell1_A003_GTCCGC_L004_R1_001.fastq.gz BetaCell1_A003_GTCCGC_L004_R2_001.fastq.gz", "fastq fastq", 3765102038.0, 18639119.0, "ena RUN GIGA R  University of Liege 05 08 2015 16:56:42:487 2", "0:101 1:101", "A:1050226787;C:789381360;G:801049952;T:1123973291;N:470648", 101, 101, null, null, 1050226787, 789381360, 801049952, 1123973291, 470648, "ERX1054560", "ERS805766", "ERA463595", "GIGA-R, University of Liege|European Nucleotide Archive", "GIGA-R, University of Liege", 2, 0.90456, 0.86125, 0.12934, 0.13194, 0.77721, 0.79109, 0.56708, 0.53213, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2015-08-05", "Adult", "Adult", "Pancreas", "Endocrine System"], [334, "ERR977576", "ERX1054559", "ERS805765", "ERP011346", "PRJEB10140", "RNAseq from the pancreatic acinar  alpha  beta and delta cells from zebrafish", "ena-STUDY-GIGA-R, University of Liege-05-08-2015-10:47:24:447-55", "Other", "We took advantage of zebrafish transgenic tools to isolate by FACS the major pancreatic cell types and obtain pure preparations of endocrine a   \u00df  and d cells as well as exocrine acinar and ductal cells.", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2017 01 31", null, "Beta cells from adults purified by FACS", "Beta cells R1 1", "SAMEA3498616", "GIGA-R, University of Liege", "ENA first public:2017 01 31|ENA last update:2015 08 05|External Id:SAMEA3498616|INSDC center alias:GIGA R  University of Liege|INSDC center name:GIGA R  University of Liege|INSDC first public:2017 01 31T17:01:11Z|INSDC last update:2015 08 05T16:56:59Z|INSDC status:public|Submitter Id:21|cell type:Pancreatic Beta cells|collected by:Estefania Tarife\u00f1o Saldivia|common name:zebrafish|dev stage:Adult|isolate:Tgins:GFP|lab host:ZDDM|sample name:21", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 paired end sequencing", "ena EXPERIMENT GIGA R  University of Liege 05 08 2015 16:56:42:486 1", "Beta R1 1", "1", "Truseq DNA Sample prep", null, "RNA-Seq", "TRANSCRIPTOMIC", "Oligo-dT", "PAIRED", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP011346", "Illumina HiSeq 2000 paired end sequencing", "ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2018 11 16", "BetaCells_30000_GTCCGC_L008_R1_001.fastq.gz BetaCells_30000_GTCCGC_L008_R2_001.fastq.gz", "fastq fastq", 10597717092.0, 52463946.0, "ena RUN GIGA R  University of Liege 05 08 2015 16:56:42:486 1", "0:101 1:101", "A:2951812422;C:2213949786;G:2252957090;T:3178649938;N:347856", 101, 101, null, null, 2951812422, 2213949786, 2252957090, 3178649938, 347856, "ERX1054559", "ERS805765", "ERA463595", "GIGA-R, University of Liege|European Nucleotide Archive", "GIGA-R, University of Liege", 2, 0.90302, 0.84857, 0.12843, 0.12749, 0.77745, 0.79157, 0.56129, 0.52011, 101, 101, "B", "B", "biological fallback assumption", "illumina", "hiseq_era", "unknown", "poly_a", "trueseq", "bulk", "unknown", "unknown", null, "Belgium", "2015-08-05", "Adult", "Adult", "Pancreas", "Endocrine System"], [10002, "ERR6806875", "ERX6430468", "ERS5060069", "ERP123913", "PRJEB40292", "Multidimensional chromatin profiling of zebrafish and human pancreas to uncover and validate disease related enhancers", "ena-STUDY-I3S-10-09-2020-08:12:35:299-4", "Other", "The pancreas is a central organ for human diseases. Most disease associated alleles overlap with non coding cis regulatory elements of DNA  suggesting that alterations in regulatory sequences contribute to pancreatic diseases. However  the interspecies identification of equivalent cis regulatory elements required for in vivo testing face fundamental challenges  including lack of sequence conservation. In this work  we performed a combined analysis of ATAC seq  ChIP seq  4C seq and HiChIP seq data from zebrafish and human pancreatic cells to identify interspecies functionally equivalent cis regulatory elements  regardless of sequence conservation. To link cis regulation with the expression of target genes in the pancreas  we additionally integrated in our analysis own and public RNA seq data from zebrafish pancreatic cell types. Among several disease associated sequences  we identified a zebrafish ptf1a distal enhancer whose deletion generates pancreatic agenesis  demonstrating the causality of this condition in humans. Our results further demonstrate that this phenotype is a consequence of loss of pancreas progenitor cells. Overall  we show that chromatin profiling can uncover interspecies functional equivalency of cis regulatory elements  contributing to the prediction of new disease causative enhancers and their role in human disease.", "ChIP seq  ATAC seq  HiChIP seq  4C seq  RNA seq|chromatin accessibility|cis regulatory mutations|pancreas and pancreatic diseases|transcriptional enhancers|ENA FIRST PUBLIC:2020 09 11|ENA LAST UPDATE:2021 09 22", null, "Adult zebrafish whole pancreas RNA seq replicate2 raw reads", "Zebrafish Whole Pancreas RNA seq replicate2", "SAMEA7301510", "I3S", "ENA first public:2021 09 23|ENA last update:2021 09 23|External Id:SAMEA7301510|INSDC center alias:I3S|INSDC center name:I3S|INSDC first public:2021 09 23T20:37:00Z|INSDC last update:2021 09 23T20:37:00Z|INSDC status:public|Submitter Id:Zebrafish Whole Pancreas RNA seq replicate2|common name:zebrafish|sample name:Zebrafish Whole Pancreas RNA seq replicate2|tissue type:whole pancreas", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing", "ena EXPERIMENT I3S 23 09 2021 16:43:09:330 6", "Exocrine2", "1", "Total RNA extracted with TRIZOL from zebrafish whole pancreas and preprared for sequencing with the TruSeq kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP123913", "Illumina HiSeq 2000 sequencing", "ENA FIRST PUBLIC:2021 09 23|ENA LAST UPDATE:2021 09 23", "Exocrine_Old_1.fastq.gz", "fastq", 1715678250.0, 34313565.0, "ena RUN I3S 23 09 2021 16:43:09:330 6", "0:50 1:0", "A:423211245;C:429948631;G:413857387;T:448546996;N:113991", 50, 0, null, null, 423211245, 429948631, 413857387, 448546996, 113991, "ERX6430468", "ERS5060069", "ERA6385885", "I3S|European Nucleotide Archive", "I3S", 1, 0.94581, null, 0.03181, null, 0.80026, null, 0.48102, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Portugal", "2020-09-11", "Adult", "Adult", "Pancreas", "Endocrine System"], [10003, "ERR6806874", "ERX6430467", "ERS5060068", "ERP123913", "PRJEB40292", "Multidimensional chromatin profiling of zebrafish and human pancreas to uncover and validate disease related enhancers", "ena-STUDY-I3S-10-09-2020-08:12:35:299-4", "Other", "The pancreas is a central organ for human diseases. Most disease associated alleles overlap with non coding cis regulatory elements of DNA  suggesting that alterations in regulatory sequences contribute to pancreatic diseases. However  the interspecies identification of equivalent cis regulatory elements required for in vivo testing face fundamental challenges  including lack of sequence conservation. In this work  we performed a combined analysis of ATAC seq  ChIP seq  4C seq and HiChIP seq data from zebrafish and human pancreatic cells to identify interspecies functionally equivalent cis regulatory elements  regardless of sequence conservation. To link cis regulation with the expression of target genes in the pancreas  we additionally integrated in our analysis own and public RNA seq data from zebrafish pancreatic cell types. Among several disease associated sequences  we identified a zebrafish ptf1a distal enhancer whose deletion generates pancreatic agenesis  demonstrating the causality of this condition in humans. Our results further demonstrate that this phenotype is a consequence of loss of pancreas progenitor cells. Overall  we show that chromatin profiling can uncover interspecies functional equivalency of cis regulatory elements  contributing to the prediction of new disease causative enhancers and their role in human disease.", "ChIP seq  ATAC seq  HiChIP seq  4C seq  RNA seq|chromatin accessibility|cis regulatory mutations|pancreas and pancreatic diseases|transcriptional enhancers|ENA FIRST PUBLIC:2020 09 11|ENA LAST UPDATE:2021 09 22", null, "Adult zebrafish whole pancreas RNA seq replicate1 raw reads", "Zebrafish Whole Pancreas RNA seq replicate1", "SAMEA7301509", "I3S", "ENA first public:2021 09 23|ENA last update:2021 09 23|External Id:SAMEA7301509|INSDC center alias:I3S|INSDC center name:I3S|INSDC first public:2021 09 23T20:37:00Z|INSDC last update:2021 09 23T20:37:00Z|INSDC status:public|Submitter Id:Zebrafish Whole Pancreas RNA seq replicate1|common name:zebrafish|sample name:Zebrafish Whole Pancreas RNA seq replicate1|tissue type:whole pancreas", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing", "ena EXPERIMENT I3S 23 09 2021 16:43:09:330 5", "Exocrine1", "1", "Total RNA extracted with TRIZOL from zebrafish whole pancreas and preprared for sequencing with the TruSeq kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP123913", "Illumina HiSeq 2000 sequencing", "ENA FIRST PUBLIC:2021 09 23|ENA LAST UPDATE:2021 09 23", "Exocrine_Young_1.fastq.gz", "fastq", 1751070500.0, 35021410.0, "ena RUN I3S 23 09 2021 16:43:09:330 5", "0:50 1:0", "A:412303526;C:454121976;G:438481251;T:446048184;N:115563", 50, 0, null, null, 412303526, 454121976, 438481251, 446048184, 115563, "ERX6430467", "ERS5060068", "ERA6385885", "I3S|European Nucleotide Archive", "I3S", 1, 0.93968, null, 0.02618, null, 0.8003, null, 0.58539, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Portugal", "2020-09-11", "Adult", "Adult", "Pancreas", "Endocrine System"], [10004, "ERR6806873", "ERX6430466", "ERS5060036", "ERP123913", "PRJEB40292", "Multidimensional chromatin profiling of zebrafish and human pancreas to uncover and validate disease related enhancers", "ena-STUDY-I3S-10-09-2020-08:12:35:299-4", "Other", "The pancreas is a central organ for human diseases. Most disease associated alleles overlap with non coding cis regulatory elements of DNA  suggesting that alterations in regulatory sequences contribute to pancreatic diseases. However  the interspecies identification of equivalent cis regulatory elements required for in vivo testing face fundamental challenges  including lack of sequence conservation. In this work  we performed a combined analysis of ATAC seq  ChIP seq  4C seq and HiChIP seq data from zebrafish and human pancreatic cells to identify interspecies functionally equivalent cis regulatory elements  regardless of sequence conservation. To link cis regulation with the expression of target genes in the pancreas  we additionally integrated in our analysis own and public RNA seq data from zebrafish pancreatic cell types. Among several disease associated sequences  we identified a zebrafish ptf1a distal enhancer whose deletion generates pancreatic agenesis  demonstrating the causality of this condition in humans. Our results further demonstrate that this phenotype is a consequence of loss of pancreas progenitor cells. Overall  we show that chromatin profiling can uncover interspecies functional equivalency of cis regulatory elements  contributing to the prediction of new disease causative enhancers and their role in human disease.", "ChIP seq  ATAC seq  HiChIP seq  4C seq  RNA seq|chromatin accessibility|cis regulatory mutations|pancreas and pancreatic diseases|transcriptional enhancers|ENA FIRST PUBLIC:2020 09 11|ENA LAST UPDATE:2021 09 22", null, "Adult zebrafish endocrine pancreas RNA seq replicate4 raw reads", "Zebrafish Endocrine Pancreas RNA seq replicate4", "SAMEA7301477", "I3S", "ENA first public:2021 09 23|ENA last update:2021 09 23|External Id:SAMEA7301477|INSDC center alias:I3S|INSDC center name:I3S|INSDC first public:2021 09 23T20:37:00Z|INSDC last update:2021 09 23T20:37:00Z|INSDC status:public|Submitter Id:Zebrafish Endocrine Pancreas RNA seq replicate4|common name:zebrafish|sample name:Zebrafish Endocrine Pancreas RNA seq replicate4|tissue type:endocrine pancreas principal islet", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing", "ena EXPERIMENT I3S 23 09 2021 16:43:09:330 4", "Endocrine4", "1", "Total RNA extracted with TRIZOL from zebrafish primary pancreatic islet and preprared for sequencing with the TruSeq kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP123913", "Illumina HiSeq 2000 sequencing", "ENA FIRST PUBLIC:2021 09 23|ENA LAST UPDATE:2021 09 23", "Endocrine_Old_2.fastq.gz", "fastq", 1710560600.0, 34211212.0, "ena RUN I3S 23 09 2021 16:43:09:330 4", "0:50 1:0", "A:441527784;C:412091003;G:396100295;T:460728135;N:113383", 50, 0, null, null, 441527784, 412091003, 396100295, 460728135, 113383, "ERX6430466", "ERS5060036", "ERA6385885", "I3S|European Nucleotide Archive", "I3S", 1, 0.95616, null, 0.04334, null, 0.84585, null, 0.17182, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Portugal", "2020-09-11", "Adult", "Adult", "Pancreas", "Endocrine System"], [10005, "ERR6806872", "ERX6430465", "ERS5060035", "ERP123913", "PRJEB40292", "Multidimensional chromatin profiling of zebrafish and human pancreas to uncover and validate disease related enhancers", "ena-STUDY-I3S-10-09-2020-08:12:35:299-4", "Other", "The pancreas is a central organ for human diseases. Most disease associated alleles overlap with non coding cis regulatory elements of DNA  suggesting that alterations in regulatory sequences contribute to pancreatic diseases. However  the interspecies identification of equivalent cis regulatory elements required for in vivo testing face fundamental challenges  including lack of sequence conservation. In this work  we performed a combined analysis of ATAC seq  ChIP seq  4C seq and HiChIP seq data from zebrafish and human pancreatic cells to identify interspecies functionally equivalent cis regulatory elements  regardless of sequence conservation. To link cis regulation with the expression of target genes in the pancreas  we additionally integrated in our analysis own and public RNA seq data from zebrafish pancreatic cell types. Among several disease associated sequences  we identified a zebrafish ptf1a distal enhancer whose deletion generates pancreatic agenesis  demonstrating the causality of this condition in humans. Our results further demonstrate that this phenotype is a consequence of loss of pancreas progenitor cells. Overall  we show that chromatin profiling can uncover interspecies functional equivalency of cis regulatory elements  contributing to the prediction of new disease causative enhancers and their role in human disease.", "ChIP seq  ATAC seq  HiChIP seq  4C seq  RNA seq|chromatin accessibility|cis regulatory mutations|pancreas and pancreatic diseases|transcriptional enhancers|ENA FIRST PUBLIC:2020 09 11|ENA LAST UPDATE:2021 09 22", null, "Adult zebrafish endocrine pancreas RNA seq replicate3 raw reads", "Zebrafish Endocrine Pancreas RNA seq replicate3", "SAMEA7301476", "I3S", "ENA first public:2021 09 23|ENA last update:2021 09 23|External Id:SAMEA7301476|INSDC center alias:I3S|INSDC center name:I3S|INSDC first public:2021 09 23T20:37:00Z|INSDC last update:2021 09 23T20:37:00Z|INSDC status:public|Submitter Id:Zebrafish Endocrine Pancreas RNA seq replicate3|common name:zebrafish|sample name:Zebrafish Endocrine Pancreas RNA seq replicate3|tissue type:endocrine pancreas principal islet", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing", "ena EXPERIMENT I3S 23 09 2021 16:43:09:330 3", "Endocrine3", "1", "Total RNA extracted with TRIZOL from zebrafish primary pancreatic islet and preprared for sequencing with the TruSeq kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP123913", "Illumina HiSeq 2000 sequencing", "ENA FIRST PUBLIC:2021 09 23|ENA LAST UPDATE:2021 09 23", "Endocrine_Old_1.fastq.gz", "fastq", 1979582750.0, 39591655.0, "ena RUN I3S 23 09 2021 16:43:09:330 3", "0:50 1:0", "A:483713055;C:499972514;G:479484600;T:516281513;N:131068", 50, 0, null, null, 483713055, 499972514, 479484600, 516281513, 131068, "ERX6430465", "ERS5060035", "ERA6385885", "I3S|European Nucleotide Archive", "I3S", 1, 0.93722, null, 0.04096, null, 0.7559, null, 0.52069, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Portugal", "2020-09-11", "Adult", "Adult", "Pancreas", "Endocrine System"], [10006, "ERR6806871", "ERX6430464", "ERS5060034", "ERP123913", "PRJEB40292", "Multidimensional chromatin profiling of zebrafish and human pancreas to uncover and validate disease related enhancers", "ena-STUDY-I3S-10-09-2020-08:12:35:299-4", "Other", "The pancreas is a central organ for human diseases. Most disease associated alleles overlap with non coding cis regulatory elements of DNA  suggesting that alterations in regulatory sequences contribute to pancreatic diseases. However  the interspecies identification of equivalent cis regulatory elements required for in vivo testing face fundamental challenges  including lack of sequence conservation. In this work  we performed a combined analysis of ATAC seq  ChIP seq  4C seq and HiChIP seq data from zebrafish and human pancreatic cells to identify interspecies functionally equivalent cis regulatory elements  regardless of sequence conservation. To link cis regulation with the expression of target genes in the pancreas  we additionally integrated in our analysis own and public RNA seq data from zebrafish pancreatic cell types. Among several disease associated sequences  we identified a zebrafish ptf1a distal enhancer whose deletion generates pancreatic agenesis  demonstrating the causality of this condition in humans. Our results further demonstrate that this phenotype is a consequence of loss of pancreas progenitor cells. Overall  we show that chromatin profiling can uncover interspecies functional equivalency of cis regulatory elements  contributing to the prediction of new disease causative enhancers and their role in human disease.", "ChIP seq  ATAC seq  HiChIP seq  4C seq  RNA seq|chromatin accessibility|cis regulatory mutations|pancreas and pancreatic diseases|transcriptional enhancers|ENA FIRST PUBLIC:2020 09 11|ENA LAST UPDATE:2021 09 22", null, "Adult zebrafish endocrine pancreas principal islet RNA seq raw reads replicate2", "Zebrafish Endocrine Pancreas RNA seq replicate2", "SAMEA7301475", "I3S", "ENA first public:2021 09 23|ENA last update:2021 09 23|External Id:SAMEA7301475|INSDC center alias:I3S|INSDC center name:I3S|INSDC first public:2021 09 23T20:37:00Z|INSDC last update:2021 09 23T20:37:00Z|INSDC status:public|Submitter Id:Zebrafish Endocrine Pancreas RNA seq replicate2|common name:zebrafish|sample name:Zebrafish Endocrine Pancreas RNA seq replicate2|tissue type:endocrine pancreas principal islet", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing", "ena EXPERIMENT I3S 23 09 2021 16:43:09:329 2", "Endocrine2", "1", "Total RNA extracted with TRIZOL from zebrafish primary pancreatic islet and preprared for sequencing with the TruSeq kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP123913", "Illumina HiSeq 2000 sequencing", "ENA FIRST PUBLIC:2021 09 23|ENA LAST UPDATE:2021 09 23", "Endocrine_Young_2.fastq.gz", "fastq", 1846315600.0, 36926312.0, "ena RUN I3S 23 09 2021 16:43:09:329 2", "0:50 1:0", "A:466245839;C:453675875;G:433502059;T:492768958;N:122869", 50, 0, null, null, 466245839, 453675875, 433502059, 492768958, 122869, "ERX6430464", "ERS5060034", "ERA6385885", "I3S|European Nucleotide Archive", "I3S", 1, 0.93566, null, 0.06945, null, 0.74065, null, 0.47497, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Portugal", "2020-09-11", "Adult", "Adult", "Pancreas", "Endocrine System"], [10007, "ERR6806870", "ERX6430463", "ERS5060033", "ERP123913", "PRJEB40292", "Multidimensional chromatin profiling of zebrafish and human pancreas to uncover and validate disease related enhancers", "ena-STUDY-I3S-10-09-2020-08:12:35:299-4", "Other", "The pancreas is a central organ for human diseases. Most disease associated alleles overlap with non coding cis regulatory elements of DNA  suggesting that alterations in regulatory sequences contribute to pancreatic diseases. However  the interspecies identification of equivalent cis regulatory elements required for in vivo testing face fundamental challenges  including lack of sequence conservation. In this work  we performed a combined analysis of ATAC seq  ChIP seq  4C seq and HiChIP seq data from zebrafish and human pancreatic cells to identify interspecies functionally equivalent cis regulatory elements  regardless of sequence conservation. To link cis regulation with the expression of target genes in the pancreas  we additionally integrated in our analysis own and public RNA seq data from zebrafish pancreatic cell types. Among several disease associated sequences  we identified a zebrafish ptf1a distal enhancer whose deletion generates pancreatic agenesis  demonstrating the causality of this condition in humans. Our results further demonstrate that this phenotype is a consequence of loss of pancreas progenitor cells. Overall  we show that chromatin profiling can uncover interspecies functional equivalency of cis regulatory elements  contributing to the prediction of new disease causative enhancers and their role in human disease.", "ChIP seq  ATAC seq  HiChIP seq  4C seq  RNA seq|chromatin accessibility|cis regulatory mutations|pancreas and pancreatic diseases|transcriptional enhancers|ENA FIRST PUBLIC:2020 09 11|ENA LAST UPDATE:2021 09 22", null, "Adult zebrafish endocrine pancreas principal islet RNA seq raw reads replicate1", "Zebrafish Endocrine Pancreas RNA seq replicate1", "SAMEA7301474", "I3S", "ENA first public:2021 09 23|ENA last update:2021 09 23|External Id:SAMEA7301474|INSDC center alias:I3S|INSDC center name:I3S|INSDC first public:2021 09 23T20:37:00Z|INSDC last update:2021 09 23T20:37:00Z|INSDC status:public|Submitter Id:Zebrafish Endocrine Pancreas RNA seq replicate1|common name:zebrafish|sample name:Zebrafish Endocrine Pancreas RNA seq replicate1|tissue type:endocrine pancreas principal islet", null, null, null, null, null, null, null, null, "Illumina HiSeq 2000 sequencing", "ena EXPERIMENT I3S 23 09 2021 16:43:09:329 1", "Endocrine1", "1", "Total RNA extracted with TRIZOL from zebrafish primary pancreatic islet and preprared for sequencing with the TruSeq kit", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "SINGLE", "ILLUMINA", "Illumina HiSeq 2000", null, "ERP123913", "Illumina HiSeq 2000 sequencing", "ENA FIRST PUBLIC:2021 09 23|ENA LAST UPDATE:2021 09 23", "Endocrine_Young_1.fastq.gz", "fastq", 1331184450.0, 26623689.0, "ena RUN I3S 23 09 2021 16:43:09:329 1", "0:50 1:0", "A:336761837;C:326693218;G:311881921;T:355763246;N:84228", 50, 0, null, null, 336761837, 326693218, 311881921, 355763246, 84228, "ERX6430463", "ERS5060033", "ERA6385885", "I3S|European Nucleotide Archive", "I3S", 1, 0.93154, null, 0.07422, null, 0.73064, null, 0.53917, null, 50, null, "B", null, "usable mapping rate", "illumina", "hiseq_era", "unknown", "cdna_unspecified", "trueseq", "bulk", "unknown", "unknown", null, "Portugal", "2020-09-11", "Adult", "Adult", "Pancreas", "Endocrine System"], [30776, "SRR28359146", "SRX23964396", "SRS20764037", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 E22", "GSM8150156", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 E22", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150156", "GSM8150156: CSN48 1 03 E22; Danio rerio; RNA Seq", "GSM8150156 r1", "GSM8150156", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53728_Track-95571_R1.fastq.gz L53728_Track-95571_R2.fastq.gz", "fastq fastq", 104878542.0, 1028221.0, "GSM8150156 r1", "0:51 1:51", "A:28863138;C:21525262;G:22453118;T:32031599;N:5425", 51, 51, null, null, 28863138, 21525262, 22453118, 32031599, 5425, "SRX23964396", "SRS20764037", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.77262, 0.78585, 0.0988, 0.10576, 0.98981, 0.98969, 0.68036, 0.67233, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30777, "SRR28359147", "SRX23964395", "SRS20764036", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 E21", "GSM8150155", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 E21", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150155", "GSM8150155: CSN48 1 03 E21; Danio rerio; RNA Seq", "GSM8150155 r1", "GSM8150155", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53727_Track-95291_R1.fastq.gz L53727_Track-95291_R2.fastq.gz", "fastq fastq", 121185282.0, 1188091.0, "GSM8150155 r1", "0:51 1:51", "A:33696023;C:24967708;G:26140769;T:36374401;N:6381", 51, 51, null, null, 33696023, 24967708, 26140769, 36374401, 6381, "SRX23964395", "SRS20764036", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.81964, 0.8273, 0.07915, 0.08503, 0.98072, 0.98082, 0.5136, 0.50712, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30778, "SRR28359148", "SRX23964394", "SRS20764035", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 E20", "GSM8150154", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 E20", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150154", "GSM8150154: CSN48 1 03 E20; Danio rerio; RNA Seq", "GSM8150154 r1", "GSM8150154", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53726_Track-95418_R1.fastq.gz L53726_Track-95418_R2.fastq.gz", "fastq fastq", 72575040.0, 711520.0, "GSM8150154 r1", "0:51 1:51", "A:20943429;C:14224819;G:14955120;T:22447601;N:4071", 51, 51, null, null, 20943429, 14224819, 14955120, 22447601, 4071, "SRX23964394", "SRS20764035", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.82387, 0.83093, 0.08054, 0.08675, 0.98687, 0.98721, 0.5993, 0.61815, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30779, "SRR28359149", "SRX23964393", "SRS20764034", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 E19", "GSM8150153", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 E19", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150153", "GSM8150153: CSN48 1 03 E19; Danio rerio; RNA Seq", "GSM8150153 r1", "GSM8150153", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53725_Track-95634_R1.fastq.gz L53725_Track-95634_R2.fastq.gz", "fastq fastq", 80873046.0, 792873.0, "GSM8150153 r1", "0:51 1:51", "A:23739380;C:13085794;G:15017775;T:29025944;N:4153", 51, 51, null, null, 23739380, 13085794, 15017775, 29025944, 4153, "SRX23964393", "SRS20764034", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.05147, 0.14716, 0.0371, 0.1306, 0.98806, 0.98833, 0.56028, 0.59733, 51, 51, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30780, "SRR28359150", "SRX23964392", "SRS20764033", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 E18", "GSM8150152", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 E18", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150152", "GSM8150152: CSN48 1 03 E18; Danio rerio; RNA Seq", "GSM8150152 r1", "GSM8150152", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53724_Track-95288_R2.fastq.gz L53724_Track-95288_R1.fastq.gz", "fastq fastq", 70936512.0, 695456.0, "GSM8150152 r1", "0:51 1:51", "A:19357090;C:14845900;G:15470063;T:21259791;N:3668", 51, 51, null, null, 19357090, 14845900, 15470063, 21259791, 3668, "SRX23964392", "SRS20764033", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.7423, 0.75148, 0.09603, 0.10377, 0.99066, 0.99062, 0.56913, 0.56951, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30781, "SRR28359151", "SRX23964391", "SRS20764032", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 E17", "GSM8150151", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 E17", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150151", "GSM8150151: CSN48 1 03 E17; Danio rerio; RNA Seq", "GSM8150151 r1", "GSM8150151", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53723_Track-95437_R1.fastq.gz L53723_Track-95437_R2.fastq.gz", "fastq fastq", 55774620.0, 546810.0, "GSM8150151 r1", "0:51 1:51", "A:15911187;C:11099571;G:11653395;T:17107731;N:2736", 51, 51, null, null, 15911187, 11099571, 11653395, 17107731, 2736, "SRX23964391", "SRS20764032", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.78444, 0.80042, 0.1432, 0.15501, 0.98204, 0.98218, 0.51608, 0.51677, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30782, "SRR28359152", "SRX23964390", "SRS20764030", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 E16", "GSM8150150", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 E16", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150150", "GSM8150150: CSN48 1 03 E16; Danio rerio; RNA Seq", "GSM8150150 r1", "GSM8150150", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53722_Track-95347_R1.fastq.gz L53722_Track-95347_R2.fastq.gz", "fastq fastq", 76449000.0, 749500.0, "GSM8150150 r1", "0:51 1:51", "A:22809962;C:14680254;G:15102439;T:23852396;N:3949", 51, 51, null, null, 22809962, 14680254, 15102439, 23852396, 3949, "SRX23964390", "SRS20764030", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.86893, 0.87396, 0.03149, 0.03559, 0.99212, 0.99198, 0.98514, 0.97868, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30783, "SRR28359153", "SRX23964389", "SRS20764029", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 E15", "GSM8150149", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 E15", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150149", "GSM8150149: CSN48 1 03 E15; Danio rerio; RNA Seq", "GSM8150149 r1", "GSM8150149", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53721_Track-95493_R1.fastq.gz L53721_Track-95493_R2.fastq.gz", "fastq fastq", 99461424.0, 975112.0, "GSM8150149 r1", "0:51 1:51", "A:27045437;C:21070936;G:21587770;T:29752188;N:5093", 51, 51, null, null, 27045437, 21070936, 21587770, 29752188, 5093, "SRX23964389", "SRS20764029", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.76782, 0.77265, 0.08688, 0.09118, 0.98681, 0.98664, 0.63246, 0.63378, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30784, "SRR28359154", "SRX23964388", "SRS20764031", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 D14", "GSM8150124", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 D14", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150124", "GSM8150124: CSN48 1 03 D14; Danio rerio; RNA Seq", "GSM8150124 r1", "GSM8150124", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53696_Track-95353_R1.fastq.gz L53696_Track-95353_R2.fastq.gz", "fastq fastq", 69766878.0, 683989.0, "GSM8150124 r1", "0:51 1:51", "A:20239008;C:13266241;G:14104575;T:22153275;N:3779", 51, 51, null, null, 20239008, 13266241, 14104575, 22153275, 3779, "SRX23964388", "SRS20764031", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.78176, 0.78796, 0.18103, 0.1874, 0.98186, 0.9821, 0.67624, 0.66145, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30785, "SRR28359155", "SRX23964387", "SRS20764027", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 D13", "GSM8150123", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 D13", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150123", "GSM8150123: CSN48 1 03 D13; Danio rerio; RNA Seq", "GSM8150123 r1", "GSM8150123", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53695_Track-95522_R1.fastq.gz L53695_Track-95522_R2.fastq.gz", "fastq fastq", 91446672.0, 896536.0, "GSM8150123 r1", "0:51 1:51", "A:26181544;C:17663296;G:18796711;T:28800124;N:4997", 51, 51, null, null, 26181544, 17663296, 18796711, 28800124, 4997, "SRX23964387", "SRS20764027", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.78134, 0.7878, 0.12516, 0.13008, 0.98644, 0.9865, 0.71837, 0.72978, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30786, "SRR28359156", "SRX23964386", "SRS20764028", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 D12", "GSM8150122", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 D12", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150122", "GSM8150122: CSN48 1 03 D12; Danio rerio; RNA Seq", "GSM8150122 r1", "GSM8150122", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53694_Track-95365_R1.fastq.gz L53694_Track-95365_R2.fastq.gz", "fastq fastq", 69981894.0, 686097.0, "GSM8150122 r1", "0:51 1:51", "A:19839934;C:13755443;G:14688765;T:21694242;N:3510", 51, 51, null, null, 19839934, 13755443, 14688765, 21694242, 3510, "SRX23964386", "SRS20764028", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.78924, 0.79909, 0.08205, 0.08909, 0.9847, 0.98445, 0.58412, 0.58962, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30787, "SRR28359157", "SRX23964385", "SRS20764026", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 D11", "GSM8150121", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 D11", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150121", "GSM8150121: CSN48 1 03 D11; Danio rerio; RNA Seq", "GSM8150121 r1", "GSM8150121", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53693_Track-95450_R1.fastq.gz L53693_Track-95450_R2.fastq.gz", "fastq fastq", 69573792.0, 682096.0, "GSM8150121 r1", "0:51 1:51", "A:19025628;C:14356513;G:14950413;T:21237487;N:3751", 51, 51, null, null, 19025628, 14356513, 14950413, 21237487, 3751, "SRX23964385", "SRS20764026", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.75688, 0.77057, 0.12799, 0.13935, 0.98652, 0.98636, 0.64152, 0.63755, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30788, "SRR28359158", "SRX23964384", "SRS20764025", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 D10", "GSM8150120", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 D10", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150120", "GSM8150120: CSN48 1 03 D10; Danio rerio; RNA Seq", "GSM8150120 r1", "GSM8150120", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53692_Track-95404_R1.fastq.gz L53692_Track-95404_R2.fastq.gz", "fastq fastq", 71057382.0, 696641.0, "GSM8150120 r1", "0:51 1:51", "A:19447181;C:14614798;G:15443597;T:21548130;N:3676", 51, 51, null, null, 19447181, 14614798, 15443597, 21548130, 3676, "SRX23964384", "SRS20764025", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.75621, 0.77479, 0.0847, 0.09971, 0.9881, 0.98841, 0.64117, 0.6427, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30789, "SRR28359159", "SRX23964383", "SRS20764024", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 D09", "GSM8150119", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 D09", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150119", "GSM8150119: CSN48 1 03 D09; Danio rerio; RNA Seq", "GSM8150119 r1", "GSM8150119", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53691_Track-95318_R1.fastq.gz L53691_Track-95318_R2.fastq.gz", "fastq fastq", 89856084.0, 880942.0, "GSM8150119 r1", "0:51 1:51", "A:24229021;C:19039299;G:19705052;T:26877901;N:4811", 51, 51, null, null, 24229021, 19039299, 19705052, 26877901, 4811, "SRX23964383", "SRS20764024", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.73565, 0.74513, 0.08918, 0.09582, 0.98882, 0.98875, 0.63639, 0.63689, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30790, "SRR28359160", "SRX23964382", "SRS20764023", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 D08", "GSM8150118", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 D08", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150118", "GSM8150118: CSN48 1 03 D08; Danio rerio; RNA Seq", "GSM8150118 r1", "GSM8150118", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53690_Track-95414_R1.fastq.gz L53690_Track-95414_R2.fastq.gz", "fastq fastq", 51053856.0, 500528.0, "GSM8150118 r1", "0:51 1:51", "A:14497740;C:9903942;G:10595509;T:16053978;N:2687", 51, 51, null, null, 14497740, 9903942, 10595509, 16053978, 2687, "SRX23964382", "SRS20764023", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.76986, 0.77936, 0.11864, 0.12512, 0.97264, 0.97268, 0.5459, 0.55357, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30791, "SRR28359161", "SRX23964381", "SRS20764022", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 D07", "GSM8150117", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 D07", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150117", "GSM8150117: CSN48 1 03 D07; Danio rerio; RNA Seq", "GSM8150117 r1", "GSM8150117", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53689_Track-95464_R1.fastq.gz L53689_Track-95464_R2.fastq.gz", "fastq fastq", 97634706.0, 957203.0, "GSM8150117 r1", "0:51 1:51", "A:27221899;C:20175184;G:21078138;T:29154379;N:5106", 51, 51, null, null, 27221899, 20175184, 21078138, 29154379, 5106, "SRX23964381", "SRS20764022", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.81639, 0.82226, 0.09416, 0.09868, 0.98492, 0.98506, 0.71814, 0.67945, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30792, "SRR28359162", "SRX23964380", "SRS20764021", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C22", "GSM8150108", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C22", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150108", "GSM8150108: CSN48 1 03 C22; Danio rerio; RNA Seq", "GSM8150108 r1", "GSM8150108", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53680_Track-95514_R1.fastq.gz L53680_Track-95514_R2.fastq.gz", "fastq fastq", 85898790.0, 842145.0, "GSM8150108 r1", "0:51 1:51", "A:25113234;C:15409408;G:16800656;T:28570810;N:4682", 51, 51, null, null, 25113234, 15409408, 16800656, 28570810, 4682, "SRX23964380", "SRS20764021", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.73097, 0.73915, 0.16293, 0.16856, 0.97788, 0.97757, 0.69417, 0.68758, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30793, "SRR28359163", "SRX23964379", "SRS20764020", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C21", "GSM8150107", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C21", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150107", "GSM8150107: CSN48 1 03 C21; Danio rerio; RNA Seq", "GSM8150107 r1", "GSM8150107", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53679_Track-95616_R1.fastq.gz L53679_Track-95616_R2.fastq.gz", "fastq fastq", 171200064.0, 1678432.0, "GSM8150107 r1", "0:51 1:51", "A:48056238;C:34021609;G:36283975;T:52829024;N:9218", 51, 51, null, null, 48056238, 34021609, 36283975, 52829024, 9218, "SRX23964379", "SRS20764020", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.74103, 0.76548, 0.09277, 0.10863, 0.98545, 0.9853, 0.58617, 0.58598, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30794, "SRR28359164", "SRX23964378", "SRS20764019", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C20", "GSM8150106", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C20", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150106", "GSM8150106: CSN48 1 03 C20; Danio rerio; RNA Seq", "GSM8150106 r1", "GSM8150106", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53678_Track-95480_R1.fastq.gz L53678_Track-95480_R2.fastq.gz", "fastq fastq", 67253088.0, 659344.0, "GSM8150106 r1", "0:51 1:51", "A:19337100;C:12492945;G:13534630;T:21884840;N:3573", 51, 51, null, null, 19337100, 12492945, 13534630, 21884840, 3573, "SRX23964378", "SRS20764019", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.72673, 0.73997, 0.10543, 0.11545, 0.98096, 0.98039, 0.64224, 0.61696, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30795, "SRR28359165", "SRX23964377", "SRS20764018", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C19", "GSM8150105", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C19", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150105", "GSM8150105: CSN48 1 03 C19; Danio rerio; RNA Seq", "GSM8150105 r1", "GSM8150105", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53677_Track-95374_R1.fastq.gz L53677_Track-95374_R2.fastq.gz", "fastq fastq", 73674396.0, 722298.0, "GSM8150105 r1", "0:51 1:51", "A:19978507;C:15426475;G:17689441;T:20576082;N:3891", 51, 51, null, null, 19978507, 15426475, 17689441, 20576082, 3891, "SRX23964377", "SRS20764018", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.77752, 0.77935, 0.02812, 0.0303, 0.97321, 0.97333, 0.1899, 0.18724, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30796, "SRR28359166", "SRX23964376", "SRS20764017", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C18", "GSM8150104", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C18", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150104", "GSM8150104: CSN48 1 03 C18; Danio rerio; RNA Seq", "GSM8150104 r1", "GSM8150104", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53676_Track-95642_R1.fastq.gz L53676_Track-95642_R2.fastq.gz", "fastq fastq", 215575572.0, 2113486.0, "GSM8150104 r1", "0:51 1:51", "A:62335546;C:39531343;G:42959177;T:70737929;N:11577", 51, 51, null, null, 62335546, 39531343, 42959177, 70737929, 11577, "SRX23964376", "SRS20764017", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.62757, 0.65364, 0.15539, 0.17268, 0.99446, 0.99439, 0.50474, 0.50773, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30797, "SRR28359167", "SRX23964375", "SRS20764016", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C17", "GSM8150103", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C17", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150103", "GSM8150103: CSN48 1 03 C17; Danio rerio; RNA Seq", "GSM8150103 r1", "GSM8150103", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53675_Track-95562_R1.fastq.gz L53675_Track-95562_R2.fastq.gz", "fastq fastq", 84986298.0, 833199.0, "GSM8150103 r1", "0:51 1:51", "A:23272888;C:17266049;G:18271557;T:26171384;N:4420", 51, 51, null, null, 23272888, 17266049, 18271557, 26171384, 4420, "SRX23964375", "SRS20764016", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.72053, 0.73608, 0.07211, 0.08237, 0.98786, 0.98827, 0.59708, 0.59102, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30798, "SRR28359168", "SRX23964374", "SRS20764015", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C16", "GSM8150102", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C16", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150102", "GSM8150102: CSN48 1 03 C16; Danio rerio; RNA Seq", "GSM8150102 r1", "GSM8150102", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53674_Track-95440_R1.fastq.gz L53674_Track-95440_R2.fastq.gz", "fastq fastq", 54376302.0, 533101.0, "GSM8150102 r1", "0:51 1:51", "A:15467523;C:10868690;G:11508252;T:16529091;N:2746", 51, 51, null, null, 15467523, 10868690, 11508252, 16529091, 2746, "SRX23964374", "SRS20764015", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.79732, 0.80686, 0.11376, 0.1223, 0.98088, 0.98133, 0.50056, 0.50786, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30799, "SRR28359169", "SRX23964373", "SRS20764014", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C15", "GSM8150101", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C15", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150101", "GSM8150101: CSN48 1 03 C15; Danio rerio; RNA Seq", "GSM8150101 r1", "GSM8150101", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53673_Track-95645_R1.fastq.gz L53673_Track-95645_R2.fastq.gz", "fastq fastq", 49047108.0, 480854.0, "GSM8150101 r1", "0:51 1:51", "A:14358922;C:7821096;G:9574290;T:17290303;N:2497", 51, 51, null, null, 14358922, 7821096, 9574290, 17290303, 2497, "SRX23964373", "SRS20764014", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.07332, 0.18211, 0.06412, 0.1716, 0.98752, 0.9878, 0.60524, 0.60709, 51, 51, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30800, "SRR28359170", "SRX23964372", "SRS20764012", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C06", "GSM8150092", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C06", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150092", "GSM8150092: CSN48 1 03 C06; Danio rerio; RNA Seq", "GSM8150092 r1", "GSM8150092", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53664_Track-95589_R1.fastq.gz L53664_Track-95589_R2.fastq.gz", "fastq fastq", 121511172.0, 1191286.0, "GSM8150092 r1", "0:51 1:51", "A:33322240;C:24518333;G:25957434;T:37706758;N:6407", 51, 51, null, null, 33322240, 24518333, 25957434, 37706758, 6407, "SRX23964372", "SRS20764012", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.71937, 0.73419, 0.0931, 0.10476, 0.99145, 0.99155, 0.70144, 0.71082, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30801, "SRR28359171", "SRX23964371", "SRS20764011", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C05", "GSM8150091", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C05", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150091", "GSM8150091: CSN48 1 03 C05; Danio rerio; RNA Seq", "GSM8150091 r1", "GSM8150091", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53663_Track-95466_R1.fastq.gz L53663_Track-95466_R2.fastq.gz", "fastq fastq", 52394136.0, 513668.0, "GSM8150091 r1", "0:51 1:51", "A:14630212;C:10551053;G:11807354;T:15402620;N:2897", 51, 51, null, null, 14630212, 10551053, 11807354, 15402620, 2897, "SRX23964371", "SRS20764011", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.76894, 0.77786, 0.06069, 0.06658, 0.98242, 0.98275, 0.2236, 0.17186, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30802, "SRR28359172", "SRX23964370", "SRS20764013", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C04", "GSM8150090", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C04", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150090", "GSM8150090: CSN48 1 03 C04; Danio rerio; RNA Seq", "GSM8150090 r1", "GSM8150090", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53662_Track-95349_R1.fastq.gz L53662_Track-95349_R2.fastq.gz", "fastq fastq", 79670568.0, 781084.0, "GSM8150090 r1", "0:51 1:51", "A:22771076;C:15643583;G:16620665;T:24630900;N:4344", 51, 51, null, null, 22771076, 15643583, 16620665, 24630900, 4344, "SRX23964370", "SRS20764013", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.80374, 0.806, 0.08033, 0.08287, 0.97222, 0.97218, 0.61535, 0.6175, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30803, "SRR28359173", "SRX23964369", "SRS20764010", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C03", "GSM8150089", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C03", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150089", "GSM8150089: CSN48 1 03 C03; Danio rerio; RNA Seq", "GSM8150089 r1", "GSM8150089", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53661_Track-95298_R1.fastq.gz L53661_Track-95298_R2.fastq.gz", "fastq fastq", 66877320.0, 655660.0, "GSM8150089 r1", "0:51 1:51", "A:19121399;C:13054001;G:13795637;T:20902909;N:3374", 51, 51, null, null, 19121399, 13054001, 13795637, 20902909, 3374, "SRX23964369", "SRS20764010", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.79253, 0.80117, 0.0821, 0.08811, 0.9777, 0.97792, 0.69404, 0.69921, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30804, "SRR28359174", "SRX23964368", "SRS20764009", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C02", "GSM8150088", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C02", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150088", "GSM8150088: CSN48 1 03 C02; Danio rerio; RNA Seq", "GSM8150088 r1", "GSM8150088", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53660_Track-95527_R1.fastq.gz L53660_Track-95527_R2.fastq.gz", "fastq fastq", 71446716.0, 700458.0, "GSM8150088 r1", "0:51 1:51", "A:20608056;C:12796514;G:14019234;T:24019077;N:3835", 51, 51, null, null, 20608056, 12796514, 14019234, 24019077, 3835, "SRX23964368", "SRS20764009", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.71157, 0.7141, 0.16048, 0.1627, 0.97792, 0.97845, 0.67132, 0.66879, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30805, "SRR28359175", "SRX23964367", "SRS20764008", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 C01", "GSM8150087", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 C01", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150087", "GSM8150087: CSN48 1 03 C01; Danio rerio; RNA Seq", "GSM8150087 r1", "GSM8150087", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53659_Track-95461_R1.fastq.gz L53659_Track-95461_R2.fastq.gz", "fastq fastq", 64670142.0, 634021.0, "GSM8150087 r1", "0:51 1:51", "A:17956351;C:12818976;G:13752850;T:20138633;N:3332", 51, 51, null, null, 17956351, 12818976, 13752850, 20138633, 3332, "SRX23964367", "SRS20764008", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.74832, 0.7561, 0.09794, 0.10329, 0.98403, 0.98388, 0.40094, 0.40168, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30806, "SRR28359176", "SRX23964366", "SRS20764007", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 B24", "GSM8150086", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 B24", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150086", "GSM8150086: CSN48 1 03 B24; Danio rerio; RNA Seq", "GSM8150086 r1", "GSM8150086", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53658_Track-95603_R1.fastq.gz L53658_Track-95603_R2.fastq.gz", "fastq fastq", 59920920.0, 587460.0, "GSM8150086 r1", "0:51 1:51", "A:17319267;C:9434358;G:12121423;T:21042551;N:3321", 51, 51, null, null, 17319267, 9434358, 12121423, 21042551, 3321, "SRX23964366", "SRS20764007", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.04427, 0.19448, 0.03621, 0.185, 0.98839, 0.98794, 0.61065, 0.61792, 51, 51, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30807, "SRR28359177", "SRX23964365", "SRS20764006", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 B23", "GSM8150085", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 B23", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150085", "GSM8150085: CSN48 1 03 B23; Danio rerio; RNA Seq", "GSM8150085 r1", "GSM8150085", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53657_Track-95283_R2.fastq.gz L53657_Track-95283_R1.fastq.gz", "fastq fastq", 53226966.0, 521833.0, "GSM8150085 r1", "0:51 1:51", "A:14941614;C:10508290;G:11101152;T:16673114;N:2796", 51, 51, null, null, 14941614, 10508290, 11101152, 16673114, 2796, "SRX23964365", "SRS20764006", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.73632, 0.75417, 0.12668, 0.14077, 0.98295, 0.98313, 0.57551, 0.57154, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30808, "SRR28359178", "SRX23964364", "SRS20764005", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 B14", "GSM8150076", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 B14", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150076", "GSM8150076: CSN48 1 03 B14; Danio rerio; RNA Seq", "GSM8150076 r1", "GSM8150076", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53648_Track-95397_R1.fastq.gz L53648_Track-95397_R2.fastq.gz", "fastq fastq", 76392594.0, 748947.0, "GSM8150076 r1", "0:51 1:51", "A:21364045;C:15464328;G:16352646;T:23207328;N:4247", 51, 51, null, null, 21364045, 15464328, 16352646, 23207328, 4247, "SRX23964364", "SRS20764005", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.81786, 0.82381, 0.08799, 0.09132, 0.97642, 0.97666, 0.62228, 0.61882, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30809, "SRR28359179", "SRX23964363", "SRS20764004", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 B13", "GSM8150075", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 B13", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150075", "GSM8150075: CSN48 1 03 B13; Danio rerio; RNA Seq", "GSM8150075 r1", "GSM8150075", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53647_Track-95506_R1.fastq.gz L53647_Track-95506_R2.fastq.gz", "fastq fastq", 36946746.0, 362223.0, "GSM8150075 r1", "0:51 1:51", "A:10280031;C:7534451;G:7970199;T:11160067;N:1998", 51, 51, null, null, 10280031, 7534451, 7970199, 11160067, 1998, "SRX23964363", "SRS20764004", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.79907, 0.80822, 0.09071, 0.0998, 0.98175, 0.98208, 0.68971, 0.64595, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30810, "SRR28359180", "SRX23964362", "SRS20764003", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 B12", "GSM8150074", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 B12", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150074", "GSM8150074: CSN48 1 03 B12; Danio rerio; RNA Seq", "GSM8150074 r1", "GSM8150074", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53646_Track-95453_R1.fastq.gz L53646_Track-95453_R2.fastq.gz", "fastq fastq", 85714476.0, 840338.0, "GSM8150074 r1", "0:51 1:51", "A:23566340;C:17568852;G:18323517;T:26251427;N:4340", 51, 51, null, null, 23566340, 17568852, 18323517, 26251427, 4340, "SRX23964362", "SRS20764003", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.75881, 0.76801, 0.12155, 0.12856, 0.98482, 0.98472, 0.61286, 0.62362, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30811, "SRR28359181", "SRX23964361", "SRS20764000", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 B11", "GSM8150073", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 B11", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150073", "GSM8150073: CSN48 1 03 B11; Danio rerio; RNA Seq", "GSM8150073 r1", "GSM8150073", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53645_Track-95322_R1.fastq.gz L53645_Track-95322_R2.fastq.gz", "fastq fastq", 60880230.0, 596865.0, "GSM8150073 r1", "0:51 1:51", "A:16894823;C:12375429;G:12826233;T:18781441;N:2304", 51, 51, null, null, 16894823, 12375429, 12826233, 18781441, 2304, "SRX23964361", "SRS20764000", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.79235, 0.79169, 0.14033, 0.14537, 0.99149, 0.99115, 0.64974, 0.6485, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30812, "SRR28359182", "SRX23964360", "SRS20764001", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 B10", "GSM8150072", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 B10", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150072", "GSM8150072: CSN48 1 03 B10; Danio rerio; RNA Seq", "GSM8150072 r1", "GSM8150072", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53644_Track-95467_R1.fastq.gz L53644_Track-95467_R2.fastq.gz", "fastq fastq", 98242626.0, 963163.0, "GSM8150072 r1", "0:51 1:51", "A:28157017;C:18311799;G:19643019;T:32125552;N:5239", 51, 51, null, null, 28157017, 18311799, 19643019, 32125552, 5239, "SRX23964360", "SRS20764001", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.69857, 0.71216, 0.26037, 0.27217, 0.98441, 0.98439, 0.59596, 0.58485, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30813, "SRR28359183", "SRX23964359", "SRS20764002", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 B09", "GSM8150071", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 B09", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150071", "GSM8150071: CSN48 1 03 B09; Danio rerio; RNA Seq", "GSM8150071 r1", "GSM8150071", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53643_Track-95356_R1.fastq.gz L53643_Track-95356_R2.fastq.gz", "fastq fastq", 72683262.0, 712581.0, "GSM8150071 r1", "0:51 1:51", "A:19574281;C:15308619;G:16971728;T:20824824;N:3810", 51, 51, null, null, 19574281, 15308619, 16971728, 20824824, 3810, "SRX23964359", "SRS20764002", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.79621, 0.80188, 0.03212, 0.03548, 0.98159, 0.98125, 0.37766, 0.43082, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30814, "SRR28359184", "SRX23964358", "SRS20763999", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 B08", "GSM8150070", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 B08", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150070", "GSM8150070: CSN48 1 03 B08; Danio rerio; RNA Seq", "GSM8150070 r1", "GSM8150070", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53642_Track-95490_R1.fastq.gz L53642_Track-95490_R2.fastq.gz", "fastq fastq", 48215502.0, 472701.0, "GSM8150070 r1", "0:51 1:51", "A:13666032;C:9613857;G:10126815;T:14806354;N:2444", 51, 51, null, null, 13666032, 9613857, 10126815, 14806354, 2444, "SRX23964358", "SRS20763999", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.81988, 0.82624, 0.07106, 0.07582, 0.98175, 0.98108, 0.57602, 0.57798, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30815, "SRR28359185", "SRX23964357", "SRS20763998", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 B07", "GSM8150069", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 B07", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150069", "GSM8150069: CSN48 1 03 B07; Danio rerio; RNA Seq", "GSM8150069 r1", "GSM8150069", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53641_Track-95473_R1.fastq.gz L53641_Track-95473_R2.fastq.gz", "fastq fastq", 76201854.0, 747077.0, "GSM8150069 r1", "0:51 1:51", "A:21033710;C:15513104;G:16188842;T:23462426;N:3772", 51, 51, null, null, 21033710, 15513104, 16188842, 23462426, 3772, "SRX23964357", "SRS20763998", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.74996, 0.76625, 0.11529, 0.12633, 0.98843, 0.98857, 0.67337, 0.6751, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30816, "SRR28359186", "SRX23964356", "SRS20763997", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A22", "GSM8150060", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A22", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150060", "GSM8150060: CSN48 1 03 A22; Danio rerio; RNA Seq", "GSM8150060 r1", "GSM8150060", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53632_Track-95579_R1.fastq.gz L53632_Track-95579_R2.fastq.gz", "fastq fastq", 89337312.0, 875856.0, "GSM8150060 r1", "0:51 1:51", "A:24279913;C:18508911;G:19215997;T:27327967;N:4524", 51, 51, null, null, 24279913, 18508911, 19215997, 27327967, 4524, "SRX23964356", "SRS20763997", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.77307, 0.78079, 0.08474, 0.08819, 0.98496, 0.98555, 0.60362, 0.59775, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30817, "SRR28359187", "SRX23964355", "SRS20763996", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A21", "GSM8150059", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A21", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150059", "GSM8150059: CSN48 1 03 A21; Danio rerio; RNA Seq", "GSM8150059 r1", "GSM8150059", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53631_Track-95546_R1.fastq.gz L53631_Track-95546_R2.fastq.gz", "fastq fastq", 102868938.0, 1008519.0, "GSM8150059 r1", "0:51 1:51", "A:28279557;C:21161886;G:21755461;T:31666533;N:5501", 51, 51, null, null, 28279557, 21161886, 21755461, 31666533, 5501, "SRX23964355", "SRS20763996", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.75403, 0.76348, 0.13488, 0.13978, 0.98675, 0.98723, 0.61677, 0.61653, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30818, "SRR28359188", "SRX23964354", "SRS20763995", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A20", "GSM8150058", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A20", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150058", "GSM8150058: CSN48 1 03 A20; Danio rerio; RNA Seq", "GSM8150058 r1", "GSM8150058", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53630_Track-95543_R1.fastq.gz L53630_Track-95543_R2.fastq.gz", "fastq fastq", 59958762.0, 587831.0, "GSM8150058 r1", "0:51 1:51", "A:17881823;C:10575047;G:11761109;T:19737967;N:2816", 51, 51, null, null, 17881823, 10575047, 11761109, 19737967, 2816, "SRX23964354", "SRS20763995", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.71592, 0.74628, 0.02396, 0.03109, 0.99245, 0.99251, 0.92743, 0.92775, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30819, "SRR28359189", "SRX23964353", "SRS20763994", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A19", "GSM8150057", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A19", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150057", "GSM8150057: CSN48 1 03 A19; Danio rerio; RNA Seq", "GSM8150057 r1", "GSM8150057", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53629_Track-95580_R1.fastq.gz L53629_Track-95580_R2.fastq.gz", "fastq fastq", 83836350.0, 821925.0, "GSM8150057 r1", "0:51 1:51", "A:23566723;C:16925562;G:17589346;T:25750439;N:4280", 51, 51, null, null, 23566723, 16925562, 17589346, 25750439, 4280, "SRX23964353", "SRS20763994", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.73931, 0.75043, 0.11385, 0.12193, 0.98557, 0.98557, 0.63327, 0.63481, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30820, "SRR28359190", "SRX23964352", "SRS20763991", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A18", "GSM8150056", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A18", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150056", "GSM8150056: CSN48 1 03 A18; Danio rerio; RNA Seq", "GSM8150056 r1", "GSM8150056", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53628_Track-95573_R1.fastq.gz L53628_Track-95573_R2.fastq.gz", "fastq fastq", 47908686.0, 469693.0, "GSM8150056 r1", "0:51 1:51", "A:13941866;C:9036815;G:9616683;T:15310786;N:2536", 51, 51, null, null, 13941866, 9036815, 9616683, 15310786, 2536, "SRX23964352", "SRS20763991", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.73338, 0.75945, 0.01988, 0.03615, 0.99064, 0.99062, 0.88101, 0.86842, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30821, "SRR28359191", "SRX23964351", "SRS20763993", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A17", "GSM8150055", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A17", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150055", "GSM8150055: CSN48 1 03 A17; Danio rerio; RNA Seq", "GSM8150055 r1", "GSM8150055", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53627_Track-95648_R1.fastq.gz L53627_Track-95648_R2.fastq.gz", "fastq fastq", 48067296.0, 471248.0, "GSM8150055 r1", "0:51 1:51", "A:14258002;C:7716733;G:8570836;T:17519000;N:2725", 51, 51, null, null, 14258002, 7716733, 8570836, 17519000, 2725, "SRX23964351", "SRS20763993", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.03558, 0.10254, 0.01613, 0.07956, 0.98346, 0.98366, 0.62736, 0.61877, 51, 51, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30822, "SRR28359192", "SRX23964350", "SRS20763990", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A16", "GSM8150054", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A16", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150054", "GSM8150054: CSN48 1 03 A16; Danio rerio; RNA Seq", "GSM8150054 r1", "GSM8150054", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53626_Track-95285_R1.fastq.gz L53626_Track-95285_R2.fastq.gz", "fastq fastq", 64520100.0, 632550.0, "GSM8150054 r1", "0:51 1:51", "A:18529980;C:12360945;G:13126104;T:20499523;N:3548", 51, 51, null, null, 18529980, 12360945, 13126104, 20499523, 3548, "SRX23964350", "SRS20763990", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.79225, 0.79957, 0.09612, 0.09923, 0.98565, 0.98569, 0.68585, 0.68805, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30823, "SRR28359193", "SRX23964349", "SRS20763992", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A15", "GSM8150053", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A15", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150053", "GSM8150053: CSN48 1 03 A15; Danio rerio; RNA Seq", "GSM8150053 r1", "GSM8150053", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53625_Track-95310_R1.fastq.gz L53625_Track-95310_R2.fastq.gz", "fastq fastq", 57464964.0, 563382.0, "GSM8150053 r1", "0:51 1:51", "A:16027163;C:9875941;G:11249945;T:20308844;N:3071", 51, 51, null, null, 16027163, 9875941, 11249945, 20308844, 3071, "SRX23964349", "SRS20763992", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.54793, 0.56093, 0.14665, 0.15373, 0.97423, 0.97374, 0.52447, 0.52236, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30824, "SRR28359194", "SRX23964348", "SRS20763987", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A06", "GSM8150044", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A06", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150044", "GSM8150044: CSN48 1 03 A06; Danio rerio; RNA Seq", "GSM8150044 r1", "GSM8150044", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53616_Track-95627_R1.fastq.gz L53616_Track-95627_R2.fastq.gz", "fastq fastq", 42204234.0, 413767.0, "GSM8150044 r1", "0:51 1:51", "A:12167972;C:7098285;G:8516860;T:14418918;N:2199", 51, 51, null, null, 12167972, 7098285, 8516860, 14418918, 2199, "SRX23964348", "SRS20763987", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.01728, 0.13044, 0.0054, 0.11743, 0.98835, 0.98813, 0.55491, 0.55686, 51, 51, "T", "B", "mate1 technical by mapping diff", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30825, "SRR28359195", "SRX23964347", "SRS20763988", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A05", "GSM8150043", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A05", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150043", "GSM8150043: CSN48 1 03 A05; Danio rerio; RNA Seq", "GSM8150043 r1", "GSM8150043", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53615_Track-95570_R1.fastq.gz L53615_Track-95570_R2.fastq.gz", "fastq fastq", 60711318.0, 595209.0, "GSM8150043 r1", "0:51 1:51", "A:16616267;C:12702862;G:12998651;T:18390580;N:2958", 51, 51, null, null, 16616267, 12702862, 12998651, 18390580, 2958, "SRX23964347", "SRS20763988", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.74171, 0.75015, 0.09281, 0.09756, 0.98196, 0.98135, 0.61594, 0.6145, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30826, "SRR28359196", "SRX23964346", "SRS20763989", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A04", "GSM8150042", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A04", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150042", "GSM8150042: CSN48 1 03 A04; Danio rerio; RNA Seq", "GSM8150042 r1", "GSM8150042", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53614_Track-95647_R1.fastq.gz L53614_Track-95647_R2.fastq.gz", "fastq fastq", 25999596.0, 254898.0, "GSM8150042 r1", "0:51 1:51", "A:7736401;C:4216599;G:4559315;T:9486137;N:1144", 51, 51, null, null, 7736401, 4216599, 4559315, 9486137, 1144, "SRX23964346", "SRS20763989", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.02907, 0.09609, 0.00643, 0.06909, 0.98064, 0.98019, 0.59162, 0.61734, 51, 51, "B", "B", "mate1-mate2 similar by mapping diff", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30827, "SRR28359197", "SRX23964345", "SRS20763985", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A03", "GSM8150041", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A03", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150041", "GSM8150041: CSN48 1 03 A03; Danio rerio; RNA Seq", "GSM8150041 r1", "GSM8150041", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53613_Track-95474_R1.fastq.gz L53613_Track-95474_R2.fastq.gz", "fastq fastq", 74797620.0, 733310.0, "GSM8150041 r1", "0:51 1:51", "A:20648666;C:15688335;G:16673606;T:21782908;N:4105", 51, 51, null, null, 20648666, 15688335, 16673606, 21782908, 4105, "SRX23964345", "SRS20763985", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.80802, 0.81136, 0.0624, 0.06518, 0.97928, 0.9792, 0.60689, 0.60864, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30828, "SRR28359198", "SRX23964344", "SRS20763986", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A02", "GSM8150040", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A02", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150040", "GSM8150040: CSN48 1 03 A02; Danio rerio; RNA Seq", "GSM8150040 r1", "GSM8150040", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53612_Track-95321_R1.fastq.gz L53612_Track-95321_R2.fastq.gz", "fastq fastq", 67447806.0, 661253.0, "GSM8150040 r1", "0:51 1:51", "A:19270398;C:12732437;G:13850269;T:21591414;N:3288", 51, 51, null, null, 19270398, 12732437, 13850269, 21591414, 3288, "SRX23964344", "SRS20763986", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.73104, 0.75072, 0.13206, 0.14505, 0.97626, 0.97648, 0.54313, 0.47631, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30829, "SRR28359199", "SRX23964343", "SRS20763984", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 1 03 A01", "GSM8150039", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing", "CSN48 1 03 A01", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48 1", "GSM8150039", "GSM8150039: CSN48 1 03 A01; Danio rerio; RNA Seq", "GSM8150039 r1", "GSM8150039", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53611_Track-95455_R1.fastq.gz L53611_Track-95455_R2.fastq.gz", "fastq fastq", 77367510.0, 758505.0, "GSM8150039 r1", "0:51 1:51", "A:21309760;C:15498935;G:16220238;T:24334550;N:4027", 51, 51, null, null, 21309760, 15498935, 16220238, 24334550, 4027, "SRX23964343", "SRS20763984", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.72269, 0.73574, 0.13644, 0.14483, 0.97693, 0.97678, 0.64678, 0.65363, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30830, "SRR28359200", "SRX23964342", "SRS20763983", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "RNA 02 G11", "GSM8150038", null, "tissue:beta cells|cell type:beta cells|treatment: |geo loc name:missing|collection date:missing", "RNA 02 G11", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment: ", "GSM8150038", "GSM8150038: RNA 02 G11; Danio rerio; RNA Seq", "GSM8150038 r1", "GSM8150038", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53609_Track-94987_R1.fastq.gz L53609_Track-94987_R2.fastq.gz", "fastq fastq", 61240392.0, 600396.0, "GSM8150038 r1", "0:51 1:51", "A:16426906;C:13172096;G:13880608;T:17757981;N:2801", 51, 51, null, null, 16426906, 13172096, 13880608, 17757981, 2801, "SRX23964342", "SRS20763983", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.00606, 0.00847, 0.00186, 0.00408, 0.99391, 0.9934, 0.61997, 0.6247, 51, 51, "T", "T", "mates < 9% mapping rate", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30831, "SRR28359201", "SRX23964341", "SRS20763982", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 G10", "GSM8150037", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 G10", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150037", "GSM8150037: CSN24 02 G10; Danio rerio; RNA Seq", "GSM8150037 r1", "GSM8150037", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53608_Track-95181_R1.fastq.gz L53608_Track-95181_R2.fastq.gz", "fastq fastq", 108348684.0, 1062242.0, "GSM8150037 r1", "0:51 1:51", "A:30298833;C:22284186;G:23138502;T:32621431;N:5732", 51, 51, null, null, 30298833, 22284186, 23138502, 32621431, 5732, "SRX23964341", "SRS20763982", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.81665, 0.82026, 0.10911, 0.111, 0.9903, 0.99022, 0.58375, 0.60752, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30832, "SRR28359202", "SRX23964340", "SRS20763981", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 F17", "GSM8150020", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 F17", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150020", "GSM8150020: CSN24 02 F17; Danio rerio; RNA Seq", "GSM8150020 r1", "GSM8150020", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53591_Track-95206_R1.fastq.gz L53591_Track-95206_R2.fastq.gz", "fastq fastq", 86279862.0, 845881.0, "GSM8150020 r1", "0:51 1:51", "A:24115181;C:17714131;G:19964968;T:24482228;N:3354", 51, 51, null, null, 24115181, 17714131, 19964968, 24482228, 3354, "SRX23964340", "SRS20763981", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.80701, 0.81935, 0.05082, 0.05296, 0.99001, 0.98916, 0.20716, 0.20255, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30833, "SRR28359203", "SRX23964339", "SRS20763980", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 F16", "GSM8150019", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 F16", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150019", "GSM8150019: CSN24 02 F16; Danio rerio; RNA Seq", "GSM8150019 r1", "GSM8150019", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53590_Track-95236_R1.fastq.gz L53590_Track-95236_R2.fastq.gz", "fastq fastq", 52062228.0, 510414.0, "GSM8150019 r1", "0:51 1:51", "A:14020180;C:10872213;G:11468886;T:15698256;N:2693", 51, 51, null, null, 14020180, 10872213, 11468886, 15698256, 2693, "SRX23964339", "SRS20763980", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.73918, 0.76144, 0.08666, 0.10335, 0.99164, 0.99172, 0.62609, 0.62128, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30834, "SRR28359204", "SRX23964338", "SRS20763979", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 F15", "GSM8150018", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 F15", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150018", "GSM8150018: CSN24 02 F15; Danio rerio; RNA Seq", "GSM8150018 r1", "GSM8150018", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53589_Track-95141_R1.fastq.gz L53589_Track-95141_R2.fastq.gz", "fastq fastq", 77157492.0, 756446.0, "GSM8150018 r1", "0:51 1:51", "A:21605693;C:15599581;G:16432852;T:23515612;N:3754", 51, 51, null, null, 21605693, 15599581, 16432852, 23515612, 3754, "SRX23964338", "SRS20763979", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.74476, 0.74702, 0.10865, 0.11076, 0.98652, 0.9862, 0.44979, 0.44751, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30835, "SRR28359205", "SRX23964337", "SRS20763978", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 F14", "GSM8150017", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 F14", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150017", "GSM8150017: CSN24 02 F14; Danio rerio; RNA Seq", "GSM8150017 r1", "GSM8150017", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53588_Track-95126_R1.fastq.gz L53588_Track-95126_R2.fastq.gz", "fastq fastq", 53797452.0, 527426.0, "GSM8150017 r1", "0:51 1:51", "A:15116683;C:10915128;G:11435804;T:16327174;N:2663", 51, 51, null, null, 15116683, 10915128, 11435804, 16327174, 2663, "SRX23964337", "SRS20763978", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.79782, 0.80616, 0.07566, 0.08202, 0.98723, 0.9876, 0.63965, 0.6399, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30836, "SRR28359206", "SRX23964336", "SRS20763977", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 F13", "GSM8150016", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 F13", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150016", "GSM8150016: CSN24 02 F13; Danio rerio; RNA Seq", "GSM8150016 r1", "GSM8150016", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53587_Track-95258_R1.fastq.gz L53587_Track-95258_R2.fastq.gz", "fastq fastq", 94360302.0, 925101.0, "GSM8150016 r1", "0:51 1:51", "A:25592436;C:19902737;G:20439380;T:28420944;N:4805", 51, 51, null, null, 25592436, 19902737, 20439380, 28420944, 4805, "SRX23964336", "SRS20763977", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.77378, 0.78037, 0.12707, 0.1297, 0.99206, 0.99182, 0.61719, 0.62462, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30837, "SRR28359207", "SRX23964335", "SRS20763976", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 F12", "GSM8150015", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 F12", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150015", "GSM8150015: CSN24 02 F12; Danio rerio; RNA Seq", "GSM8150015 r1", "GSM8150015", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53586_Track-95184_R1.fastq.gz L53586_Track-95184_R2.fastq.gz", "fastq fastq", 62354844.0, 611322.0, "GSM8150015 r1", "0:51 1:51", "A:16894234;C:13102917;G:13985509;T:18368881;N:3303", 51, 51, null, null, 16894234, 13102917, 13985509, 18368881, 3303, "SRX23964335", "SRS20763976", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.77413, 0.77856, 0.0563, 0.06016, 0.97601, 0.97546, 0.52098, 0.52409, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30838, "SRR28359208", "SRX23964334", "SRS20763975", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 F11", "GSM8150014", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 F11", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150014", "GSM8150014: CSN24 02 F11; Danio rerio; RNA Seq", "GSM8150014 r1", "GSM8150014", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53585_Track-95282_R1.fastq.gz L53585_Track-95282_R2.fastq.gz", "fastq fastq", 134866134.0, 1322217.0, "GSM8150014 r1", "0:51 1:51", "A:36606180;C:28153427;G:29082203;T:41017328;N:6996", 51, 51, null, null, 36606180, 28153427, 29082203, 41017328, 6996, "SRX23964334", "SRS20763975", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.78038, 0.78847, 0.103, 0.10673, 0.99022, 0.99026, 0.63847, 0.64824, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30839, "SRR28359209", "SRX23964333", "SRS20763973", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 F10", "GSM8150013", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 F10", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150013", "GSM8150013: CSN24 02 F10; Danio rerio; RNA Seq", "GSM8150013 r1", "GSM8150013", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53584_Track-94961_R1.fastq.gz L53584_Track-94961_R2.fastq.gz", "fastq fastq", 57289218.0, 561659.0, "GSM8150013 r1", "0:51 1:51", "A:15654996;C:12067784;G:13483977;T:16079504;N:2957", 51, 51, null, null, 15654996, 12067784, 13483977, 16079504, 2957, "SRX23964333", "SRS20763973", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.78546, 0.78801, 0.03275, 0.0365, 0.98451, 0.98484, 0.18731, 0.18714, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30840, "SRR28359210", "SRX23964332", "SRS20763974", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 F01", "GSM8150004", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 F01", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150004", "GSM8150004: CSN24 02 F01; Danio rerio; RNA Seq", "GSM8150004 r1", "GSM8150004", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53575_Track-95159_R1.fastq.gz L53575_Track-95159_R2.fastq.gz", "fastq fastq", 120780648.0, 1184124.0, "GSM8150004 r1", "0:51 1:51", "A:32680701;C:24675276;G:25705829;T:37712522;N:6320", 51, 51, null, null, 32680701, 24675276, 25705829, 37712522, 6320, "SRX23964332", "SRS20763974", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.74064, 0.74741, 0.09215, 0.09447, 0.98746, 0.98764, 0.6778, 0.66742, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30841, "SRR28359211", "SRX23964331", "SRS20763972", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E24", "GSM8150003", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E24", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150003", "GSM8150003: CSN24 02 E24; Danio rerio; RNA Seq", "GSM8150003 r1", "GSM8150003", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53574_Track-95235_R1.fastq.gz L53574_Track-95235_R2.fastq.gz", "fastq fastq", 125646150.0, 1231825.0, "GSM8150003 r1", "0:51 1:51", "A:34906622;C:25653760;G:26843705;T:38235468;N:6595", 51, 51, null, null, 34906622, 25653760, 26843705, 38235468, 6595, "SRX23964331", "SRS20763972", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.79136, 0.79591, 0.11781, 0.1209, 0.99275, 0.99261, 0.59738, 0.60471, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30842, "SRR28359212", "SRX23964330", "SRS20763971", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E23", "GSM8150002", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E23", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150002", "GSM8150002: CSN24 02 E23; Danio rerio; RNA Seq", "GSM8150002 r1", "GSM8150002", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53573_Track-95222_R1.fastq.gz L53573_Track-95222_R2.fastq.gz", "fastq fastq", 102050286.0, 1000493.0, "GSM8150002 r1", "0:51 1:51", "A:28856641;C:20351972;G:21425480;T:31410880;N:5313", 51, 51, null, null, 28856641, 20351972, 21425480, 31410880, 5313, "SRX23964330", "SRS20763971", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.77509, 0.78297, 0.13105, 0.13959, 0.98275, 0.98236, 0.57536, 0.56425, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30843, "SRR28359213", "SRX23964329", "SRS20763970", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E22", "GSM8150001", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E22", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150001", "GSM8150001: CSN24 02 E22; Danio rerio; RNA Seq", "GSM8150001 r1", "GSM8150001", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53572_Track-95208_R1.fastq.gz L53572_Track-95208_R2.fastq.gz", "fastq fastq", 93339384.0, 915092.0, "GSM8150001 r1", "0:51 1:51", "A:24881598;C:19769054;G:20522772;T:28161697;N:4263", 51, 51, null, null, 24881598, 19769054, 20522772, 28161697, 4263, "SRX23964329", "SRS20763970", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.79486, 0.79815, 0.0588, 0.06066, 0.99391, 0.99375, 0.61742, 0.62514, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30844, "SRR28359214", "SRX23964328", "SRS20763969", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E21", "GSM8150000", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E21", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8150000", "GSM8150000: CSN24 02 E21; Danio rerio; RNA Seq", "GSM8150000 r1", "GSM8150000", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53571_Track-95100_R1.fastq.gz L53571_Track-95100_R2.fastq.gz", "fastq fastq", 81079596.0, 794898.0, "GSM8150000 r1", "0:51 1:51", "A:22871371;C:16291248;G:17451823;T:24461074;N:4080", 51, 51, null, null, 22871371, 16291248, 17451823, 24461074, 4080, "SRX23964328", "SRS20763969", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.76031, 0.78541, 0.13661, 0.15665, 0.98693, 0.98683, 0.524, 0.53378, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30845, "SRR28359215", "SRX23964327", "SRS20763968", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E20", "GSM8149999", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E20", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149999", "GSM8149999: CSN24 02 E20; Danio rerio; RNA Seq", "GSM8149999 r1", "GSM8149999", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53570_Track-95253_R1.fastq.gz L53570_Track-95253_R2.fastq.gz", "fastq fastq", 110380524.0, 1082162.0, "GSM8149999 r1", "0:51 1:51", "A:29965518;C:23223337;G:24025378;T:33160713;N:5578", 51, 51, null, null, 29965518, 23223337, 24025378, 33160713, 5578, "SRX23964327", "SRS20763968", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.80146, 0.80582, 0.09058, 0.09163, 0.99153, 0.99155, 0.59927, 0.60152, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30846, "SRR28359216", "SRX23964326", "SRS20763967", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E19", "GSM8149998", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E19", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149998", "GSM8149998: CSN24 02 E19; Danio rerio; RNA Seq", "GSM8149998 r1", "GSM8149998", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53569_Track-95196_R1.fastq.gz L53569_Track-95196_R2.fastq.gz", "fastq fastq", 69006060.0, 676530.0, "GSM8149998 r1", "0:51 1:51", "A:18708547;C:14544311;G:15053174;T:20696747;N:3281", 51, 51, null, null, 18708547, 14544311, 15053174, 20696747, 3281, "SRX23964326", "SRS20763967", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.79623, 0.80729, 0.10708, 0.11406, 0.98378, 0.98388, 0.63419, 0.64935, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30847, "SRR28359217", "SRX23964325", "SRS20763965", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E18", "GSM8149997", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E18", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149997", "GSM8149997: CSN24 02 E18; Danio rerio; RNA Seq", "GSM8149997 r1", "GSM8149997", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53568_Track-95096_R1.fastq.gz L53568_Track-95096_R2.fastq.gz", "fastq fastq", 99737232.0, 977816.0, "GSM8149997 r1", "0:51 1:51", "A:26637824;C:21626541;G:22174230;T:29293509;N:5128", 51, 51, null, null, 26637824, 21626541, 22174230, 29293509, 5128, "SRX23964325", "SRS20763965", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.81323, 0.82081, 0.05142, 0.05469, 0.98796, 0.98778, 0.60536, 0.61653, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30848, "SRR28359218", "SRX23964324", "SRS20763964", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E09", "GSM8149988", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E09", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149988", "GSM8149988: CSN24 02 E09; Danio rerio; RNA Seq", "GSM8149988 r1", "GSM8149988", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53559_Track-95194_R1.fastq.gz L53559_Track-95194_R2.fastq.gz", "fastq fastq", 163634418.0, 1604259.0, "GSM8149988 r1", "0:51 1:51", "A:44510452;C:34830439;G:36037266;T:48247463;N:8798", 51, 51, null, null, 44510452, 34830439, 36037266, 48247463, 8798, "SRX23964324", "SRS20763964", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.81161, 0.81908, 0.10681, 0.11049, 0.98541, 0.98508, 0.61527, 0.61898, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30849, "SRR28359219", "SRX23964323", "SRS20763966", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E08", "GSM8149987", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E08", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149987", "GSM8149987: CSN24 02 E08; Danio rerio; RNA Seq", "GSM8149987 r1", "GSM8149987", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53558_Track-95209_R1.fastq.gz L53558_Track-95209_R2.fastq.gz", "fastq fastq", 57472104.0, 563452.0, "GSM8149987 r1", "0:51 1:51", "A:15516019;C:11920636;G:12819202;T:17212927;N:3320", 51, 51, null, null, 15516019, 11920636, 12819202, 17212927, 3320, "SRX23964323", "SRS20763966", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.77941, 0.80237, 0.11606, 0.13655, 0.98843, 0.98802, 0.63415, 0.6372, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30850, "SRR28359220", "SRX23964322", "SRS20763962", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E07", "GSM8149986", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E07", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149986", "GSM8149986: CSN24 02 E07; Danio rerio; RNA Seq", "GSM8149986 r1", "GSM8149986", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53557_Track-95060_R1.fastq.gz L53557_Track-95060_R2.fastq.gz", "fastq fastq", 84329724.0, 826762.0, "GSM8149986 r1", "0:51 1:51", "A:23213591;C:17425659;G:18317338;T:25368637;N:4499", 51, 51, null, null, 23213591, 17425659, 18317338, 25368637, 4499, "SRX23964322", "SRS20763962", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.77061, 0.77727, 0.10045, 0.10712, 0.98121, 0.98068, 0.56772, 0.60046, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30851, "SRR28359221", "SRX23964321", "SRS20763963", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E06", "GSM8149985", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E06", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149985", "GSM8149985: CSN24 02 E06; Danio rerio; RNA Seq", "GSM8149985 r1", "GSM8149985", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53556_Track-95157_R1.fastq.gz L53556_Track-95157_R2.fastq.gz", "fastq fastq", 90084054.0, 883177.0, "GSM8149985 r1", "0:51 1:51", "A:24491087;C:18640738;G:19792986;T:27154578;N:4665", 51, 51, null, null, 24491087, 18640738, 19792986, 27154578, 4665, "SRX23964321", "SRS20763963", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.78647, 0.79489, 0.08515, 0.09456, 0.98849, 0.98857, 0.63931, 0.66604, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30852, "SRR28359222", "SRX23964320", "SRS20763961", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E05", "GSM8149984", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E05", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149984", "GSM8149984: CSN24 02 E05; Danio rerio; RNA Seq", "GSM8149984 r1", "GSM8149984", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53555_Track-94966_R1.fastq.gz L53555_Track-94966_R2.fastq.gz", "fastq fastq", 125602392.0, 1231396.0, "GSM8149984 r1", "0:51 1:51", "A:34921102;C:25913321;G:27652602;T:37108830;N:6537", 51, 51, null, null, 34921102, 25913321, 27652602, 37108830, 6537, "SRX23964320", "SRS20763961", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.80211, 0.81923, 0.07468, 0.08725, 0.98096, 0.98141, 0.6085, 0.60656, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30853, "SRR28359223", "SRX23964319", "SRS20763960", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E04", "GSM8149983", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E04", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149983", "GSM8149983: CSN24 02 E04; Danio rerio; RNA Seq", "GSM8149983 r1", "GSM8149983", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53554_Track-95175_R1.fastq.gz L53554_Track-95175_R2.fastq.gz", "fastq fastq", 138146148.0, 1354374.0, "GSM8149983 r1", "0:51 1:51", "A:37652275;C:28730826;G:30345873;T:41409667;N:7507", 51, 51, null, null, 37652275, 28730826, 30345873, 41409667, 7507, "SRX23964319", "SRS20763960", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.78803, 0.80111, 0.11623, 0.12673, 0.98693, 0.98691, 0.59478, 0.59626, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30854, "SRR28359224", "SRX23964318", "SRS20763959", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E03", "GSM8149982", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E03", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149982", "GSM8149982: CSN24 02 E03; Danio rerio; RNA Seq", "GSM8149982 r1", "GSM8149982", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53553_Track-95229_R1.fastq.gz L53553_Track-95229_R2.fastq.gz", "fastq fastq", 43340718.0, 424909.0, "GSM8149982 r1", "0:51 1:51", "A:12414298;C:8301959;G:8947793;T:13674457;N:2211", 51, 51, null, null, 12414298, 8301959, 8947793, 13674457, 2211, "SRX23964318", "SRS20763959", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.77187, 0.78279, 0.09554, 0.10234, 0.96988, 0.96907, 0.68183, 0.68002, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30855, "SRR28359225", "SRX23964317", "SRS20763957", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 E02", "GSM8149981", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 E02", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149981", "GSM8149981: CSN24 02 E02; Danio rerio; RNA Seq", "GSM8149981 r1", "GSM8149981", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53552_Track-95270_R1.fastq.gz L53552_Track-95270_R2.fastq.gz", "fastq fastq", 54583770.0, 535135.0, "GSM8149981 r1", "0:51 1:51", "A:15121800;C:11180657;G:11546149;T:16733328;N:1836", 51, 51, null, null, 15121800, 11180657, 11546149, 16733328, 1836, "SRX23964317", "SRS20763957", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.75063, 0.74772, 0.08009, 0.08597, 0.99226, 0.99174, 0.60001, 0.64726, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30856, "SRR28359226", "SRX23964316", "SRS20763958", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 D17", "GSM8149972", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 D17", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149972", "GSM8149972: CSN24 02 D17; Danio rerio; RNA Seq", "GSM8149972 r1", "GSM8149972", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53543_Track-95221_R1.fastq.gz L53543_Track-95221_R2.fastq.gz", "fastq fastq", 96396936.0, 945068.0, "GSM8149972 r1", "0:51 1:51", "A:27035084;C:19609718;G:20326917;T:29420013;N:5204", 51, 51, null, null, 27035084, 19609718, 20326917, 29420013, 5204, "SRX23964316", "SRS20763958", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.78575, 0.79348, 0.10773, 0.11065, 0.9907, 0.99084, 0.62675, 0.61548, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30857, "SRR28359227", "SRX23964315", "SRS20763956", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 D16", "GSM8149971", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 D16", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149971", "GSM8149971: CSN24 02 D16; Danio rerio; RNA Seq", "GSM8149971 r1", "GSM8149971", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53542_Track-95264_R1.fastq.gz L53542_Track-95264_R2.fastq.gz", "fastq fastq", 96110826.0, 942263.0, "GSM8149971 r1", "0:51 1:51", "A:25901191;C:20364226;G:20916556;T:28924084;N:4769", 51, 51, null, null, 25901191, 20364226, 20916556, 28924084, 4769, "SRX23964315", "SRS20763956", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.79762, 0.80618, 0.11011, 0.11552, 0.99375, 0.99346, 0.66749, 0.66702, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30858, "SRR28359228", "SRX23964314", "SRS20763955", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 D15", "GSM8149970", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 D15", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149970", "GSM8149970: CSN24 02 D15; Danio rerio; RNA Seq", "GSM8149970 r1", "GSM8149970", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53541_Track-95201_R1.fastq.gz L53541_Track-95201_R2.fastq.gz", "fastq fastq", 112977342.0, 1107621.0, "GSM8149970 r1", "0:51 1:51", "A:31316984;C:23180824;G:23954892;T:34518677;N:5965", 51, 51, null, null, 31316984, 23180824, 23954892, 34518677, 5965, "SRX23964314", "SRS20763955", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.80236, 0.81225, 0.09467, 0.09898, 0.98798, 0.98792, 0.59556, 0.60165, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30859, "SRR28359229", "SRX23964313", "SRS20763954", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 D14", "GSM8149969", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 D14", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149969", "GSM8149969: CSN24 02 D14; Danio rerio; RNA Seq", "GSM8149969 r1", "GSM8149969", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53540_Track-95238_R1.fastq.gz L53540_Track-95238_R2.fastq.gz", "fastq fastq", 102919530.0, 1009015.0, "GSM8149969 r1", "0:51 1:51", "A:28150047;C:21734378;G:22351140;T:30678625;N:5340", 51, 51, null, null, 28150047, 21734378, 22351140, 30678625, 5340, "SRX23964313", "SRS20763954", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.80227, 0.81098, 0.09599, 0.10126, 0.98916, 0.98912, 0.60568, 0.60515, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30860, "SRR28359230", "SRX23964312", "SRS20763952", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 D13", "GSM8149968", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 D13", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149968", "GSM8149968: CSN24 02 D13; Danio rerio; RNA Seq", "GSM8149968 r1", "GSM8149968", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53539_Track-95168_R1.fastq.gz L53539_Track-95168_R2.fastq.gz", "fastq fastq", 107626320.0, 1055160.0, "GSM8149968 r1", "0:51 1:51", "A:30184242;C:21948089;G:22592041;T:32896285;N:5663", 51, 51, null, null, 30184242, 21948089, 22592041, 32896285, 5663, "SRX23964312", "SRS20763952", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.80741, 0.81187, 0.11977, 0.12059, 0.98744, 0.98748, 0.63704, 0.63196, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30861, "SRR28359231", "SRX23964311", "SRS20763953", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 D12", "GSM8149967", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 D12", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149967", "GSM8149967: CSN24 02 D12; Danio rerio; RNA Seq", "GSM8149967 r1", "GSM8149967", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53538_Track-95179_R1.fastq.gz L53538_Track-95179_R2.fastq.gz", "fastq fastq", 88955730.0, 872115.0, "GSM8149967 r1", "0:51 1:51", "A:24731175;C:18348363;G:19047295;T:26824445;N:4452", 51, 51, null, null, 24731175, 18348363, 19047295, 26824445, 4452, "SRX23964311", "SRS20763953", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.78236, 0.78697, 0.14225, 0.14606, 0.98928, 0.98884, 0.57192, 0.56974, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30862, "SRR28359232", "SRX23964310", "SRS20763951", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN24 02 D11", "GSM8149966", null, "tissue:beta cells|cell type:beta cells|treatment:CSN24|geo loc name:missing|collection date:missing", "CSN24 02 D11", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN24", "GSM8149966", "GSM8149966: CSN24 02 D11; Danio rerio; RNA Seq", "GSM8149966 r1", "GSM8149966", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53537_Track-95146_R1.fastq.gz L53537_Track-95146_R2.fastq.gz", "fastq fastq", 133286052.0, 1306726.0, "GSM8149966 r1", "0:51 1:51", "A:36989885;C:27812176;G:28601689;T:39874764;N:7538", 51, 51, null, null, 36989885, 27812176, 28601689, 39874764, 7538, "SRX23964310", "SRS20763951", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.83708, 0.84176, 0.09809, 0.10024, 0.98717, 0.98699, 0.55011, 0.62275, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"], [30863, "SRR28359059", "SRX23964309", "SRS20763949", "SRP495499", "PRJNA1088503", "Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity", "GSE261729", "Transcriptome Analysis", "Beta cells are remarkably heterogeneous. However  beta cells response to chronic stress at a single cell level remains largely unknown. Here  we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably  we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis  inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3  a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment  pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19  RNA 02 G11  RNA 03 P18 do not correspond to the other samples eg  Ctrl  CNS24  CNS48 2.", null, "pubmed:39762647", null, "CSN48 2 03 I03", "GSM8150233", null, "tissue:beta cells|cell type:beta cells|treatment:CSN48|geo loc name:missing|collection date:missing", "CSN48 2 03 I03", "bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42  d GRCz11   gunzip  A sam  t 20   use sarray=1   input buffer size=500000   output buffer size=500000  B 5  n 1  m 0.6  s EnsemblGene 95.ss.GRCz11.iit  N 0 Counts were created with featureCounts v2.0.1; featureCounts  a EnsemblGene 95.GRCz11.TR.gtf  s 0  p  o  bfx1391.GRCz11.e95.tsv  Q 1  T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts  where each column represent either a sample or gene information start  end  strand  geneid and each row is a gene. Cells countain fragments per gene per sample.", "beta cells", null, "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "cell type:beta cells|treatment:CSN48", "GSM8150233", "GSM8150233: CSN48 2 03 I03; Danio rerio; RNA Seq", "GSM8150233 r1", "GSM8150233", "1", "The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 \u00b5l freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/\u00b5l murine RNase inhibitor NEB. post the sort  the plate is shortly centrifuged and lysed cells stored at  80\u00b0C.post thawing the plate  the cells are immediately mixed with 0.5 \u00b5l of a primer mix containing 5 mM dNTP Invitrogen  0.5 \u00b5M dT primer*  2 U RNase Inhibitor NEB  ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 \u00b0C  followed by reverse transcription at 42 \u00b0C for 90 min post filling up to 1.5 \u00b5l with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen  1 M betaine  5 mM DTT  6 mM MgCl2  1 \u00b5M TSO primer*  2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis  the reverse transcriptase is inactivated at 70\u00b0C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98\u00b0C for 3 min  23 cycles [98\u00b0C 20 sec  67\u00b0C 15 sec  72\u00b0C 6 min] and final elongation at 72\u00b0C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris  20 mM EDTA  18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 \u00b5l is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer  0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55\u00b0C for 5 min. Subsequently  Illumina indices are added during PCR 72\u00b0C 3 min  98\u00b0C 30 sec  13 cycles [98\u00b0C 10 sec  63\u00b0C 20 sec  72\u00b0C 1 min]  72\u00b0C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 \u00b5M dual indexing primers. post PCR  libraries are quantified with AccuBlue Broad range chemistry  equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE  S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN  where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG  where rG stands for ribo guanosine; UP primer: C6 aminolinker  AAGCAGTGGTATCAACGCAGAGT", null, "RNA-Seq", "TRANSCRIPTOMIC", "cDNA", "PAIRED", "ILLUMINA", "Illumina NovaSeq 6000", null, "SRP495499", null, "loader:fastq load.py", "L53805_Track-95554_R1.fastq.gz L53805_Track-95554_R2.fastq.gz", "fastq fastq", 95352048.0, 934824.0, "GSM8150233 r1", "0:51 1:51", "A:25907556;C:20064750;G:20900153;T:28474753;N:4836", 51, 51, null, null, 25907556, 20064750, 20900153, 28474753, 4836, "SRX23964309", "SRS20763949", "SRA1825239", "Dresden-concept Genome Center, TU Dresden", "Ninov Lab, CRTD, TU Dresden", 2, 0.79315, 0.80387, 0.08817, 0.09613, 0.98632, 0.98595, 0.63242, 0.63879, 51, 51, "B", "B", "biological fallback assumption", "illumina", "novaseq_era", "unknown", "random_priming", "unknown", "sc", "single_cell_plate", "smartseq", null, "Germany", "2024-03-15", "Undetermined", "Larval", "Pancreas", "Endocrine System"]], "truncated": false, "filtered_table_rows_count": 2521, "expanded_columns": [], "expandable_columns": [], "columns": ["rowid", "run.accession", "experiment.accession", "sample.accession", "study.accession", "bioproject", "study.title", "study.alias", "study.type", "study.abstract", "study.attributes", "study.PMIDs", "sample.description", "sample.title", "sample.alias", "sample.centername", "sample.attributes", "GEOsample.title", "GEOsample.dataprocessing", "GEOsample.source", "GEOsample.treatmentprotocol", "GEOsample.extractprotocol", "GEOsample.growthprotocol", "GEOsample.characteristics", "GEOsample.accession", "experiment.title", "experiment.alias", "experiment.library_name", "experiment.design_description", "experiment.library_construction_protocol", "experiment.attributes", "experiment.library_strategy", "experiment.library_source", "experiment.library_selection", "experiment.library_layout", "experiment.platform", "experiment.instrument_model", "experiment.spot_descriptor", "experiment.study_ref", "run.title", "run.attributes", "run.filename", "run.semantic_name", "run.total_bases", "run.total_spots", "run.alias", "run.read_lengths", "run.base_counts", "run.r1_length", "run.r2_length", "run.r3_length", "run.r4_length", "run.Acount", "run.Ccount", "run.Gcount", "run.Tcount", "run.Ncount", "run.experiment", "run.pool_member", "submission.accession", "submission.srasource", "submission.bioprojectsource", "seqdetective.n_mates", "seqdetective.mapping_rate.mate1", "seqdetective.mapping_rate.mate2", "seqdetective.nofeature_rate.mate1", "seqdetective.nofeature_rate.mate2", "seqdetective.sparsity.mate1", "seqdetective.sparsity.mate2", "seqdetective.pos_strand_rate.mate1", "seqdetective.pos_strand_rate.mate2", "seqdetective.readlen.mate1", "seqdetective.readlen.mate2", "seqdetective.judgement.mate1", "seqdetective.judgement.mate2", "seqdetective.judgement.reason", "platform_family", "instrument_generation", "read_bias", "selection_class", "prep_kit", "sc_or_bulk", "tech_class", "technology", "tech_variant", "submission.bioprojectsource.country", "earliest_date", "devstage_curation", "devstage_curation_coarse", "tissue_curation", "tissue_curation_coarse"], "primary_keys": [], "units": {}, "query": {"sql": "select rowid, [run.accession], [experiment.accession], [sample.accession], [study.accession], bioproject, [study.title], [study.alias], [study.type], [study.abstract], [study.attributes], [study.PMIDs], [sample.description], [sample.title], [sample.alias], [sample.centername], [sample.attributes], [GEOsample.title], [GEOsample.dataprocessing], [GEOsample.source], [GEOsample.treatmentprotocol], [GEOsample.extractprotocol], [GEOsample.growthprotocol], [GEOsample.characteristics], [GEOsample.accession], [experiment.title], [experiment.alias], [experiment.library_name], [experiment.design_description], [experiment.library_construction_protocol], [experiment.attributes], [experiment.library_strategy], [experiment.library_source], [experiment.library_selection], [experiment.library_layout], [experiment.platform], [experiment.instrument_model], [experiment.spot_descriptor], [experiment.study_ref], [run.title], [run.attributes], [run.filename], [run.semantic_name], [run.total_bases], [run.total_spots], [run.alias], [run.read_lengths], [run.base_counts], [run.r1_length], [run.r2_length], [run.r3_length], [run.r4_length], [run.Acount], [run.Ccount], [run.Gcount], [run.Tcount], [run.Ncount], [run.experiment], [run.pool_member], [submission.accession], [submission.srasource], [submission.bioprojectsource], [seqdetective.n_mates], [seqdetective.mapping_rate.mate1], [seqdetective.mapping_rate.mate2], [seqdetective.nofeature_rate.mate1], [seqdetective.nofeature_rate.mate2], [seqdetective.sparsity.mate1], [seqdetective.sparsity.mate2], [seqdetective.pos_strand_rate.mate1], [seqdetective.pos_strand_rate.mate2], [seqdetective.readlen.mate1], [seqdetective.readlen.mate2], [seqdetective.judgement.mate1], [seqdetective.judgement.mate2], [seqdetective.judgement.reason], platform_family, instrument_generation, read_bias, selection_class, prep_kit, sc_or_bulk, tech_class, technology, tech_variant, [submission.bioprojectsource.country], earliest_date, devstage_curation, devstage_curation_coarse, tissue_curation, tissue_curation_coarse from run_metadata where \"experiment.library_strategy\" = :p0 and \"tissue_curation\" = :p1 order by rowid limit 101", "params": {"p0": "RNA-Seq", "p1": "Pancreas"}}, "facet_results": {"experiment.library_strategy": {"name": "experiment.library_strategy", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas", "results": [{"value": "RNA-Seq", "label": "RNA-Seq", "count": 2521, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?tissue_curation=Pancreas", "selected": true}], "truncated": false}, "experiment.library_source": {"name": "experiment.library_source", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas", "results": [{"value": "TRANSCRIPTOMIC", "label": "TRANSCRIPTOMIC", "count": 2286, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&experiment.library_source=TRANSCRIPTOMIC", "selected": false}, {"value": "TRANSCRIPTOMIC SINGLE CELL", "label": "TRANSCRIPTOMIC SINGLE CELL", "count": 235, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&experiment.library_source=TRANSCRIPTOMIC+SINGLE+CELL", "selected": false}], "truncated": false}, "experiment.library_selection": {"name": "experiment.library_selection", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas", "results": [{"value": "cDNA", "label": "cDNA", "count": 2509, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&experiment.library_selection=cDNA", "selected": false}, {"value": "Oligo-dT", "label": "Oligo-dT", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&experiment.library_selection=Oligo-dT", "selected": false}, {"value": "unspecified", "label": "unspecified", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&experiment.library_selection=unspecified", "selected": false}], "truncated": false}, "experiment.library_layout": {"name": "experiment.library_layout", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas", "results": [{"value": "SINGLE", "label": "SINGLE", "count": 1748, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&experiment.library_layout=SINGLE", "selected": false}, {"value": "PAIRED", "label": "PAIRED", "count": 773, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&experiment.library_layout=PAIRED", "selected": false}], "truncated": false}, "experiment.platform": {"name": "experiment.platform", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas", "results": [{"value": "ILLUMINA", "label": "ILLUMINA", "count": 2521, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&experiment.platform=ILLUMINA", "selected": false}], "truncated": false}, "devstage_curation_coarse": {"name": "devstage_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas", "results": [{"value": "Adult", "label": "Adult", "count": 1367, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&devstage_curation_coarse=Adult", "selected": false}, {"value": "Larval", "label": "Larval", "count": 707, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&devstage_curation_coarse=Larval", "selected": false}, {"value": "Juvenile", "label": "Juvenile", "count": 417, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&devstage_curation_coarse=Juvenile", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 24, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&devstage_curation_coarse=Undetermined", "selected": false}, {"value": "Embryo", "label": "Embryo", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&devstage_curation_coarse=Embryo", "selected": false}], "truncated": false}, "devstage_curation": {"name": "devstage_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas", "results": [{"value": "Adult", "label": "Adult", "count": 1367, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&devstage_curation=Adult", "selected": false}, {"value": "Undetermined", "label": "Undetermined", "count": 721, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&devstage_curation=Undetermined", "selected": false}, {"value": "Juvenile", "label": "Juvenile", "count": 417, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&devstage_curation=Juvenile", "selected": false}, {"value": "Larval", "label": "Larval", "count": 10, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&devstage_curation=Larval", "selected": false}, {"value": "Pharyngula", "label": "Pharyngula", "count": 6, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&devstage_curation=Pharyngula", "selected": false}], "truncated": false}, "tissue_curation_coarse": {"name": "tissue_curation_coarse", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas", "results": [{"value": "Endocrine System", "label": "Endocrine System", "count": 2521, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&tissue_curation_coarse=Endocrine+System", "selected": false}], "truncated": false}, "tissue_curation": {"name": "tissue_curation", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas", "results": [{"value": "Pancreas", "label": "Pancreas", "count": 2521, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq", "selected": true}], "truncated": false}, "technology": {"name": "technology", "type": "column", "hideable": false, "toggle_url": "/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas", "results": [{"value": "smartseq", "label": "smartseq", "count": 2431, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&technology=smartseq", "selected": false}, {"value": "10x", "label": "10x", "count": 51, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&technology=10x", "selected": false}, {"value": "unknown", "label": "unknown", "count": 39, "toggle_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&technology=unknown", "selected": false}], "truncated": false}}, "suggested_facets": [], "next": "30863", "next_url": "http://metadata.rnaquarium.org/metadata/run_metadata.json?experiment.library_strategy=RNA-Seq&tissue_curation=Pancreas&_next=30863", "private": false, "allow_execute_sql": true, "query_ms": 141.80435899834265}